ID: 1131132003

View in Genome Browser
Species Human (GRCh38)
Location 15:89906198-89906220
Sequence CTCCAGGGAGGCAAATAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131132003 Original CRISPR CTCCAGGGAGGCAAATAGCC TGG (reversed) Intronic
900573232 1:3370281-3370303 TTCCAGAGAGGCAAGTAACCAGG + Intronic
900647720 1:3716516-3716538 CCCCAGGGAAGCCACTAGCCTGG - Intronic
903415433 1:23179121-23179143 CCACAGGGAGGAAAATGGCCTGG - Intergenic
903516240 1:23912833-23912855 CTCCAGGGACACAAGAAGCCAGG - Intronic
904042153 1:27591244-27591266 ATCCAGGGAGGAAACTAGGCTGG + Intronic
905678979 1:39853089-39853111 TGACAGGGAAGCAAATAGCCAGG - Intronic
908842666 1:68294964-68294986 CTCCAGGGAGGCATAGAGGCAGG + Intergenic
908979660 1:69940461-69940483 CTCCATGCAGTCAAATACCCTGG + Intronic
909056009 1:70822020-70822042 CTCCCTGAAGGCAAATTGCCAGG + Intergenic
909391408 1:75125674-75125696 CTCCAGGATGGCAATCAGCCAGG - Intergenic
910754559 1:90673760-90673782 CTCCAGAAAGGCATACAGCCTGG - Intergenic
912633519 1:111270333-111270355 GTCCAGGGAGGAAGATAGGCTGG + Intergenic
912945663 1:114081955-114081977 CTCCAGGGAGAGAGAAAGCCAGG - Intergenic
916586371 1:166153606-166153628 CTCCAGGGAGGGTAGAAGCCTGG + Intronic
916681512 1:167109265-167109287 CCTCAGGGAGGCTTATAGCCTGG + Intronic
919747168 1:201016208-201016230 CACCAGGGTGGGAAATAGCTTGG + Intronic
919854709 1:201697311-201697333 CTCCAGGGAGGCAGCCAGGCAGG + Intronic
920502270 1:206492900-206492922 AGCGAGGGAGGCAAATACCCGGG + Exonic
920615222 1:207485927-207485949 CTCAAGGGAAGTAAAGAGCCAGG + Intronic
920867381 1:209764352-209764374 CTCCAGAGAAGAAAAGAGCCAGG + Intronic
921409857 1:214823795-214823817 CAGCTGGGAGGCGAATAGCCTGG - Intergenic
921429467 1:215047868-215047890 ATCAAGGGAGGCAAATAAGCTGG + Intronic
921944049 1:220874432-220874454 CTCCAGGGAGGGAGATGCCCGGG + Intergenic
922699473 1:227750508-227750530 CTCCTGGGAGGCACATGCCCTGG + Intronic
924812673 1:247416885-247416907 CTCAAGGGAGGCAGAGAGCCTGG - Intronic
1067794908 10:49313858-49313880 CTGCAGCCAGGCAAATGGCCTGG + Intronic
1068096668 10:52499695-52499717 CAGCTGGGAGGCAGATAGCCTGG - Intergenic
1068770693 10:60817597-60817619 CTCCTGGGTGGCCAGTAGCCTGG + Intergenic
1071457755 10:85863753-85863775 TGCCAGGAAGGCAGATAGCCTGG - Intronic
1072905853 10:99452980-99453002 TTCCATGGAAGCAAACAGCCAGG + Intergenic
1075174453 10:120146137-120146159 ATCCAGAGATGCAGATAGCCAGG + Intergenic
1075512476 10:123083713-123083735 CACCAGGAAAGCAAAGAGCCGGG + Intergenic
1076499858 10:130928978-130929000 CACCAGGGAGGCAGACAGACAGG + Intergenic
