ID: 1131123318

View in Genome Browser
Species Human (GRCh38)
Location 15:89836982-89837004
Sequence CGTCTGTAACCTCTGTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 430}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131123318 Original CRISPR CGTCTGTAACCTCTGTGCTC TGG Intronic
900017672 1:164376-164398 CGTCTGTAATCTCAGCACTCTGG + Intergenic
900047931 1:522972-522994 CGTCTGTAATCTCAGCACTCTGG + Intergenic
900070149 1:764836-764858 CGTCTGTAATCTCAGCACTCTGG + Intergenic
901578143 1:10217575-10217597 CGCCTGTAACCTCAGCACTCTGG - Intronic
902045357 1:13519843-13519865 CGTCTGTAATCTCAGTACTTTGG - Intergenic
902272850 1:15316967-15316989 GGTCTAGAACCTCTGAGCTCAGG - Intronic
902759971 1:18574787-18574809 CACCTGTAACCTCAGTGCTTTGG + Intergenic
903701844 1:25254692-25254714 CGCCTGTAATCCCAGTGCTCTGG - Intronic
905427917 1:37898919-37898941 CGTCTGTAATCCCAGTACTCTGG + Intronic
907022126 1:51078166-51078188 CGCCTGTAATCTCAGTGCTCTGG - Intergenic
907164613 1:52399226-52399248 CGTCTGTAATCACAGTACTCTGG + Intronic
908383086 1:63615022-63615044 CTGCTGTAACCACTGGGCTCTGG - Intronic
909937563 1:81570647-81570669 CGTCTGTAATCTCAGTACTTTGG - Intronic
911428374 1:97751515-97751537 CGCCTGTAACCTCAATGCTTTGG + Intronic
915435984 1:155906843-155906865 CGCCTGTAATCTCAGTGCTTTGG + Intronic
915728882 1:158038584-158038606 CGTCTGTAATCTCAGTGTTTTGG - Intronic
916547524 1:165819872-165819894 CATCTGTAATCTCTGCACTCTGG + Intronic
917875889 1:179286551-179286573 CGCCTGTAATCTCAGTGCTTTGG - Intergenic
918318299 1:183341415-183341437 CGTCTGTAATCCCAGTGCTATGG + Intronic
919225305 1:194690738-194690760 GGTCTCGAACTTCTGTGCTCAGG + Intergenic
919412249 1:197259931-197259953 GGTCTTTAACTTCTGGGCTCAGG - Intergenic
920146790 1:203868270-203868292 GGTCTCTAACTTCTGAGCTCAGG + Intronic
920307090 1:205025886-205025908 CATCTGTAATCTCAGTGCTTTGG - Intergenic
920530228 1:206696441-206696463 CGCCTGTAATCTCAGTGCTTTGG + Intronic
921099153 1:211913127-211913149 GGTCTGTAAACTGTGTGTTCTGG - Intergenic
921231796 1:213080779-213080801 GGTCTTTAACACCTGTGCTCAGG + Intronic
922265854 1:223982871-223982893 CGTCTGTAATCTCAGCACTCTGG + Intergenic
922773419 1:228202359-228202381 CATCTGTAACCTTGGTGCTTTGG + Intergenic
923156346 1:231282678-231282700 CGCCTGTAATCTCAGTGCTTTGG + Intergenic
923567239 1:235085402-235085424 CGCCTGTAACCTCAGCACTCTGG - Intergenic
923623847 1:235598347-235598369 CGTCTGTAATCCCAGTGCTTTGG + Intronic
924347694 1:243087823-243087845 CGTCTGTAATCTCAGCACTCTGG + Intergenic
924464759 1:244290107-244290129 TGTCTGTAATCTCAGTGCTTTGG - Intergenic
1064661096 10:17608745-17608767 CGTCTGTAACCCCAGTACTTTGG - Intronic
1064787902 10:18918465-18918487 CGTCTGTAATCCCAGTGCTTTGG - Intergenic
1065504406 10:26414916-26414938 TGTCTATAATCTCAGTGCTCTGG + Intergenic
1065626256 10:27632053-27632075 CATCTGTAATCTCAGTGCTTTGG + Intergenic
1066166682 10:32796070-32796092 CCTCTGTCTCCTCTGTCCTCAGG + Intronic
1066229103 10:33414593-33414615 CACCTGTAATCTCAGTGCTCTGG + Intergenic
1066277948 10:33887237-33887259 CATCTGTAATCTCAGTGCTTTGG - Intergenic
1066476079 10:35748679-35748701 CGGCTGTAATCCCAGTGCTCTGG + Intergenic
1066588975 10:36971620-36971642 CCTCTCTAGCCACTGTGCTCTGG - Intergenic
1069975040 10:72206142-72206164 CGCCTGTAATCCCTGTGCTTTGG + Intronic
1071578172 10:86745539-86745561 CGTCTGTAATCTCAGTACTTTGG + Intergenic
1072309666 10:94142254-94142276 TGCCTGTAATCTCTGTACTCTGG + Intronic
1072382563 10:94890391-94890413 CGTCTGTAATCTCTGCACTTTGG - Intergenic
1073474922 10:103746567-103746589 CGTCTGTAATCCCAGTACTCTGG - Intronic
1075335138 10:121603319-121603341 CGCCTGTAATCTCAGTGCTTTGG - Intergenic
1076847220 10:133075231-133075253 CCTCTGTGACCTCTGTGCCGAGG + Intronic
1076974269 11:159568-159590 CGTCTGTAATCTCAGCACTCTGG + Intergenic
1077086952 11:757874-757896 CGCCTGTAACCCCAGTGCTTTGG + Intronic
1077582582 11:3426308-3426330 CGCCTGTAATCTCAGTGCTTTGG + Intergenic
1077813620 11:5663983-5664005 CGTCTAGAACCTCTGACCTCAGG - Exonic
1078213844 11:9294276-9294298 CGTCTGGAACCCCTGACCTCAGG - Intronic
