ID: 1131122314

View in Genome Browser
Species Human (GRCh38)
Location 15:89830259-89830281
Sequence AGCCAGCTGGGAAACTGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131122314_1131122320 6 Left 1131122314 15:89830259-89830281 CCCACTCAGTTTCCCAGCTGGCT No data
Right 1131122320 15:89830288-89830310 CATCTGCCCCCAGAGATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131122314 Original CRISPR AGCCAGCTGGGAAACTGAGT GGG (reversed) Intergenic
No off target data available for this crispr