1078052969 11:7983657-7983679 CTCCAGGGCTGCCAAGAGCCAGG - Intronic
1080934138 11:36844055-36844077 CTTCTGGGAGGCAAACAGCCAGG + Intergenic
1087367534 11:97239849-97239871 CTCCAGTGAGGCAAGTATCTGGG - Intergenic
1088326028 11:108602468-108602490 TTCCAGAAAGGCAAATAACCTGG + Intergenic
1089096353 11:115923090-115923112 CTCCCCGGTGGCAATTAGCCGGG + Intergenic
1090867889 11:130718384-130718406 CTCCAGGGAGTGGAAGAGCCTGG + Intergenic
1092033745 12:5312128-5312150 CTGCAGAGAGGTAAATAGTCTGG + Intergenic
1092158300 12:6299560-6299582 CGCCAGGGTGGCAGACAGCCTGG - Intergenic
1096518297 12:52170373-52170395 CTCCACTGGGCCAAATAGCCTGG - Exonic
1096529736 12:52235029-52235051 CCCCAGGCAGGGAAACAGCCAGG + Intronic
1097030708 12:56087461-56087483 ATCCCGGGAAGCAAAAAGCCAGG - Intronic
1097181629 12:57175123-57175145 TCCCAGGGAGGCAAAAAGCTGGG + Intronic
1102575260 12:113852233-113852255 CTCCAGGGACACAATTAGCAGGG + Intronic
1104605680 12:130185770-130185792 CTGCAGGGAGGCATGGAGCCGGG - Intergenic
1105908203 13:24834902-24834924 CAGCTGGGAGGCAGATAGCCTGG + Intronic
1105950531 13:25225668-25225690 CTCCTGGGATGCAGGTAGCCAGG + Intergenic
1106558417 13:30829312-30829334 CTCCCGGGAGGCAGATACCAGGG + Intergenic
1107441246 13:40429173-40429195 CCCCAGGTAGGCAAACAGCAAGG - Intergenic
1108407831 13:50123204-50123226 CTGCAGGGAGGCAAGAGGCCAGG - Intronic
1110838330 13:80110601-80110623 CTCCAGGAAGGAATGTAGCCTGG + Intergenic
1111176829 13:84606340-84606362 CTCCAGGGATGCAAAGATGCAGG + Intergenic
1113647947 13:112012175-112012197 CTGCAGGGAGGCAAAGCGCCGGG - Intergenic
1113923679 13:113928748-113928770 TTCCCGGGAGGCAGAGAGCCAGG - Intergenic
1114242893 14:20885271-20885293 CTCCATGAAGGAAAATATCCGGG + Intergenic
1115504099 14:34077916-34077938 CTACAGGGTGGCAAAGAGCCTGG + Intronic
1117546311 14:56797273-56797295 CTCGAAGGAGGCAAAAACCCAGG + Intergenic
1119549926 14:75501439-75501461 CTCCATTGAGGCCAATAGGCTGG - Intergenic
1120188478 14:81418595-81418617 CTCCAGGGAAGCACATAATCAGG - Intronic
1121336860 14:93082876-93082898 CTCCAGGAGGGCAAATTCCCCGG + Intronic
1121444157 14:93968122-93968144 CTCCAGGAAGGCACATGGTCAGG - Intronic
1128435595 15:67644662-67644684 CTCCTGGGAGCCACAGAGCCTGG - Intronic
1131132003 15:89906198-89906220 CTCCAGGGAGGCAAATAGCCTGG - Intronic
1131409145 15:92191477-92191499 CTCCAGGGAGCCAAAGTCCCTGG - Intergenic
1131967170 15:97856829-97856851 CTCCAGGCAAGCAATTAGCATGG + Intergenic
1132210338 15:100017278-100017300 CAGCTGGGAGGCAGATAGCCTGG - Intronic