1078611526 11:12823810-12823832 CCTCTGTAATCTCTGTGCCTGGG - Intronic
1080187060 11:29502738-29502760 CGTCTGTAATCCCAGTGCTTTGG + Intergenic
1080532574 11:33191198-33191220 GGTCTCTAACCCCTGAGCTCCGG + Intergenic
1081341596 11:41934564-41934586 CTTCTCTGACCTCAGTGCTCTGG + Intergenic
1082834212 11:57639923-57639945 GGTCAGTGACCTCTCTGCTCTGG - Intergenic
1083395448 11:62388448-62388470 GGTCTCAAACCTCTGAGCTCAGG - Intronic
1083905460 11:65666681-65666703 GGTCTCGAACCTCTGAGCTCAGG + Intergenic
1087266667 11:96069142-96069164 GGTCTGTAACTTCTGGCCTCAGG + Intronic
1089227446 11:116937942-116937964 CGCCTGTAATCCCAGTGCTCTGG + Intronic
1089332166 11:117697274-117697296 GGTTTCTAACCTCTGTGTTCAGG + Intronic
1089406997 11:118205923-118205945 CGTGTTTCACTTCTGTGCTCTGG + Exonic
1090200278 11:124849323-124849345 TGTCTGTAATCTCAGTGCTTTGG + Intergenic
1090527616 11:127554393-127554415 CGTCTGTAATCTCAGTACTTTGG - Intergenic
1091491849 12:939408-939430 CGTCTGTAATCCCAGTGCTTTGG - Intronic
1091611946 12:2018039-2018061 CGTCTGCAACCTCTGGCCTGTGG - Intronic
1092086280 12:5765063-5765085 GGTCTCTAGACTCTGTGCTCAGG - Intronic
1092343195 12:7693727-7693749 GGTCTCTAACTTCTGAGCTCAGG - Intronic
1092822785 12:12368702-12368724 CACCTGTAATCTCAGTGCTCTGG - Intronic
1093314584 12:17632594-17632616 GGTCTCTAACTTCTGAGCTCAGG + Intergenic
1096137983 12:49218667-49218689 CGCCTGTAACCCCTATGCTTTGG - Intronic
1097994519 12:65872963-65872985 GGTCTTTCACATCTGTGCTCTGG + Intronic
1100153077 12:91764922-91764944 GGTTTGAAACCTTTGTGCTCGGG - Intergenic
1101512472 12:105405609-105405631 CGTCTGTAATCCCAGTGCTTTGG - Intergenic
1102327091 12:111995481-111995503 CGTCTGTAATCTCTGCACTTTGG + Intronic
1102381279 12:112468801-112468823 CGCCTGTAATCTCAGTGCTTTGG + Intronic
1102906516 12:116679981-116680003 CGTCTGTAATCCCAGTGCTTTGG - Intergenic
1103223271 12:119264540-119264562 CGCCTGTAATCTCAGTGCTTTGG + Intergenic
1103322086 12:120098142-120098164 CGCCTGTAATCTCAGTGCTTTGG - Intronic
1103980426 12:124733561-124733583 CGCCTGTAATCTCAGTGCTTTGG - Intergenic
1103983485 12:124751796-124751818 TGTCTGTAATCTCAGTGCTTTGG - Intergenic
1104470066 12:129022808-129022830 TGTCTATACCCTCAGTGCTCTGG + Intergenic
1104709875 12:130977924-130977946 CGTTTGTAATCACTGTGCTGTGG - Intronic
1104823843 12:131694409-131694431 CGTGTGCAGCCTCTGTGCACGGG - Intergenic
1105604261 13:21913598-21913620 CGTCTGTAATCCCAGTGCTTTGG + Intergenic
1105807934 13:23968451-23968473 CGCCTGTAATCTCAGTACTCTGG - Intergenic
1106657473 13:31761212-31761234 CGTCTGTAACCTCAGCACTTTGG - Intronic
1107862658 13:44675418-44675440 TGTCTCGAACTTCTGTGCTCAGG - Intergenic
1108684495 13:52807026-52807048 CGCCTGTAATCCCTGTACTCAGG + Intergenic
1110778627 13:79439040-79439062 CGTCTGTAATCTCAGTGCTTTGG - Intergenic
1111231546 13:85350701-85350723 TGTCTGTAATCCCTGTGCTTTGG + Intergenic
1111847239 13:93526450-93526472 TGTCTGTTACTTCTGTGATCTGG - Intronic
1112103069 13:96211190-96211212 CATCTGTAATCTCAGTACTCTGG - Intronic
1113591712 13:111506175-111506197 CCTCTGTAGTCTCTGAGCTCAGG + Intergenic
1114492442 14:23111815-23111837 CGTCTGTAATCCCAGTGCTTTGG - Intergenic
1114657696 14:24325919-24325941 CTTCTGTGCCCTCTGTTCTCTGG - Intronic
1115234050 14:31191096-31191118 GGTCTGTAACCCCAGTGCTTTGG - Intronic
1115710935 14:36049998-36050020 TGCCTGTAACCTCAGTGCTTTGG + Intergenic
1115938491 14:38582590-38582612 CGTCTGTAATCCCAGTGCTTTGG + Intergenic
1116982841 14:51189458-51189480 CGCCTGTAATCTCAGTGCTTTGG - Intergenic
1117147549 14:52850236-52850258 CGTCTGTAATCCCAGTGCTTTGG - Intergenic
1118245978 14:64111147-64111169 GGTCTCTAACTTCTGGGCTCAGG - Intronic
1119056060 14:71421330-71421352 CGCCTGTAACCCCAGTGCTTTGG + Intronic
1119157864 14:72428109-72428131 CATCTGGAACATCTGTTCTCTGG - Intronic
1120472706 14:84946589-84946611 CGTCTGTAATCCCAGTGCTTTGG - Intergenic
1121186316 14:91973764-91973786 CGCCTGTAACCCCAGTGCTTTGG + Intronic
1122181431 14:99957729-99957751 CGCCTGTAATCTCAGTGCTTAGG - Intergenic
1125004434 15:34801178-34801200 GGTCTCTAACCCCTGAGCTCAGG + Intergenic
