ID: 1131132835

View in Genome Browser
Species Human (GRCh38)
Location 15:89911036-89911058
Sequence TCCCAGTGGCCTTGTAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131132835_1131132844 17 Left 1131132835 15:89911036-89911058 CCCCTCCTACAAGGCCACTGGGA 0: 1
1: 0
2: 1
3: 22
4: 163
Right 1131132844 15:89911076-89911098 CTCAGTCTTATCTACAAAATGGG 0: 1
1: 0
2: 9
3: 53
4: 344
1131132835_1131132845 18 Left 1131132835 15:89911036-89911058 CCCCTCCTACAAGGCCACTGGGA 0: 1
1: 0
2: 1
3: 22
4: 163
Right 1131132845 15:89911077-89911099 TCAGTCTTATCTACAAAATGGGG 0: 1
1: 0
2: 11
3: 59
4: 384
1131132835_1131132846 21 Left 1131132835 15:89911036-89911058 CCCCTCCTACAAGGCCACTGGGA 0: 1
1: 0
2: 1
3: 22
4: 163
Right 1131132846 15:89911080-89911102 GTCTTATCTACAAAATGGGGAGG 0: 1
1: 0
2: 4
3: 41
4: 221
1131132835_1131132843 16 Left 1131132835 15:89911036-89911058 CCCCTCCTACAAGGCCACTGGGA 0: 1
1: 0
2: 1
3: 22
4: 163
Right 1131132843 15:89911075-89911097 CCTCAGTCTTATCTACAAAATGG 0: 1
1: 2
2: 8
3: 50
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131132835 Original CRISPR TCCCAGTGGCCTTGTAGGAG GGG (reversed) Intronic
900562646 1:3315054-3315076 TCCCACTGGCCTTCGAGGAGCGG - Intronic
902881572 1:19375033-19375055 TCCCCGTGGCTTTGGAGCAGAGG - Intronic
903128431 1:21263034-21263056 TCCCAGAGGCCTTGAAGGGGAGG + Intronic
904605492 1:31695731-31695753 TCCCAGTGGACTGGCAGCAGGGG - Intronic
904610386 1:31722867-31722889 AGTCAGTGGCCTTGGAGGAGTGG + Intergenic
904649365 1:31993059-31993081 TCCCAGTTGGCTTGTATGACAGG + Intergenic
905919623 1:41710781-41710803 TCCCTGTGGCCGTGCAGCAGTGG + Intronic
906318115 1:44800851-44800873 TGTCAGTGGCCTCGTAGCAGCGG - Exonic
907388685 1:54142192-54142214 CCCCACTGGCCTCGTAGGAGTGG - Intronic
911240673 1:95462452-95462474 TCTCAGTGACCTTGTAGGGAGGG + Intergenic
913192457 1:116425171-116425193 TCCAAGTGGGCTTGTTGCAGTGG - Intergenic
913398446 1:118398852-118398874 TCCCAGTGGTCTTGCAAGAAAGG - Intergenic
913540680 1:119817635-119817657 TCACTGAGGCCTTGTAAGAGTGG + Intergenic
915622424 1:157093904-157093926 GCCGAGTGCCCTTGGAGGAGAGG - Intronic
918259465 1:182782493-182782515 CCCCAGTGGCCTCGTGGCAGGGG + Intergenic
919100173 1:193086325-193086347 TACCAGTTGCCTTGAAGGAATGG - Intronic
919810629 1:201406914-201406936 AGCCAGTGGCCCTCTAGGAGGGG - Exonic
921152915 1:212415817-212415839 TCCCAGTGGCCTGAGTGGAGGGG - Intergenic
922898183 1:229116680-229116702 ACACAGTGGCCTGGTGGGAGGGG + Intergenic
923348376 1:233079837-233079859 TCCCAGTGGACTTGGTGGTGTGG - Intronic
923497536 1:234538508-234538530 TCCCAGTGAACTGGCAGGAGAGG + Intergenic
923730721 1:236547179-236547201 TCCCAGTGGCCTTCTCAGAGTGG + Intronic
924707062 1:246510084-246510106 TCCCAGTGGACTTGGATGTGGGG - Intergenic
1069896898 10:71685594-71685616 CCACAGTGGCCTAGTAGAAGAGG + Intronic
1070025172 10:72625685-72625707 TCCCAGTCGCCTGTGAGGAGGGG + Intronic