1132555983 16:572882-572904 CTCGAGGGAGGGACATAGCTTGG - Intronic
1136282322 16:29221052-29221074 CTCCAGGGAGGCACAATGGCAGG + Intergenic
1136577415 16:31132748-31132770 CTGCAGGGAGGCAGATGGGCCGG + Exonic
1137470056 16:48746108-48746130 CTCCATGGAGGCTCACAGCCTGG - Intergenic
1137592089 16:49699955-49699977 CCCCAGGGAGGCTGATATCCTGG - Intronic
1137592714 16:49703633-49703655 CTCCAGAGAGGCACCTAGCAGGG + Intronic
1139290675 16:65855422-65855444 CTCCAGGGAGGGAATTGGCCAGG - Intergenic
1140626165 16:76796875-76796897 CTGCAGGAAGGCTAATAGACTGG + Intergenic
1141761749 16:86033239-86033261 GTCCAGGGAGGCAAACTGCCTGG - Intergenic
1142086694 16:88186970-88186992 CTCCAGGGAGGCACAATGGCAGG + Intergenic
1142841095 17:2631283-2631305 CCGCTGGGAGGCAGATAGCCTGG - Intronic
1143475679 17:7202680-7202702 CTCCTGGAAGGCACAAAGCCTGG - Intronic
1146970014 17:37065045-37065067 CTCAAGGGAGGGTGATAGCCCGG + Intergenic
1150587437 17:66531565-66531587 CTCCAGGGAGCCAACAACCCAGG - Intronic
1150896207 17:69213635-69213657 CAGCAGGGAGGCTTATAGCCTGG - Intronic
1151796916 17:76353008-76353030 TTCCAGGGAGGCAGATGGGCCGG - Intronic
1152251767 17:79216203-79216225 CGCCTGGGAGGCAAACAGGCTGG - Intronic
1154531025 18:15345163-15345185 AACCTGGGAGGCAGATAGCCGGG + Intergenic
1161549019 19:4900616-4900638 CTCCAGCCATGCAAATATCCTGG - Intronic
1168317280 19:55489812-55489834 TTCCAGGGACCCAAATGGCCTGG + Intronic
926087659 2:10030102-10030124 CTCCCAGGACGCAAAAAGCCAGG + Intergenic
927086151 2:19675620-19675642 GTCCCGGGAGGCAAGAAGCCTGG + Intergenic
927355407 2:22167438-22167460 CACCTGGGAGGCATGTAGCCTGG + Intergenic
927468585 2:23355280-23355302 CTCCAGGGTGAAAAAGAGCCGGG + Intergenic
928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG + Intronic
934557673 2:95296080-95296102 CTCAGGGGAAGAAAATAGCCTGG - Intergenic
935925025 2:108058712-108058734 GTGCAGGGAGGCAAAGAGGCTGG + Intergenic
937885454 2:126896636-126896658 CTCCAGGGAGGGACAGGGCCTGG + Intergenic
938772225 2:134510468-134510490 CTAGAGGGAGGGGAATAGCCTGG + Intronic
945155832 2:206836211-206836233 CTCCAGGTAGGCAGATTGCAAGG + Intergenic
947457129 2:230265364-230265386 CAGCTGGGAGGCAGATAGCCTGG - Intronic
948479648 2:238241331-238241353 GTCCAGGGACGCTTATAGCCTGG - Intergenic
948655745 2:239475814-239475836 CTCCAGGAAGGCAGATGCCCCGG - Intergenic
1169724980 20:8718414-8718436 CTCCAGGAAGGAACACAGCCCGG - Intronic
1171328603 20:24318009-24318031 GTCCAGGGACACAGATAGCCAGG - Intergenic
1172869409 20:38126512-38126534 CTCCGGGGAGCCCACTAGCCAGG - Intronic
1173119603 20:40276611-40276633 CTGCAGGGAGCCAAAGAGCTGGG - Intergenic