1125665962 15:41430521-41430543 GGTCTTGAACCTCTGAGCTCAGG - Intronic
1126950032 15:53870764-53870786 CTTCTTAAACCTCTGTGCTTTGG - Intergenic
1127272435 15:57413500-57413522 AGTCTGGAACTTCTGGGCTCAGG + Intronic
1128608011 15:69051951-69051973 CGCCTGTAATCTCAGTGCTTTGG + Intronic
1128963473 15:72033065-72033087 GGTCTGGAACCCCTGAGCTCAGG + Intronic
1130113297 15:80984354-80984376 GGTCTTTAACTCCTGTGCTCAGG - Intronic
1130699327 15:86163174-86163196 TGTCTGTAATCTCAGTGCTTTGG + Intronic
1131123318 15:89836982-89837004 CGTCTGTAACCTCTGTGCTCTGG + Intronic
1131231512 15:90663338-90663360 CTTCTTTTACATCTGTGCTCAGG - Intergenic
1131463541 15:92637030-92637052 CATCTGTATCCTCTGTGCCCTGG + Intronic
1131668069 15:94591148-94591170 AGTTTGTACCCTCTGAGCTCTGG + Intergenic
1132901327 16:2256298-2256320 CGCCTGTAATCCCAGTGCTCTGG + Intronic
1133094318 16:3431001-3431023 CGTCTGTAATCCCAGTGCTTTGG - Intronic
1133351163 16:5101543-5101565 CGCCTGTAATCTCAGTGCTTTGG + Intergenic
1133647471 16:7777644-7777666 CGTCTGTAACCTCAGTCCTTTGG + Intergenic
1133792891 16:9022867-9022889 CATCTGTAATCTCAGTGCTTTGG + Intergenic
1134126623 16:11620592-11620614 CGTCTGTAATCCCAGTGCTTTGG - Intronic
1135090733 16:19514012-19514034 AATCTCTAATCTCTGTGCTCAGG - Intronic
1135701331 16:24635033-24635055 CTTCTGTAATCCCAGTGCTCTGG - Intergenic
1135820986 16:25685638-25685660 CGCCTGTAATCCCGGTGCTCTGG - Intergenic
1136045882 16:27614567-27614589 CGCCTGTAATCTCAGTGCTCTGG - Intronic
1136048880 16:27636755-27636777 CCTCTGTGAGCTGTGTGCTCTGG + Intronic
1136582087 16:31158877-31158899 CGTCTGTAATCCCAGTGGTCTGG + Intergenic
1136610076 16:31360774-31360796 CGCCTGTAATCCCTGTGCTTTGG - Intronic
1136611206 16:31366774-31366796 CGTCTGTAATCCCAGTGCTTTGG - Intronic
1137451396 16:48577894-48577916 CCCCAGTAACCTCTGTGCACGGG + Intronic
1140344897 16:74203616-74203638 CGCCTGTAATCTCAGTGCTTTGG + Intergenic
1140746646 16:77986522-77986544 CATCTGTCAACTCTGAGCTCGGG - Intergenic
1140860790 16:79016007-79016029 CGTCTGTAATCCCAGCGCTCTGG - Intronic
1141776648 16:86127606-86127628 CTTCTGTAAACTCTGCGCTCGGG + Intergenic
1142025966 16:87813847-87813869 CGCCTGTAATCCCTGTGCTTTGG + Intergenic
1142445991 16:90138081-90138103 CGTCTGTAATCTCAGCACTCTGG - Intergenic
1142497143 17:312041-312063 CGTCTGTAATCCCAGTGCTTTGG + Intronic
1142831881 17:2555206-2555228 CGTGTGTAAGCTCAATGCTCTGG - Intergenic
1143194595 17:5066235-5066257 CGTCTGTAATCCCAGTGCTTTGG + Intergenic
1144505836 17:15829963-15829985 CATCTGTAATCCCAGTGCTCTGG - Intergenic
1144591277 17:16525885-16525907 TGTCTGTAATCTCAGTACTCTGG - Intergenic
1144870936 17:18370410-18370432 CATGTGTATCCTTTGTGCTCAGG + Intergenic
1145170010 17:20647895-20647917 CATCTGTAATCCCAGTGCTCTGG - Intergenic
1145775924 17:27528636-27528658 CGTCTGTAATCCCAGTGCTTTGG + Intronic
1145862261 17:28220918-28220940 TGTCTGTAATCCCAGTGCTCTGG - Intergenic
1145951814 17:28824400-28824422 CGTCTGAAACTCCTGGGCTCAGG + Intronic
1146442257 17:32907589-32907611 CGTCTGTAATCCCTGTACTTTGG + Intergenic
1146931566 17:36781885-36781907 CTTCTGTAAACTCAGTGCTTTGG - Intergenic
1147214592 17:38891832-38891854 CGCCTGTAATCCCTGTGCTCTGG + Intronic
1147604719 17:41768000-41768022 CGTCTGTAAACTCAGCGCTTGGG + Intronic
1147707735 17:42439122-42439144 GGTCTAGAACCTCTGGGCTCAGG + Intergenic
1147764236 17:42822939-42822961 CGCCTGTAATCTCAGTGCTTTGG - Intronic
1148799933 17:50217672-50217694 CGCCTGGAATCTCAGTGCTCTGG - Intergenic
1148926666 17:51092651-51092673 CGCCTGTAATCTCAGTGCTTTGG + Intronic
1149199644 17:54168033-54168055 TGTCTGTAACCTCAGTACTTTGG - Intergenic
1149675726 17:58459745-58459767 CGTCTGTAAACCCAGTGCTTTGG - Intronic
1149889371 17:60372906-60372928 CATCTGTAATCTCAGAGCTCTGG + Intronic
1150331071 17:64294809-64294831 CGTCTGTAATCTCTATACTTTGG - Intergenic
1150372981 17:64657473-64657495 GGTCTTGAACTTCTGTGCTCAGG - Intronic
1150751999 17:67872834-67872856 CGCCTGTAACCCCAGTGCTTTGG + Intronic
1151379267 17:73713605-73713627 CGACTGTAATCTCAGTGCTTTGG + Intergenic
1152619287 17:81353590-81353612 CGTCTGTAACCCCAGCACTCTGG - Intergenic
