ID: 1131126870

View in Genome Browser
Species Human (GRCh38)
Location 15:89866325-89866347
Sequence GCTTAGACTAGGGGGTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131126862_1131126870 1 Left 1131126862 15:89866301-89866323 CCACGTTGCCTAGACAATGAACT 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1131126870 15:89866325-89866347 GCTTAGACTAGGGGGTTGGGAGG 0: 1
1: 0
2: 4
3: 13
4: 171
1131126861_1131126870 16 Left 1131126861 15:89866286-89866308 CCATGGAGGTATACTCCACGTTG 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1131126870 15:89866325-89866347 GCTTAGACTAGGGGGTTGGGAGG 0: 1
1: 0
2: 4
3: 13
4: 171
1131126863_1131126870 -7 Left 1131126863 15:89866309-89866331 CCTAGACAATGAACTAGCTTAGA 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1131126870 15:89866325-89866347 GCTTAGACTAGGGGGTTGGGAGG 0: 1
1: 0
2: 4
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131126870 Original CRISPR GCTTAGACTAGGGGGTTGGG AGG Intronic