1070849412 10:79551594-79551616 GCCCTGTTGCCTTGTAGGTGTGG + Intergenic
1071173895 10:82900656-82900678 TCACAGTGGCCTTATAGGGTTGG + Intronic
1071562676 10:86655922-86655944 GCACAGGGGCCTTCTAGGAGTGG - Intronic
1075850441 10:125581974-125581996 TCACTGTGGCCTTGTATGAGTGG - Intronic
1077335659 11:2002740-2002762 TGCCAGAGACCCTGTAGGAGGGG + Intergenic
1080871874 11:36243512-36243534 CTGCAGTGGCTTTGTAGGAGGGG + Intergenic
1083213563 11:61204331-61204353 TCCCAGGGGTCTTGGAGGACGGG + Intronic
1083216446 11:61223167-61223189 TCCCAGGGGTCTTGGAGGACGGG + Intronic
1083219328 11:61241993-61242015 TCCCAGGGGTCTTGGAGGACGGG + Intronic
1083610935 11:64004001-64004023 CCCCAGTGGCATTTGAGGAGCGG - Intronic
1085792822 11:79510747-79510769 CCCCAGTGGCCTTACAGTAGAGG + Intergenic
1086856789 11:91875010-91875032 TACCAGTGGCTTTGTAGAAGCGG - Intergenic
1087016296 11:93557448-93557470 TCCCACTGGGCTTGTAGCTGGGG - Intergenic
1087043066 11:93820443-93820465 TCCCACTGTCCTGTTAGGAGCGG + Exonic
1087768816 11:102184648-102184670 TCCCATGGGCCTTGTGTGAGTGG + Intronic
1091308308 11:134555022-134555044 TCCCTGTGGCCTGGAAGGAGAGG - Intergenic
1202818643 11_KI270721v1_random:57922-57944 TGCCAGAGACCCTGTAGGAGGGG + Intergenic
1096243234 12:49970526-49970548 GCCCTGTGGCCTTGAAGTAGGGG - Intronic
1097489918 12:60254394-60254416 CTCCAGTTACCTTGTAGGAGTGG + Intergenic
1103256184 12:119543417-119543439 TCCCAGTGGACATGAGGGAGGGG + Intergenic
1103763922 12:123268999-123269021 TCCCAGCGCCCTGGCAGGAGGGG + Intronic
1103919616 12:124392695-124392717 TCCCAGTGGACATGTAGTGGAGG + Intronic
1104435075 12:128749084-128749106 TCCCAGTTGGCTTGGAGGAAAGG - Intergenic
1104860276 12:131919837-131919859 TCCCCGTGGCCTTGAGGGTGTGG - Intronic
1105405450 13:20128681-20128703 TCAAAGTGTCCTCGTAGGAGAGG + Intergenic
1106498848 13:30307729-30307751 TGCCAGTGGCGTCGAAGGAGGGG + Intergenic
1110472774 13:75878612-75878634 TCACAGTGACCATGTAGCAGTGG - Intronic
1111659926 13:91196413-91196435 TACCAGTGGCCCAGAAGGAGTGG - Intergenic
1114215565 14:20655426-20655448 TCCCAGTGGTCTTGGGGTAGTGG - Intergenic
1117985406 14:61381714-61381736 TCCCAGTGGCCTTGGCAGTGAGG + Intronic
1118431168 14:65720242-65720264 TCCCTGTGGGCTTGTAGTGGTGG - Intronic
1119647834 14:76361203-76361225 GCCCAGTGGCCTGGCAGGTGGGG + Intronic
1119727255 14:76928964-76928986 TCGCAGTGGCCTTGTGGCTGAGG - Intergenic
1119840561 14:77789680-77789702 TCCCAGTTGCCTAATAGGAAGGG + Intergenic
1120701805 14:87706308-87706330 GCCAAGTGGCCTTGCAGGAGAGG - Intergenic
1121439058 14:93937344-93937366 ACCAAGAGGCATTGTAGGAGGGG - Intronic
1121879326 14:97486093-97486115 TCCCATTGGACTTGTAGGCCTGG + Intergenic
1122468132 14:101948269-101948291 TCCCAGCGGCCAGGAAGGAGAGG - Intergenic
1123782900 15:23645081-23645103 TCCGGGTGGCCTTGCCGGAGCGG + Exonic
1124235706 15:27987986-27988008 TCTCAGTGGCCTTTTGGGTGAGG - Intronic