1152709545 17:81864196-81864218 CATCTGTAACCCCAGTGCTTTGG - Intergenic
1152933827 17:83124532-83124554 CGTCTGCAACCTCTGGGCTGTGG + Intergenic
1152933836 17:83124574-83124596 CATCTGCAACCTCTGGGCTGTGG + Intergenic
1152933845 17:83124615-83124637 CGTCTGCATCCTCTGGGCTGTGG + Intergenic
1152933853 17:83124657-83124679 CGTCTGCAACCTCTGGGCTGTGG + Intergenic
1152933861 17:83124699-83124721 CGTCTGCAACCTCTGGGCTGTGG + Intergenic
1152933869 17:83124741-83124763 CGTCTGCAACCTCTGGGCTGTGG + Intergenic
1152933877 17:83124783-83124805 CGTCTGCAACCTCTGGGCTGTGG + Intergenic
1152933886 17:83124825-83124847 CATCTGCAACCTCTGGGCTGTGG + Intergenic
1152933895 17:83124867-83124889 CGTCTGCAACCTCTGGGCTGTGG + Intergenic
1152933903 17:83124909-83124931 CGTCTGCAACCTCTGGGCTGTGG + Intergenic
1152933912 17:83124951-83124973 TGTCTGCAACCTCTGGGCTGTGG + Intergenic
1152933919 17:83124993-83125015 CGTCTGCAACCTCTGGGCTGTGG + Intergenic
1152933936 17:83125076-83125098 CGTCTGCAACCTCTGGGCTGTGG + Intergenic
1152933946 17:83125118-83125140 CGTCTGCAACCTCTGGGCTGTGG + Intergenic
1152933955 17:83125160-83125182 CATCTGCAACCTCTGGGCTGTGG + Intergenic
1152933965 17:83125202-83125224 CATCTGCAACCTCTGGGCTGTGG + Intergenic
1152933974 17:83125244-83125266 CATCTGCAACCTCTGGGCTGTGG + Intergenic
1153273539 18:3346772-3346794 TGTCTGTAATCTCAGTGCTTTGG + Intergenic
1154324662 18:13381326-13381348 CGCCTGTAACCCCAGTGCTTTGG - Intronic
1156360920 18:36383872-36383894 TGTGTTCAACCTCTGTGCTCTGG + Intronic
1156458286 18:37306976-37306998 CGTTTGCCACCTCTGTGGTCTGG + Intronic
1156602260 18:38622985-38623007 CATCTGTAACATCTGTACTGAGG + Intergenic
1157165961 18:45358700-45358722 TGACTGTAATCTCTGTACTCAGG - Intronic
1157668978 18:49512396-49512418 CGTCTGTAATCCCAGTGCTTTGG - Intergenic
1158341541 18:56471900-56471922 TGCCTGTAATCTCAGTGCTCTGG - Intergenic
1158385850 18:56990793-56990815 CCCCTGCAGCCTCTGTGCTCAGG + Intronic
1159378693 18:67628603-67628625 CGTCTGTAATCTCAGCGCTTTGG - Intergenic
1159510356 18:69390643-69390665 GGTCTTGAACTTCTGTGCTCCGG + Intergenic
1160355636 18:78226195-78226217 CGTCTGTAACCCCAGCGCTTTGG - Intergenic
1160651219 19:229749-229771 CGTCTGTAATCTCAGCACTCTGG + Intergenic
1160920061 19:1515391-1515413 CGTCTCCCACCTCTGTCCTCTGG + Intergenic
1161065916 19:2237155-2237177 CGCCTGTAATCTCACTGCTCAGG + Intronic
1161090070 19:2355528-2355550 CGCCTGTAACCCCAGTGCTTTGG + Intergenic
1161115946 19:2496467-2496489 TCTCTGCAACCTCTGTCCTCTGG + Intergenic
1161247040 19:3258869-3258891 CGTCTGTAATCTCAGCGCTTTGG - Intronic
1161344009 19:3758959-3758981 CGCCTGTAATCTCAGTACTCTGG + Intronic
1161901319 19:7121726-7121748 CGCCTGTAATCTCAGTGCTTTGG - Intronic
1162028526 19:7907571-7907593 CCTCTGTGGCCTCTGTTCTCAGG + Intronic
1162391384 19:10392060-10392082 CGCCTGTAATCTCAGTGCTTTGG - Intronic
1162455024 19:10778389-10778411 CGCCTGTAATCTCAGTGCTTTGG + Intronic
1162929191 19:13948135-13948157 CGCCTGTAATCTCAGTGCTTTGG - Intronic
1163233206 19:16017458-16017480 CCTCTGTGACCTCCGTGTTCTGG + Intergenic
1163348911 19:16763038-16763060 CGCCTGTAATCTCAGTGCTTTGG - Intronic
1164008698 19:21176956-21176978 CGCCTGTAACCACAGTGCTTTGG - Intronic
1164984995 19:32641891-32641913 CCTCTGTAACCCCAGTGCTTTGG - Intronic
1165051293 19:33143067-33143089 CGTCTGTAATCCCAGTGCTTTGG + Intronic
1165167524 19:33867213-33867235 CTTCTGTAACCTCTGCACTTTGG + Intergenic
1165258650 19:34595551-34595573 TCTCTGTAAACACTGTGCTCAGG - Exonic
1165383750 19:35498467-35498489 TGCCTGTAATCTCTGTGCTTTGG - Intronic
1165672821 19:37693994-37694016 CGTCTGTAATCTCAGTACTTTGG + Intronic
1166511690 19:43413690-43413712 CGTCTGTAATCCCAGTACTCTGG + Intronic
1166553326 19:43681569-43681591 CCTCTGTAATCCCAGTGCTCTGG - Intergenic
1166572716 19:43808364-43808386 CGCCTGTAACCTCAATGCTTTGG - Intronic
1166699004 19:44871264-44871286 CGCCTGTAACCTCAGAGCTTTGG + Intronic
1167091673 19:47348726-47348748 CATCTGTAATCTCAGTGCTTTGG + Intergenic
1167214876 19:48157804-48157826 CGCCTGTATTCTCAGTGCTCTGG - Intronic
1167285848 19:48598666-48598688 CTTCTGCAGGCTCTGTGCTCAGG - Intronic
