ID: 1131128254

View in Genome Browser
Species Human (GRCh38)
Location 15:89874898-89874920
Sequence GAGTCGTATTTTAAGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131128254 Original CRISPR GAGTCGTATTTTAAGTTGGT GGG Intronic
903646413 1:24898760-24898782 GAGTGGTTTTTGAAGTCGGTGGG + Intergenic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
909216610 1:72899069-72899091 GCGCCGTTTTTTAAGCTGGTTGG - Intergenic
909308841 1:74119693-74119715 GAGTATTATTTTAATTTGGTGGG - Intronic
909812197 1:79944097-79944119 GCGCCGTTTTTTAAGCTGGTCGG + Intergenic
914410594 1:147423519-147423541 GGGCCGTTTTTTAAGCTGGTCGG - Intergenic
918363976 1:183787283-183787305 GAGTAGAGTTTTAAGGTGGTAGG - Intronic
922672057 1:227517636-227517658 GGGCAGTATTTTTAGTTGGTAGG + Intergenic
1064958416 10:20937331-20937353 GATGCTTATTTTAAGTTGGGAGG - Intronic
1065357870 10:24859956-24859978 CAGTCATATTTTAATTTGGTGGG - Intronic
1076083685 10:127606313-127606335 GTGTCCAGTTTTAAGTTGGTGGG + Intergenic
1076938246 10:133580857-133580879 GTGCCGTTTTTTAAGCTGGTTGG - Intergenic
1080234867 11:30056911-30056933 GCGCCGTTTTTTAAGCTGGTCGG + Intergenic
1084519662 11:69655582-69655604 GAGTCCTATATTGAGTGGGTGGG + Intronic
1089101625 11:115967236-115967258 GTGCCGTTTTTTAAGCTGGTTGG - Intergenic
1089309158 11:117546536-117546558 GACTGGTCTTTTAAGTAGGTGGG + Intronic
1091308563 11:134556886-134556908 GAGTCATATTTTAGGTTGTATGG + Intergenic
1092301153 12:7251430-7251452 GCGCCGTTTTTTAAGCTGGTCGG - Intergenic
1110541882 13:76715216-76715238 GAGTTGCAATTTGAGTTGGTAGG - Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1118168067 14:63357527-63357549 GAGTTTTAATTAAAGTTGGTTGG + Intergenic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1134287946 16:12878939-12878961 GTGTCTAATTTTAAGGTGGTAGG - Intergenic
1137916975 16:52442238-52442260 GAGTCGTATCTTAAGGGGGGAGG + Intronic
1138796584 16:59976902-59976924 GTGCCGTTTTTTAAGCTGGTCGG - Intergenic
1140991786 16:80219996-80220018 GTGCCGTTTTTTAAGCTGGTTGG - Intergenic
1141457502 16:84153381-84153403 AAGTTTTATTTTAAGTTGATGGG - Intronic
1149186417 17:54002993-54003015 GGTTTGTCTTTTAAGTTGGTGGG + Intergenic
1150520656 17:65864265-65864287 GAGTCATATTTTAAGATGCTGGG + Intronic
1157365110 18:47057744-47057766 GAGAGGTATTTTAAGTAGGCAGG + Intronic
1158997578 18:62938799-62938821 GAGGGGTTTTTTAAGTTGCTTGG + Intronic
1159230644 18:65604299-65604321 GAGTCGTATTTTGATATGCTAGG - Intergenic
1159974385 18:74692480-74692502 GATTCGTAGTTGAAGTAGGTAGG + Intronic
929464263 2:42130679-42130701 AAGTCATATTTTAATTTAGTTGG - Intergenic
930800977 2:55442407-55442429 GCGCCGTTTTTTAAGCTGGTCGG - Intergenic
931210452 2:60189325-60189347 GCGTCGTTTTTTAAGCTTGTTGG - Intergenic
941948504 2:171127741-171127763 GAGAGGTATTTTAAATTAGTGGG - Intronic
941950838 2:171154921-171154943 GAGTTGGATTTTTAGGTGGTGGG - Intronic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
1176706062 21:10120587-10120609 GAGTTGAATTTGAAGTTTGTGGG + Intergenic
1178879662 21:36439215-36439237 GAGTGGCATTTTAAATTGATTGG - Intergenic
1180155385 21:45974874-45974896 GAGTCATGTTCTAAGTTGGGAGG + Intergenic
1180504945 22:15985795-15985817 GTGCCGTATTTTAAGCTGGTGGG + Intergenic
1184133038 22:42529161-42529183 GAGTCATATTTTAGGTTGTATGG - Intergenic
1203333715 22_KI270739v1_random:36251-36273 GTGCCGTATTTTAAGCTGGTGGG - Intergenic
952101278 3:30016189-30016211 GAGTTGTCATTTTAGTTGGTGGG - Intergenic