1174088903 20:48030881-48030903 TTCCAGAGAGGCAGATTGCCTGG - Intergenic
1175270025 20:57727277-57727299 CCCCAGCGACGCTAATAGCCTGG + Intergenic
1175916464 20:62428259-62428281 GCCCAGGGGGGCAAATAGGCTGG + Intergenic
1175945378 20:62556071-62556093 CCACAGGGAGGGAAGTAGCCGGG + Intronic
1176766382 21:13023297-13023319 AACCTGGGAGGCAGATAGCCGGG - Intergenic
1177246612 21:18533165-18533187 CTGCAGGGTGGCAAACAGGCTGG - Intergenic
1177789989 21:25712748-25712770 CTACAGGGAAGAAAAGAGCCTGG - Intronic
1179279882 21:39925220-39925242 CTCCAAGGAGGCATGTAGCTGGG - Intronic
1179543828 21:42101229-42101251 CTCCAGGGAGTCCAATTCCCAGG + Intronic
1179936927 21:44611995-44612017 CTCCTGTGAGGAAAATACCCAGG + Intronic
1180060806 21:45383941-45383963 CTGCAGGGAGGAAAATCACCTGG - Intergenic
1181035635 22:20168575-20168597 CTCCAGGGAGGCTAGGAGGCTGG + Intergenic
1181823374 22:25493516-25493538 CCACAATGAGGCAAATAGCCGGG - Intergenic
1182422851 22:30256981-30257003 CTCCAGGGTCCCAAACAGCCAGG + Intergenic
1183032099 22:35113956-35113978 CCCCAGGGAGGAAAAAAGTCAGG + Intergenic
949135307 3:557965-557987 CTCCAGAGAAGCAAATATACTGG + Intergenic
950151206 3:10688905-10688927 CACCATGGAGGGAAAGAGCCTGG - Intronic
952350434 3:32531094-32531116 CTCCTGGGAAGAAAATAGACTGG - Intronic
952834532 3:37591926-37591948 CCCCAGGCAGGCAAATGTCCAGG - Intronic
953943609 3:47125591-47125613 CTCCAGGAAGGCAGAAGGCCTGG - Intronic
954082939 3:48223200-48223222 CTCCAGAGAGGAAGAGAGCCAGG - Intergenic
956755132 3:72378301-72378323 CTCCAGGGATGCAAGCAGCATGG + Exonic
956995738 3:74824757-74824779 CAGCGGGGAGGCAGATAGCCAGG - Intergenic
962156566 3:132954601-132954623 CTCCATAGAAGCAAATGGCCAGG + Intergenic
963346802 3:144104489-144104511 GTCCAGAGAGGCAAATTGCCAGG + Intergenic
965850653 3:173018865-173018887 ATCCAGGAAGGAAAAAAGCCTGG + Intronic
966651229 3:182303338-182303360 CTCCAAGGTGGCAAGTAGCCAGG + Intergenic
967549586 3:190774915-190774937 TTCTAGTGAGGAAAATAGCCTGG + Intergenic
971456982 4:26854464-26854486 ATCCAGGGAGGCACATAAGCTGG - Intergenic
973757225 4:54087210-54087232 CCCCAGGGAAGGAAAGAGCCTGG + Intronic
977845441 4:101761667-101761689 CCCCAGGGAGGCTTGTAGCCTGG - Intronic
977929679 4:102737322-102737344 CAGCAGGGAGGCTTATAGCCTGG + Intronic
978033791 4:103970736-103970758 CTACAGGGAGGAAAATAACTTGG + Intergenic
978135775 4:105257552-105257574 ATCCAGAGCTGCAAATAGCCTGG - Intronic
979434572 4:120673466-120673488 CTGCAGGGAGGCTTATGGCCTGG + Intergenic
981346590 4:143683739-143683761 CAGCTGGGAGGCAGATAGCCTGG + Intronic