1167617009 19:50540614-50540636 CGCCTGTAACCCCAGTGCTTTGG - Intronic
1168179738 19:54653291-54653313 CCTCTGAATCCTCTGTGCGCTGG + Intronic
925206893 2:2014657-2014679 CTTCTGTGAGCTCTGGGCTCTGG - Intronic
927592159 2:24365846-24365868 CGTCTGTAACCCCTGCACTTTGG - Intergenic
928493898 2:31812394-31812416 AGGCTGTAGCCTCAGTGCTCTGG - Intergenic
928579733 2:32695458-32695480 CGCCTGTAATCTCAGTGCTTTGG + Intronic
928614112 2:33019408-33019430 TCACTGTAACCTCTGTCCTCTGG + Intronic
929306532 2:40369341-40369363 TGTCTGCAACCTCAGTGTTCAGG + Intronic
930080282 2:47441017-47441039 GGTCTGGAACTTCTGAGCTCAGG + Intronic
930211531 2:48643822-48643844 CGTCTGTAATCTCGTTACTCGGG - Intronic
930605463 2:53488952-53488974 CATCTGTAATCCCAGTGCTCTGG + Intergenic
930666717 2:54106322-54106344 CACCTGTAATCTCTGTGCTTTGG - Intronic
931866188 2:66414111-66414133 CGTCTGTAACCCCAGCGCTTTGG - Intergenic
932277214 2:70460656-70460678 GTCCTATAACCTCTGTGCTCTGG + Intronic
934969103 2:98748791-98748813 CATCTGTAATCTCAGTGCTTTGG - Intergenic
935071351 2:99696904-99696926 CATCTGTAACCTCAGTGCTTTGG - Intronic
935117449 2:100148659-100148681 TGCCTGTAATCTCAGTGCTCTGG + Intergenic
935302582 2:101705920-101705942 CGTCTTTGACCCCTGTGCTTTGG + Intronic
935809300 2:106781445-106781467 GGTCTGTCACTCCTGTGCTCCGG - Intergenic
935976948 2:108587456-108587478 TGCCTGTAATCTCAGTGCTCTGG - Intronic
938295990 2:130179911-130179933 CGTCTGTAATCTCTGCACTTTGG - Intronic
940867912 2:158835763-158835785 CGCCTGTAACCCCAGTGCTTTGG + Intronic
941975250 2:171397251-171397273 CGTCTGTAATCTCAGAGCTTTGG + Intronic
943776832 2:191774838-191774860 GGTCTGTAACCTCTTTGTTTTGG + Intergenic
944452449 2:199856943-199856965 CATCTGTAACCTCAGAGCTTTGG + Intergenic
944864220 2:203845224-203845246 CGTCTGTAATCTCAGTACTTTGG - Intergenic
944980298 2:205109912-205109934 CGTCTGTAATCCCTGTACTTTGG - Intronic
946318624 2:218934402-218934424 CGCCTGTAATCTCTGCACTCTGG - Intergenic
946437610 2:219668291-219668313 CGCCTGTAACCCCAGTGCTTTGG - Intergenic
947177201 2:227380066-227380088 CGCCTGTAATCTCAGTGCTTTGG + Intronic
947254154 2:228143279-228143301 CGCCTGTAATCTCAGTGCTTTGG + Intronic
948177223 2:235953668-235953690 CGCCTGTAATCTCAGTGCTTTGG + Intronic
948925191 2:241091759-241091781 CCTCTGTGACCTCTCTCCTCAGG + Exonic
948926459 2:241101834-241101856 GGTCTGTAACTTCTGGCCTCAGG - Intronic
1169232133 20:3897438-3897460 CGTCTGTAATCTCAGTACTTTGG + Intronic
1169451790 20:5718221-5718243 GGTCTCGAACCTCTGAGCTCAGG + Intergenic
1171723307 20:28588920-28588942 CTCCTGTAATCTCTGTGCTTTGG + Intergenic
1171754747 20:29094162-29094184 CTCCTGTAATCTCTGTGCTTTGG - Intergenic
1171787904 20:29488376-29488398 CTCCTGTAATCTCTGTGCTTTGG + Intergenic
1171860036 20:30391012-30391034 CTCCTGTAACCTCTGTGCTTTGG - Intronic
1172971892 20:38879795-38879817 CTTCTAGAACCTCTGTGCCCAGG - Intronic
1172984121 20:38968766-38968788 GGTCTCTAACCCCTGAGCTCAGG + Intronic
1177011620 21:15737049-15737071 CGTCTGAAATCTGTGTTCTCAGG + Intronic
1178096114 21:29217486-29217508 CGTCTGTAATCCCTGTACTTTGG + Intronic
1178256413 21:31056542-31056564 GGTCTTTAACCCCTGAGCTCAGG + Intergenic
1178569731 21:33725007-33725029 CGTCTGTAATCTCAATGCTTTGG + Intronic
1178996908 21:37410785-37410807 CGCCTGTAATCTCAGTACTCTGG + Intronic
1179192613 21:39136274-39136296 CCTGTGTAAACTCTGGGCTCTGG + Intergenic
1179286132 21:39978804-39978826 CCTCTGTACCCTCTCTCCTCAGG - Intergenic
1179490732 21:41740016-41740038 CCTTTGTAACCTCAGTGCTGGGG - Exonic
1179799941 21:43806789-43806811 CCTCTGTGACCACTGTGCTGTGG - Intergenic
1180215286 21:46319500-46319522 CGCCTGTAATCTCAGTGCTTTGG + Intronic
1180296861 22:10947581-10947603 CTCCTGTAATCTCTGTGCTTTGG + Intergenic
1180696030 22:17752082-17752104 CCACTGTCACCTCTGAGCTCGGG + Intronic
1181268920 22:21647443-21647465 CGCCTGTAATCTCAGTGCTTTGG + Intergenic
1182439525 22:30354668-30354690 CATCTCTAACCTCTTTCCTCAGG + Intronic
1183920626 22:41164493-41164515 GGTCTGGAACCCCTGTCCTCAGG - Intronic
1184227901 22:43140749-43140771 CGTCTGTAATCCCAGTGCTTTGG - Intronic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
