ID: 1131126870 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:89866325-89866347 |
Sequence | GCTTAGACTAGGGGGTTGGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 189 | |||
Summary | {0: 1, 1: 0, 2: 4, 3: 13, 4: 171} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1131126862_1131126870 | 1 | Left | 1131126862 | 15:89866301-89866323 | CCACGTTGCCTAGACAATGAACT | 0: 1 1: 0 2: 0 3: 8 4: 69 |
||
Right | 1131126870 | 15:89866325-89866347 | GCTTAGACTAGGGGGTTGGGAGG | 0: 1 1: 0 2: 4 3: 13 4: 171 |
||||
1131126861_1131126870 | 16 | Left | 1131126861 | 15:89866286-89866308 | CCATGGAGGTATACTCCACGTTG | 0: 1 1: 0 2: 1 3: 3 4: 76 |
||
Right | 1131126870 | 15:89866325-89866347 | GCTTAGACTAGGGGGTTGGGAGG | 0: 1 1: 0 2: 4 3: 13 4: 171 |
||||
1131126863_1131126870 | -7 | Left | 1131126863 | 15:89866309-89866331 | CCTAGACAATGAACTAGCTTAGA | 0: 1 1: 0 2: 1 3: 8 4: 99 |
||
Right | 1131126870 | 15:89866325-89866347 | GCTTAGACTAGGGGGTTGGGAGG | 0: 1 1: 0 2: 4 3: 13 4: 171 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1131126870 | Original CRISPR | GCTTAGACTAGGGGGTTGGG AGG | Intronic | ||