1124646231 15:31439412-31439434 TCCCAGGGGTCTGGAAGGAGAGG - Intergenic
1125029597 15:35063041-35063063 TCCCATTGGTCTTATAGGTGAGG + Intergenic
1126709635 15:51442597-51442619 TCCCAGTGGACTTGTATGCCAGG - Intergenic
1128241610 15:66105182-66105204 GCCCTGTGGCTTTGTAGGAGTGG - Intronic
1129241620 15:74255573-74255595 GCCCTGTGGCGTTGGAGGAGTGG + Intronic
1131132835 15:89911036-89911058 TCCCAGTGGCCTTGTAGGAGGGG - Intronic
1131387772 15:92021523-92021545 ACCCTCTTGCCTTGTAGGAGTGG - Intronic
1133309003 16:4830725-4830747 TCTCTGTGGCCTTGTAAGACCGG + Intronic
1133384100 16:5354882-5354904 TTCCAGTGGCCTTCTTGGAGAGG + Intergenic
1133551949 16:6864960-6864982 TCCCAGTGCCAATGTTGGAGTGG + Intronic
1137574082 16:49586919-49586941 CCCCAGCTGCCTTGGAGGAGGGG + Intronic
1138135641 16:54519108-54519130 TCCCAGTTTCCTTGTAGTAGGGG - Intergenic
1142201956 16:88765328-88765350 TCCCAGTGGCCTGGGGGGAAGGG - Intronic
1143173639 17:4944451-4944473 TTCCACTGGCTTTGTAGGTGAGG + Intronic
1143670639 17:8393450-8393472 TCCCAGTGGCCATGTCAGAAGGG - Exonic
1143732411 17:8888567-8888589 TCCGAGTGGCCTTGGAGGCGTGG - Exonic
1145887317 17:28391471-28391493 CCCCAGAGGCCATGTAGGAGGGG + Intronic
1147795032 17:43036276-43036298 TCCCAGTGGCCTGGGAGCACAGG + Intergenic
1148991837 17:51672910-51672932 TTCCAGTGGCTTTGCAGGAGGGG + Intronic
1150562428 17:66304487-66304509 TCCCCCTGGCCTAGAAGGAGAGG - Intronic
1152809338 17:82374187-82374209 TCACAGTGGCCTCCTGGGAGCGG + Intergenic
1154111883 18:11577286-11577308 TCCCAGTGCTCTTGTTGAAGGGG - Intergenic
1154201750 18:12305291-12305313 TCCCAGTGGCCCTGTAGGGAGGG - Intergenic
1157318148 18:46610729-46610751 TCCCTGTGGCCTTGGAAGGGGGG - Intronic
1158319853 18:56250657-56250679 TTCCAGTGGCTTTGCAGGAATGG - Intergenic
1158344526 18:56502720-56502742 TCCCGCTGGCCATGTAAGAGAGG - Intergenic
1160858599 19:1228227-1228249 GCGCAGTGGCCTTGGGGGAGAGG - Exonic
1165091563 19:33390792-33390814 GCCCAGGGGCCTGGGAGGAGAGG + Intronic
1165486704 19:36100959-36100981 TCCCAGTGGGCTTGTGGGAGTGG + Intronic
1168113834 19:54209756-54209778 CACCAGTGGCCTTGCAGGAGGGG + Intronic
926123871 2:10259438-10259460 TCCCTGTGGCCTGGAAGGGGTGG + Intergenic
926718857 2:15943712-15943734 ACCCAGTGCCCTTGAAGGTGAGG + Intronic
926744888 2:16143129-16143151 TTCCGCTGGCCGTGTAGGAGAGG - Intergenic
930753904 2:54957393-54957415 TCCCAGTGGCCCTCTGGGAGCGG + Intronic
930885019 2:56315329-56315351 TCCCAGCGGCCTTTTGGGAATGG + Intronic
931268942 2:60685256-60685278 AGCCAGTTGCCTTGTGGGAGTGG - Intergenic
931798971 2:65740332-65740354 TCTCAGTGGCATTTTAGAAGGGG - Intergenic
938571319 2:132564306-132564328 CCCCTGTGGCCTTGGATGAGTGG + Intronic
940134356 2:150419267-150419289 ACCCAGGGGGCTTGCAGGAGGGG + Intergenic
943581969 2:189694514-189694536 TTCCAGGGACCTGGTAGGAGGGG + Intronic
946739847 2:222790554-222790576 CCCCAGAGGCCATGTTGGAGAGG + Intergenic