949438617 3:4056411-4056433 TGCCTGTAACCTCAGTGCTTTGG + Intronic
949752811 3:7374437-7374459 CATCTGTAATCCCAGTGCTCTGG - Intronic
950729277 3:14942688-14942710 CGCCTGTAATCCCTGTGCTTTGG - Intergenic
951077820 3:18418191-18418213 CCTCTATAAGCTCTGTCCTCTGG + Intronic
951885396 3:27519280-27519302 TGCCTGTAACCTCTGCGCTCTGG + Intergenic
952189332 3:31005800-31005822 TGTCTGTAATCTCAGTACTCTGG - Intergenic
953072654 3:39537313-39537335 CATCTGTAATCCCTGTGGTCTGG - Intergenic
953274309 3:41479945-41479967 CGCCTGTAATCTCAGTGCTTTGG + Intronic
953534970 3:43770370-43770392 AGTATGTCACCTCTGTGCACCGG - Intergenic
954013870 3:47667914-47667936 CGTCTGTAATCTAAGTACTCTGG + Intronic
954547501 3:51450740-51450762 CGCCTGTAACCTCAGTACTTTGG - Intronic
954866590 3:53735149-53735171 GGTGTGTCACCTCTGTGCTGGGG - Intronic
955864407 3:63367570-63367592 CGTCTCAAACTTCTGAGCTCAGG + Intronic
956318462 3:67967189-67967211 CGTGTCTCTCCTCTGTGCTCAGG - Intergenic
956501750 3:69894423-69894445 CGCCTGTAACCCCAGTGCTTTGG + Intronic
957177506 3:76830320-76830342 TGTCTGTTACCTCTGTTCTCTGG + Intronic
957876629 3:86155194-86155216 TGTCTGCACACTCTGTGCTCAGG - Intergenic
957890391 3:86350019-86350041 CGCCTGTAATCCCTGTGCTTTGG + Intergenic
959578120 3:107957032-107957054 CGCCTGTGTCCTCTGGGCTCCGG - Intergenic
960397389 3:117154028-117154050 CGCCTGTAATCTCTGTGCTTTGG + Intergenic
961028301 3:123580521-123580543 CGCCTGTAATCTCAGTGCTTTGG + Intronic
962223068 3:133580440-133580462 CGCCTGTAATCTCAGTACTCTGG + Intronic
963929589 3:150989640-150989662 AGCCTGGAACCTCTGGGCTCAGG - Intergenic
964251483 3:154723168-154723190 CACCTGTAATCTCAGTGCTCTGG - Intergenic
964775731 3:160274676-160274698 CGTCTGTAATCCCAGTGCTTTGG + Intronic
966192010 3:177280068-177280090 CGTCTGTAATCTCAGCGCTTTGG + Intergenic
966523523 3:180897960-180897982 CGCCTGTAACCCCAGTGCTTTGG + Intronic
967324815 3:188228521-188228543 CATCTGTAATCCCTGTGCTTTGG + Intronic
968366613 3:198190231-198190253 CGTCTGTAATCTCAGCACTCTGG - Intergenic
968437090 4:599279-599301 CCTCTGGAAGCTCTGTCCTCGGG + Intergenic
968451795 4:679395-679417 CCTCTGTCAGCTCTGTGGTCTGG - Intronic
969551797 4:7873606-7873628 CGTCTGTAATCCCAGTGCTTTGG - Intronic
970436655 4:16042072-16042094 CGCCTGTAACCCCAGTGCTTTGG - Intronic
971142642 4:23941316-23941338 CATCTGTAATCTCAGTGCTTTGG - Intergenic
972311288 4:37886101-37886123 CGTCTGTAATCCCAGCGCTCTGG + Intergenic
972588905 4:40465441-40465463 GGTCTTGAACCTCTGAGCTCAGG - Intronic
975317678 4:72973572-72973594 CGTTTGTAATCTCAGTGCTTTGG + Intergenic
975850299 4:78565240-78565262 CACCTGTAATCTCTGTGCTTTGG - Intronic
975989778 4:80246774-80246796 CGTCTGTAATCCCTGTACTTTGG + Intergenic
975990141 4:80250762-80250784 CGCCTGTAATCCCTGTGCTTTGG - Intergenic
976065178 4:81178864-81178886 CGCCTGTAATCTCAGTACTCTGG + Intronic
976252280 4:83064818-83064840 TGTCTGTAATCCCAGTGCTCTGG - Intronic
976956840 4:90911729-90911751 CGTCTGTCACCCCTTTGCTTGGG - Intronic
977379154 4:96248351-96248373 AGTCACTAACCTCTGTTCTCTGG + Intergenic
978358042 4:107898603-107898625 GGTCTGTCAGCTCTGGGCTCTGG - Intronic
978443225 4:108756618-108756640 GGTCTCTAACTTCTGAGCTCAGG - Intronic
978655251 4:111058485-111058507 TGTCTGTAATCCCAGTGCTCTGG - Intergenic
980907801 4:138965262-138965284 CGCCTGTAATCTCAGTGCTTTGG - Intergenic
982367787 4:154598987-154599009 CGTCTGTAATCCCAGTGCTTTGG - Intergenic
982462861 4:155692796-155692818 CGTCTGTAATCCCAGTGCTTTGG + Intronic
983063642 4:163186000-163186022 CTTCTGTGTCCTCTGTGCTGTGG + Intergenic
984186184 4:176546434-176546456 CCTCTGGGACCTCTGTGTTCTGG + Intergenic
984788745 4:183593896-183593918 CGTCTGTAATCCCAGTGCTTTGG - Intergenic
985120968 4:186641788-186641810 GGTCTCGAACCTCTGAGCTCAGG - Intronic
985438204 4:189954852-189954874 CTCCTGTAATCTCTGTGCTTTGG - Intronic
986173623 5:5333504-5333526 CGTCTGGAACTTCTGACCTCAGG + Intergenic
986642487 5:9886246-9886268 GGTCTGGAACTTCTGAGCTCAGG + Intergenic
991054026 5:62303149-62303171 CGCCTGTAATCCCAGTGCTCTGG + Intergenic
992584977 5:78229194-78229216 TGCCTGTAACCCCTGTGCTTTGG - Intronic