981468222 4:145098414-145098436 CTCCAGGTACGTGAATAGCCCGG + Exonic
982800349 4:159698003-159698025 CAACAGGGAGGCTTATAGCCTGG - Intergenic
985008720 4:185560557-185560579 CCCCAGGGAGGCAGAGAGGCTGG - Intergenic
988200925 5:28067098-28067120 CTGCAGGGAGGCAAGCACCCTGG + Intergenic
991942000 5:71862332-71862354 CTCCAGGGAAGCAGACAGCTGGG - Intergenic
996756117 5:126936964-126936986 CTGCAGCGTGGCAAAGAGCCTGG - Intronic
998099374 5:139419372-139419394 CTCCAGAGAGGGAAATAGGGGGG + Intronic
1000264445 5:159621276-159621298 CATCAGGGAGGCTCATAGCCTGG + Intergenic
1002886111 6:1295709-1295731 CTCCAGGGAGGCAGACAGGTGGG + Intergenic
1003258923 6:4498308-4498330 CTCCAGGGATGCAAAGAAGCTGG + Intergenic
1004806042 6:19205079-19205101 CTGCAGGGAGGCAGGTACCCTGG - Intergenic
1005876458 6:30013690-30013712 GTCAAGGGAGGGAACTAGCCGGG - Intergenic
1006524062 6:34588949-34588971 CTGCAAGGAGTCATATAGCCTGG - Exonic
1010936064 6:81863221-81863243 CACCATAGAGGGAAATAGCCTGG + Intergenic
1013293155 6:108736083-108736105 CTCCACGGAGGCCAATTTCCAGG + Intergenic
1013852687 6:114534852-114534874 CAGCTGGGAGGCAGATAGCCTGG - Intergenic
1013929751 6:115516510-115516532 CTGCAGGGTGGCAAAGAGTCTGG + Intergenic
1018034623 6:159871628-159871650 CTGCAGGCAGGCACATGGCCTGG + Intergenic
1022974963 7:35548414-35548436 CTACAGGGAGGCAGATAGGAGGG - Intergenic
1023643467 7:42284600-42284622 CTCCAGGTAGGCTAATAATCTGG + Intergenic
1026824529 7:73573164-73573186 CTCCAGGGGAGCACAGAGCCAGG + Intronic
1027162534 7:75813199-75813221 CTCCAGGGATGCACAGAGCTGGG + Intronic
1028647924 7:93119402-93119424 CAGCAGGGAGGCTGATAGCCAGG + Intergenic
1028880543 7:95875051-95875073 CTCAAGGGAGTCCATTAGCCAGG + Intronic
1029336288 7:99902612-99902634 CTCCAGGGAGGCACCAAGGCAGG - Intronic
1030182223 7:106721930-106721952 CTCCAGTGTGGTAAATAGACTGG - Intergenic
1031247745 7:119338360-119338382 CTTCAGGGAGAAAAATAGGCAGG - Intergenic
1032079375 7:128851067-128851089 CCCCAGGGAGGCTTATACCCTGG + Intronic
1033322357 7:140351281-140351303 CTCCAGGAAGGCAACATGCCTGG + Exonic
1033755296 7:144394073-144394095 ATACAGGGTGGCAAAGAGCCTGG + Intergenic
1033810122 7:145002188-145002210 CTCCAGGGCGGGATATAGTCTGG + Intergenic
1034191828 7:149219098-149219120 CTCCAGGGAGGGAAAGGGGCTGG - Intronic
1034258143 7:149735632-149735654 CTACAGGGTGGCAAAGAGCAAGG - Intergenic
1034971108 7:155419764-155419786 CACCAGGGAGGCGATGAGCCAGG + Intergenic
1035472595 7:159119803-159119825 GTCCAGGGATGCACAAAGCCTGG + Intronic
1040741316 8:50579566-50579588 CCCCAGGGATGCACATAGCAGGG - Intronic