948365322 2:237450881-237450903 TCCCAGTGACCAGGGAGGAGAGG + Intergenic
1168819159 20:761717-761739 CCCCAGTGGCCCTGCAAGAGGGG + Exonic
1168980937 20:2003036-2003058 TCCCTGTGGCCCTGTCAGAGTGG + Intergenic
1170177819 20:13492271-13492293 TCCCTGTGGACTTCTAAGAGGGG - Intronic
1170733008 20:18990277-18990299 TCCCAGGGGCCTAGCAGAAGGGG + Intergenic
1170850447 20:19999334-19999356 GCCCAGTGACTTTGCAGGAGAGG - Intronic
1171128722 20:22628180-22628202 TCCCAGTGGTCTATTAGTAGCGG - Intergenic
1172834891 20:37866925-37866947 TCCCCGGGGCCTTGTGGGGGTGG + Intronic
1172969339 20:38862041-38862063 GCCCAGTCTCCTTGGAGGAGAGG + Intronic
1175262113 20:57681265-57681287 TCCCAGTGGCAGTGATGGAGGGG - Intronic
1175765934 20:61592984-61593006 TCACAGGGTCCTTATAGGAGGGG + Intronic
1175964414 20:62653289-62653311 TCCCTGTGGCCTTGGGGAAGGGG + Intronic
1179634033 21:42696151-42696173 GCCCAGTGCCCCTGTATGAGGGG + Intronic
1183330931 22:37221042-37221064 TCCTATAGGCCTTGTAGGTGAGG + Intergenic
1183787464 22:40038503-40038525 TTCCTCTGGCCTTGTAGGATTGG + Exonic
949511657 3:4771916-4771938 TCCCAGGGGTCTCGTAGGTGAGG - Intronic
950625418 3:14242990-14243012 TCCCAGTAGCCTGGCTGGAGCGG - Intergenic
953438493 3:42898296-42898318 TCCCAGTTGTCTTGTGGGGGAGG - Intronic
953587083 3:44211934-44211956 CCCCAGTGGCCTTGTAGGTCAGG - Intergenic
954397890 3:50302689-50302711 CCCCAGTGGGCGTGTAGTAGGGG + Exonic
955448496 3:59040548-59040570 TACTATTGGCTTTGTAGGAGAGG - Intronic
956120032 3:65957046-65957068 TCAGAGTGGACTTGTAGGATTGG - Intronic
960943771 3:122952333-122952355 GCCCTGTGGCCTTGTTTGAGGGG - Intronic
961184706 3:124904625-124904647 TCAAACTGGCCTTGTAGCAGAGG + Intergenic
961411825 3:126727670-126727692 TCCCTCTGGGCTTCTAGGAGGGG + Intronic
961495335 3:127287469-127287491 CGGCAGTGGCCCTGTAGGAGGGG - Intergenic
964672670 3:159244313-159244335 TTCCAGAGGTTTTGTAGGAGTGG + Intronic
968629510 4:1642733-1642755 TCCCAGTGGCAGTGGACGAGTGG - Intronic
969116032 4:4871426-4871448 GCCGCGTGCCCTTGTAGGAGAGG + Intergenic
969475780 4:7421842-7421864 ATCCAGTGGGCTTGCAGGAGAGG + Intronic
973723679 4:53750932-53750954 GCCAAGGGGCCTTGAAGGAGGGG + Intronic
978473015 4:109092150-109092172 TCCCCGTGGACTTGTGGTAGTGG - Intronic
980435582 4:132767746-132767768 TCCCAGTGTTGTTGGAGGAGAGG - Intergenic
980742690 4:136973114-136973136 GCCCTGTGGCTTTGTAGGAAGGG + Intergenic
983031887 4:162813251-162813273 TTGCAGTGGCCTTGATGGAGAGG - Intergenic
986504092 5:8430607-8430629 TCGCAGCGGCCTTGCTGGAGTGG + Intergenic
992676772 5:79112741-79112763 TCCCAGTGGCTTGTTGGGAGGGG + Intronic
994045598 5:95305966-95305988 GCCCAGGGGCCTTGAGGGAGAGG - Intergenic
996089165 5:119334019-119334041 TCCCAGTGGTCTGGTAGCAGTGG + Intronic
997997608 5:138598987-138599009 ACCCAGTGGCCTTGCCAGAGAGG - Intergenic
999297971 5:150472498-150472520 ACCCAGTGGCCTTGTCAGGGGGG - Intergenic