993848406 5:92974265-92974287 CGCCTGTAATCTCAGTGCTTTGG - Intergenic
995079245 5:108028581-108028603 CCTCTTTAACCCCTGTGCTCTGG + Intronic
996741840 5:126806689-126806711 GGTATGTAACCTCTGTGATTAGG - Intronic
997116452 5:131130648-131130670 CGTCTGTAATCTCAGTACTTTGG + Intergenic
997622302 5:135306794-135306816 CTTCTGTAATCCATGTGCTCTGG - Intronic
997957392 5:138289937-138289959 TGCCTGTAACCTCAGTGCTTTGG + Intronic
998547421 5:143042128-143042150 TGTCTGTAGGCTCAGTGCTCTGG + Intronic
998967820 5:147559730-147559752 ATTCTGTACCCTCTGTTCTCTGG + Intergenic
999209631 5:149876720-149876742 GGTCTTGAACCTCTGAGCTCAGG + Intronic
1000037867 5:157462390-157462412 CGTCTGTAATCTTAGTGCTTTGG + Intronic
1001946749 5:175785337-175785359 CATATGTAATCTCTGTGGTCAGG + Intergenic
1002192512 5:177485722-177485744 CGTCTGTAATCCCAGTGCTTTGG + Intronic
1002647332 5:180666246-180666268 GGTCTGGAACTTCTGAGCTCAGG - Intergenic
1002725836 5:181295438-181295460 CGTCTGTAATCTCAGCACTCTGG - Intergenic
1002947417 6:1776425-1776447 CATCTGTAATCTCAGTGCTTTGG + Intronic
1003059955 6:2855148-2855170 TATCTGTAAGCTCTGAGCTCAGG + Intergenic
1003069407 6:2933089-2933111 CGCCTGTAATCCCAGTGCTCAGG - Intergenic
1003317774 6:5027389-5027411 CGTCTGTAATCTCAGCACTCTGG - Intergenic
1004659579 6:17698330-17698352 CGCCTGTAATCTCAGTGCTTTGG + Intronic
1005148314 6:22718392-22718414 CGTCTGTAATTTCTGTGACCTGG - Intergenic
1007649395 6:43408791-43408813 GGTCTTGAACCTCTGTGCTCAGG - Intergenic
1008377991 6:50812845-50812867 CATCTGTAATCTCAGTGCTTTGG + Intergenic
1011839533 6:91479267-91479289 CTTCTGAAAACTCCGTGCTCAGG - Intergenic
1012398052 6:98822485-98822507 GGTCTGGAACCTGTGTGGTCAGG + Intergenic
1012779874 6:103544849-103544871 GGTCTGGAACCTCTGATCTCAGG - Intergenic
1013101344 6:106989540-106989562 GGTCTGTAACTCCTGAGCTCAGG - Intergenic
1015498060 6:133901626-133901648 CATCTATAATCTCTGTACTCTGG + Intergenic
1015539810 6:134302508-134302530 GCTATGAAACCTCTGTGCTCTGG - Intronic
1015542426 6:134328599-134328621 CGTCTGTAACCCCAGTACTTTGG - Intergenic
1015592682 6:134837487-134837509 CGTCTGTAATCTCAGCACTCTGG + Intergenic
1016926040 6:149349158-149349180 CGCCTGTAACCCCAGTGCTTTGG + Intronic
1016956882 6:149635443-149635465 CGTCTGTAATCTCAGTACTTTGG + Intronic
1017448860 6:154534670-154534692 GGCCTGTAACCTCAGTGCTTTGG - Intergenic
1017504510 6:155055699-155055721 CGTCTGTAATCCCAGTGCTTTGG + Intronic
1017625494 6:156343383-156343405 GGTCTGAAACTTCTGAGCTCAGG - Intergenic
1017937397 6:159018255-159018277 CTTCTGTAGCCACTGTGCTTTGG + Intergenic
1019035078 6:169047776-169047798 CGTCTGTAATCTCAGCACTCTGG + Intergenic
1019582930 7:1777063-1777085 CGTCTGTAATCCCAGTGCTTTGG - Intergenic
1020208334 7:6137616-6137638 CGTCTGTAATCTCTGCACTTTGG - Intronic
1020219191 7:6221736-6221758 CGCCTGTAACCTCAATACTCAGG + Intronic
1020264931 7:6554002-6554024 CGCCTGTAATCTCAGTGCTTTGG + Intergenic
1020597594 7:10228256-10228278 GGTCTTCAACCTCTGGGCTCAGG - Intergenic
1021098349 7:16559131-16559153 CGCCTGTAATCTCAGTGCTTAGG + Intronic
1021117643 7:16761793-16761815 CATCTGTAATCTCAGTACTCTGG - Intronic
1021922747 7:25502972-25502994 CATCTGTAATCCCAGTGCTCTGG - Intergenic
1024193205 7:47033532-47033554 CGTCTGTAATCCCAGTGCTTTGG - Intergenic
1026303778 7:69122484-69122506 CGTTTGTAATCTCAGTGCTTTGG - Intergenic
1026311828 7:69192690-69192712 CGCCTGTAATCTCAGTGCTTTGG + Intergenic
1026543638 7:71302575-71302597 TGTCTGTTGCCTCTGAGCTCAGG + Intronic
1027590209 7:80110205-80110227 CGTCTGTAACCCCAGTACTTTGG + Intergenic
1027959870 7:84931336-84931358 CGTCTGTAATCTCAGTACTCTGG - Intergenic
1028611253 7:92714450-92714472 AGTCTGTATACTCTGAGCTCCGG - Intronic
1029447081 7:100619726-100619748 TGTCTGTAACCCCAGTGCTTTGG - Intergenic
1029740148 7:102486891-102486913 CGTCTCTAACTCCTGAGCTCAGG + Intronic
1029758145 7:102586070-102586092 CGTCTCTAACTCCTGAGCTCAGG + Intronic
1029776083 7:102685148-102685170 CGTCTCTAACTCCTGAGCTCAGG + Intergenic
1030109344 7:106013313-106013335 CGTCAGTGCCCTCTGTGCTCAGG + Intronic
1033337029 7:140462610-140462632 TGTCTCTAACCCCTGAGCTCAGG - Intronic