1044907205 8:97017487-97017509 CAGCTGGGAGGCAAGTAGCCTGG + Intronic
1045178097 8:99748321-99748343 CTACAGAGAGGCAAATTTCCTGG - Intronic
1047206205 8:122804534-122804556 CTCCTGGGAGGCACATAGGCAGG + Intronic
1047337690 8:123952308-123952330 CTGCAGGGAGGCAGCCAGCCTGG - Intronic
1047353249 8:124095931-124095953 GGCCAGGGATGCAAATTGCCTGG - Intronic
1048508843 8:135044241-135044263 CTCCAGGGAAGCCAAGAGACAGG + Intergenic
1049036580 8:140081036-140081058 CTCCAGGGAGGCACCCACCCTGG + Intronic
1049213391 8:141396897-141396919 ATCCAGGGAAGGAAACAGCCTGG + Intronic
1052311498 9:27073959-27073981 CTCCAGTGACTCAAATGGCCAGG - Intergenic
1053136120 9:35651062-35651084 CTCAAGGGGGGCAAAGGGCCTGG - Intergenic
1053517324 9:38741965-38741987 CACCAGGCAGACAAATACCCTGG + Intergenic
1058948281 9:109879263-109879285 AGCCAGGGAGCCAAAGAGCCAGG + Intronic
1059398854 9:114056070-114056092 CTCCAGGGAGTCACATTGCATGG + Exonic
1059447346 9:114346709-114346731 CTCCAGGAAGGCAGCGAGCCAGG - Exonic
1060800844 9:126545170-126545192 CTCCAGGGAGTCAGCCAGCCTGG - Intergenic
1062625317 9:137439777-137439799 CTCCAGGTAGGCAAAGAGGTTGG + Intronic
1185730850 X:2460447-2460469 CTCCAGGCTGGGCAATAGCCTGG - Intronic
1185733794 X:2481994-2482016 CTCCAGGCTGGGCAATAGCCTGG - Intronic
1187681369 X:21770787-21770809 CAGCAGGGAGGCAGATAGCCTGG + Intergenic
1187748338 X:22433420-22433442 CAGCTGGGAGGCACATAGCCTGG + Intergenic
1188045954 X:25426357-25426379 CAGCTGGGAGGCAAGTAGCCTGG - Intergenic
1189204930 X:39229728-39229750 CTCCAGGGTGGCAAAGGTCCAGG - Intergenic
1190524017 X:51310575-51310597 CTGCAGGGAGGCAGGTACCCTGG - Intergenic
1191005061 X:55702602-55702624 AGCCAGGGAGGCAAGTAGTCTGG + Intergenic
1191080320 X:56504062-56504084 CATCTGGGAGGCAGATAGCCTGG + Intergenic
1192146796 X:68687931-68687953 CTCCAGGAAGGCAGGTACCCAGG + Intronic
1192312505 X:70028298-70028320 CTACAGGGAGGCCAAGAGTCAGG - Intronic
1192965784 X:76175225-76175247 ATCCACGGAGGGCAATAGCCAGG + Intronic
1194224949 X:91244915-91244937 CTCCAGGGAAGCATGTAGCCTGG - Intergenic
1198480474 X:137035396-137035418 CTACAGAGAGGCAAATTGACAGG + Intergenic
1198505376 X:137295941-137295963 CTTCAGGGAGCCACATAGCTTGG + Intergenic
1198552953 X:137763412-137763434 CTCCAGGAAAGCATATAGCAGGG - Intergenic
1200135471 X:153872525-153872547 GTCCAGGGAGGCACAAGGCCGGG + Intronic
1200561412 Y:4708225-4708247 CTCCAGGGAAGCATGTAGCCTGG - Intergenic
1200690820 Y:6305515-6305537 CGCTAGGGAGGAAAGTAGCCGGG + Intergenic
1201044452 Y:9869201-9869223 CGCTAGGGAGGAAAGTAGCCGGG - Intergenic