954307171 3:49734441-49734463 GAGTGGCATTTGAAGTTGCTGGG - Intronic
959385118 3:105694628-105694650 GTTTCTTATTTTAAGTTGATAGG - Intronic
961069469 3:123908516-123908538 CAATGATATTTTAAGTTGGTGGG - Intronic
965906638 3:173715967-173715989 GAGTTGTATTTTAAATTATTTGG + Intronic
967467962 3:189829233-189829255 GAATCCTCTTTTAAGATGGTTGG - Intronic
967501427 3:190202663-190202685 AAGTGACATTTTAAGTTGGTGGG + Intergenic
971588733 4:28439391-28439413 ATGTCATATTTTAAGTTGGTTGG - Intergenic
972830503 4:42809441-42809463 GAATCCTATTTTTGGTTGGTAGG + Intergenic
975661564 4:76693691-76693713 GAGTCATTTTTTAAGGTTGTGGG + Intronic
978677498 4:111337243-111337265 GTGCCGTTTTTTAAGCTGGTCGG - Intergenic
979561915 4:122110394-122110416 GCGCCGTTTTTTAAGTTGGTCGG - Intergenic
979963116 4:127045230-127045252 GATTCCTACTTTAATTTGGTAGG - Intergenic
980129697 4:128807160-128807182 GAGTCATATTGGGAGTTGGTGGG + Intergenic
982147745 4:152415907-152415929 GGGTATTATTTTAAGTTGGATGG - Intronic
986565415 5:9108850-9108872 GAGTGGTCTTTTAAATTGTTTGG - Intronic
988104966 5:26733033-26733055 GAATTTTTTTTTAAGTTGGTAGG - Intergenic
993685242 5:90929336-90929358 GCGTCGTGTTTTAAGCCGGTCGG + Intronic
994969688 5:106719566-106719588 GCGCCGTTTTTTAAGCTGGTCGG + Intergenic
996487724 5:124056495-124056517 CAGAGGTATTTTCAGTTGGTGGG + Intergenic
1005259974 6:24048414-24048436 GAGCAGCATTTTAAGTCGGTAGG - Intergenic
1008657027 6:53625942-53625964 GAATAGTATATTAAGTTGGAGGG + Intergenic
1009875083 6:69495663-69495685 GCGCCGTTTTTTAAGCTGGTTGG - Intergenic
1019038333 6:169082095-169082117 GTGTCTTATTTTTGGTTGGTTGG - Intergenic
1021095249 7:16528018-16528040 AAGTCGGATTTTAAATTAGTTGG - Intronic
1022411813 7:30144720-30144742 GAGCAGTATTTTAAGTCTGTAGG + Intronic
1024796932 7:53032026-53032048 GGGCCGTTTTTTAAGCTGGTCGG + Intergenic
1025621908 7:63180784-63180806 GATTTTTATTTTAATTTGGTGGG - Intergenic
1026475018 7:70727783-70727805 GAGTAGGATTTTAACTTGTTAGG - Intronic
1037129329 8:15388854-15388876 GACTCTTATTTTCAGGTGGTGGG - Intergenic
1038122313 8:24631262-24631284 AATTAGTAGTTTAAGTTGGTGGG + Intergenic
1041435323 8:57832606-57832628 CAGTCATATTTTGAGTTGCTGGG + Intergenic
1042588665 8:70372458-70372480 GAGTAGGATTTTGGGTTGGTGGG - Intronic
1045232971 8:100323187-100323209 GAGTGTTATTTTAAGATGATGGG + Intronic
1046344633 8:112906458-112906480 GAGACGTTTTTTTGGTTGGTTGG - Intronic
1053643335 9:40107704-40107726 GAGTTGAATTTGAAGTTTGTGGG + Intergenic
1053762817 9:41357786-41357808 GAGTTGAATTTGAAGTTTGTGGG - Intergenic
1054324189 9:63704932-63704954 GAGTTGAATTTGAAGTTTGTGGG + Intergenic
1054541420 9:66268899-66268921 GAGTTGAATTTGAAGTTTGTGGG - Intergenic
1059156445 9:111993024-111993046 CAATAGTATTTTAATTTGGTGGG - Intergenic
1061436769 9:130568210-130568232 GAGTAGTAATTTAAGATAGTGGG + Intergenic
1202791095 9_KI270719v1_random:90675-90697 GAGTTGAATTTGAAGTTTGTGGG + Intergenic
1187894099 X:23964741-23964763 CAGTCGTATTTTCTGTTGTTTGG - Intergenic
1189317415 X:40065857-40065879 GAGTAATATTTGAAGTGGGTTGG - Intronic
1191935850 X:66426554-66426576 GCGCCGTTTTTTAAGCTGGTGGG - Intergenic
1196004627 X:110822454-110822476 GCGCCGTTTTTTAAGCTGGTTGG + Intergenic
1196570479 X:117260976-117260998 GCGCCGTTTTTTAAGCTGGTCGG - Intergenic
1200432816 Y:3108367-3108389 GTGTCGTAGTCTAAGTTTGTAGG - Intergenic
1201447002 Y:14068225-14068247 GAGTCTTATTTTAAGTCTGTTGG - Intergenic