1034127166 7:148683958-148683980 CGCCTGTAATCTCAGTGCTTTGG + Intergenic
1034930897 7:155163114-155163136 CGCCTGTAATCTCAGTGCTTTGG - Intergenic
1035564498 8:632100-632122 CCACTGAAACCTTTGTGCTCAGG + Intronic
1036642837 8:10594710-10594732 GGTCTTGAACCTCTGGGCTCAGG - Intergenic
1037032603 8:14127280-14127302 ACTCTGTAACCTCTGGTCTCAGG - Intronic
1037275084 8:17169464-17169486 CATCTGTCATTTCTGTGCTCTGG - Intronic
1037943682 8:22973492-22973514 CGCCTGTAATCTCAGTGCTTTGG - Intronic
1038495180 8:27996446-27996468 CCACTGCATCCTCTGTGCTCTGG - Intergenic
1038905764 8:31900898-31900920 CATCTGTGACCTCTGTTTTCAGG - Intronic
1039815977 8:41094809-41094831 CGTCTGTAACCCCAGTACTTTGG - Intergenic
1039892779 8:41696148-41696170 CGCCTGTAATCTCAGTGCTTTGG - Intronic
1041027876 8:53705132-53705154 CGCCTGTAACCCCAGTGCTTTGG + Intergenic
1041109427 8:54470628-54470650 CGACTTCAACCTCTCTGCTCAGG + Intergenic
1042141208 8:65680423-65680445 CATCTGTAATCTCAGTGCTTTGG - Intronic
1043441688 8:80282119-80282141 CGTCTGTAACCTCAGCACTTTGG - Intergenic
1043603812 8:81974443-81974465 CGCCTGTAATCCCTGTACTCTGG - Intergenic
1044104353 8:88184466-88184488 CTCCTGTAATCTCTGTGCTTTGG + Intronic
1045282441 8:100760843-100760865 CGCCTGTAATCTCAGTGCTTTGG + Intergenic
1045653156 8:104361566-104361588 CTTCTGTGACCTCGGGGCTCAGG + Intronic
1047282225 8:123455639-123455661 GGTCTGGAACCCCTGAGCTCAGG + Intronic
1047345862 8:124027820-124027842 CGTCTGTAATCTCAGTGCTTTGG - Intronic
1047623274 8:126630283-126630305 CATCTGTAATCTCAGTGCTTTGG + Intergenic
1050341461 9:4643742-4643764 CGTCTGTAACCCCAGCACTCTGG + Intronic
1050453598 9:5809607-5809629 TTTCTGTATCCTCTGTGCTTAGG - Intronic
1051409670 9:16776354-16776376 GGTCTCGAACCTCTGAGCTCAGG + Intronic
1051625163 9:19092238-19092260 GGTCTTGAACCCCTGTGCTCAGG - Intronic
1052484293 9:29076136-29076158 CACCTGTAATCTCTGTGCTTTGG - Intergenic
1053242214 9:36505253-36505275 GGTCTGGAACTTCTGAGCTCAGG + Intergenic
1053388903 9:37719257-37719279 CCTCTGCACCCTCTGTGCTGTGG - Intronic
1053726794 9:41011432-41011454 CTCCTGTAATCTCTGTGCTTTGG - Intergenic
1054339151 9:63840368-63840390 CTCCTGTAATCTCTGTGCTTTGG + Intergenic
1055953456 9:81752352-81752374 CGCCTGTAATCCCTGTGCTTTGG - Intergenic
1056115824 9:83440418-83440440 CTTCTGTCACTTCTGGGCTCTGG + Intronic
1057265348 9:93613832-93613854 TGCCTGTAATCTCAGTGCTCTGG - Intronic
1058462027 9:105191484-105191506 CGCCTGTAACCTCAGTGCTTTGG - Intergenic
1060490087 9:124077536-124077558 CGCCTGTAACCCCAGTGCTTTGG - Intergenic
1061050543 9:128192127-128192149 CGCCTGTAATCTCAGTACTCTGG + Intronic
1061586017 9:131569084-131569106 CGCCTGTAACCTCAGCGCTTTGG - Intergenic
1061684797 9:132266553-132266575 CGTCTTGAACCTCTGACCTCAGG - Intronic
1062174198 9:135151852-135151874 CTTCTGTTACTTCAGTGCTCTGG + Intergenic
1062750972 9:138253082-138253104 CGTCTGTAATCTCAGCACTCTGG - Intergenic
1202803720 9_KI270720v1_random:28762-28784 CGCCTGTAATCTCTGTGCTTTGG + Intergenic
1186334898 X:8575841-8575863 CGTCTGTAATCTTAGTGCTTTGG + Intronic
1188365657 X:29312177-29312199 CGCCTGTAATCCCTGTGCTTTGG + Intronic
1188466810 X:30490747-30490769 CGTCTGTAATCCCAGTACTCTGG + Intergenic
1188559569 X:31452364-31452386 CGTCTGTAACTCCTGACCTCAGG - Intronic
1192311177 X:70015310-70015332 CGTCTGTAATCTCAGCGCTTTGG + Intronic
1192859849 X:75055901-75055923 GGTCTGGAACTTCTGGGCTCAGG + Intronic
1193041493 X:77008348-77008370 GGTCTGGAACCTCTGACCTCAGG + Intergenic
1194674893 X:96782692-96782714 TGTCTGTAACCTCAGTACTTTGG - Intronic
1195079124 X:101354728-101354750 TGCCTTTAACCTCTGTGCTGGGG - Intronic
1196859483 X:120014277-120014299 CGCCTGTAATCTCAGTGCTCTGG - Intergenic
1196901029 X:120383433-120383455 CCTTTGTAGTCTCTGTGCTCTGG + Intergenic
1198142910 X:133823717-133823739 CACCTGTAACCTCAGTGCTTTGG + Intronic
1200496772 Y:3895136-3895158 CGCCTGTAACCTCAGTACTTTGG + Intergenic
1200750851 Y:6942854-6942876 TGTCTGTAATCTCAGTGCTTTGG + Intronic
1202371398 Y:24199162-24199184 CGTCTGTAATCCCAGTGCTTTGG + Intergenic
1202499387 Y:25470953-25470975 CGTCTGTAATCCCAGTGCTTTGG - Intergenic