999670581 5:153955968-153955990 TCACAGTGTCCTTATAAGAGAGG - Intergenic
1001436797 5:171705502-171705524 TCCCACTGCCCTGGGAGGAGAGG - Intergenic
1001693270 5:173648578-173648600 TCACAGTGGCCATGTAGCATGGG + Intergenic
1002026847 5:176401527-176401549 CCACAGTGCCCTTGTAGGGGAGG + Intronic
1003184639 6:3820475-3820497 ACCCAGGGGCCTTGTTGGTGTGG + Intergenic
1003852316 6:10237621-10237643 TCCCAGTTGCCTTTTTGGAGTGG - Intergenic
1006830874 6:36967511-36967533 TCCCAGTGGCCTAGTAACAGTGG - Intergenic
1007909074 6:45495044-45495066 ACACAGTGGCCTTGGAGGATGGG - Intronic
1016799074 6:148150231-148150253 TGCCAGTAGCTTTGTAGGAAAGG + Intergenic
1018170473 6:161139811-161139833 TCCCAGTGTCCCTGTGGGAGGGG - Intronic
1018726055 6:166614359-166614381 TCCCAGTGTCCTTCTGGGAATGG - Intronic
1019046070 6:169147080-169147102 TCCCAATGGCCTTGGCCGAGAGG - Intergenic
1020036997 7:4970068-4970090 TCCCACTGGCACTGAAGGAGAGG - Intergenic
1022283443 7:28933311-28933333 TGCCAGTGGCCTTGGAGATGGGG + Intergenic
1024977097 7:55123702-55123724 TCCCAGTGGCAGTTTATGAGGGG + Intronic
1034640466 7:152598021-152598043 TCTCAGTGGGCTTGTGGGACTGG + Intergenic
1035152169 7:156883819-156883841 TCACAGGGTCCTTATAGGAGAGG - Intronic
1035233978 7:157484457-157484479 GCGCAGTGGCGATGTAGGAGGGG - Intergenic
1035600131 8:892470-892492 CCCCAGGGGCATTGTATGAGTGG - Intergenic
1038933686 8:32223951-32223973 TCACTGTGGCCTGGAAGGAGAGG + Intronic
1041027718 8:53703935-53703957 TCCCAGAGACCTTGGAGGACTGG - Intergenic
1045485628 8:102628738-102628760 TCCCAGCCGCCTTGCAGGAAAGG + Intergenic
1047595675 8:126375361-126375383 TCCTAGTGGCCTTGAAAGGGTGG + Intergenic
1048600904 8:135917675-135917697 TCCAAGTGGCCTGGGAGGAAGGG + Intergenic
1049621672 8:143601019-143601041 CCCCAGTGTCCTCCTAGGAGAGG + Exonic
1051445349 9:17134667-17134689 TGGCAGGGGCCTTGAAGGAGAGG + Intergenic
1051900990 9:22040056-22040078 TCCCTGTAGCCTTGAGGGAGAGG + Intergenic
1052376215 9:27720533-27720555 TCCCACTGGCTTTGAAGAAGTGG - Intergenic
1054790791 9:69254424-69254446 TCCCGGCGGCCTGGCAGGAGTGG - Exonic
1056133103 9:83604720-83604742 TCACAGTGACCTTGTAAGATTGG - Intergenic
1060429141 9:123533848-123533870 CCACAGTGGCCGTGGAGGAGAGG - Intronic
1061475517 9:130863183-130863205 TTCCTGTGTCTTTGTAGGAGTGG + Intronic
1062358373 9:136175788-136175810 TCCGAGGGGCCTTCGAGGAGGGG + Intergenic
1062572822 9:137193480-137193502 TCCCAGTGGCCTTGAAGCCCAGG + Intronic
1186544261 X:10432847-10432869 ACCCAGTGGCCTGGAAGCAGAGG + Intergenic
1189259711 X:39669736-39669758 GCACAGTTGCCCTGTAGGAGCGG + Intergenic
1194587951 X:95759807-95759829 TCCCAGAGGTTTTGCAGGAGAGG + Intergenic
1197525824 X:127561544-127561566 TACCAGGGGCCTGGTAGGATAGG - Intergenic
1198440637 X:136659859-136659881 TTCCTATGGCCTTGTTGGAGGGG + Exonic
1198497578 X:137208195-137208217 TCTCAGTGTCCTTGGAGGATTGG + Intergenic