ID: 1131132844

View in Genome Browser
Species Human (GRCh38)
Location 15:89911076-89911098
Sequence CTCAGTCTTATCTACAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 9, 3: 53, 4: 344}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131132840_1131132844 3 Left 1131132840 15:89911050-89911072 CCACTGGGAGTTACTGGAACCAG 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1131132844 15:89911076-89911098 CTCAGTCTTATCTACAAAATGGG 0: 1
1: 0
2: 9
3: 53
4: 344
1131132833_1131132844 18 Left 1131132833 15:89911035-89911057 CCCCCTCCTACAAGGCCACTGGG 0: 1
1: 0
2: 0
3: 38
4: 244
Right 1131132844 15:89911076-89911098 CTCAGTCTTATCTACAAAATGGG 0: 1
1: 0
2: 9
3: 53
4: 344
1131132836_1131132844 16 Left 1131132836 15:89911037-89911059 CCCTCCTACAAGGCCACTGGGAG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1131132844 15:89911076-89911098 CTCAGTCTTATCTACAAAATGGG 0: 1
1: 0
2: 9
3: 53
4: 344
1131132837_1131132844 15 Left 1131132837 15:89911038-89911060 CCTCCTACAAGGCCACTGGGAGT 0: 1
1: 0
2: 1
3: 16
4: 110
Right 1131132844 15:89911076-89911098 CTCAGTCTTATCTACAAAATGGG 0: 1
1: 0
2: 9
3: 53
4: 344
1131132835_1131132844 17 Left 1131132835 15:89911036-89911058 CCCCTCCTACAAGGCCACTGGGA 0: 1
1: 0
2: 1
3: 22
4: 163
Right 1131132844 15:89911076-89911098 CTCAGTCTTATCTACAAAATGGG 0: 1
1: 0
2: 9
3: 53
4: 344
1131132838_1131132844 12 Left 1131132838 15:89911041-89911063 CCTACAAGGCCACTGGGAGTTAC 0: 1
1: 0
2: 0
3: 12
4: 84
Right 1131132844 15:89911076-89911098 CTCAGTCTTATCTACAAAATGGG 0: 1
1: 0
2: 9
3: 53
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131132844 Original CRISPR CTCAGTCTTATCTACAAAAT GGG Intronic
903039828 1:20521063-20521085 CTCTTTCTCATCTGCAAAATGGG - Intergenic
903040083 1:20522933-20522955 CTCTTTCTCATCTGCAAAATGGG + Intergenic
903250783 1:22052058-22052080 TTCCGTCTTCTCTGCAAAATGGG + Intergenic
903649321 1:24913419-24913441 AGCTGTCTTATCTGCAAAATGGG + Intronic
903876408 1:26477185-26477207 CTCACTCTCGACTACAAAATGGG - Intergenic
904853841 1:33480192-33480214 CTTAGTTTAATCTATAAAATGGG - Intronic
905775012 1:40662815-40662837 CTCAGTCTCCTCTGGAAAATAGG - Intronic
905782326 1:40723044-40723066 CTCAACCTTATCTGTAAAATTGG + Intronic
905927215 1:41759996-41760018 TTCAGTCTCATCTATAAAATGGG + Intronic
906335767 1:44928991-44929013 CTCAGTTTCATCTATAAAATGGG + Intronic
907446871 1:54513822-54513844 CTCAGCCTTAGCTGCAAAATGGG + Intergenic
907840508 1:58152545-58152567 CTCAGTCTTCTCTGCAAAATGGG + Intronic
908257922 1:62318175-62318197 CAAAGTCCTATCTACCAAATAGG - Intronic
908799911 1:67868922-67868944 CTCATTATTATCTAGAATATAGG + Intergenic
909926675 1:81445791-81445813 CACATTCTTATTTGCAAAATGGG + Intronic
910326101 1:86008992-86009014 CTCAGTCTTTTCAACAACAACGG - Intronic
910483812 1:87687887-87687909 TTCAGTTTTCTCTATAAAATGGG - Intergenic
910711167 1:90182928-90182950 CTCAGTTTTATGTGCAAAATAGG + Intergenic
914233096 1:145782661-145782683 GTGAGTCATACCTACAAAATTGG + Intronic
914394842 1:147255653-147255675 CTGAATCTTATCTAAAAAAATGG - Intronic
915166424 1:153950410-153950432 CTCAGTCTTTCCTACAAAAGAGG + Intronic
916370220 1:164084682-164084704 GTCAGTCTTATCATGAAAATAGG - Intergenic
916797945 1:168185339-168185361 CTCAGTTTTATCAATAAATTGGG + Intronic
917208828 1:172609618-172609640 TTCAGTAGTATTTACAAAATGGG + Intronic
917715984 1:177738304-177738326 CTCATTCACATCTGCAAAATGGG + Intergenic
919745783 1:201008444-201008466 CTGAGCCTCATCTGCAAAATGGG - Intronic
919894789 1:202002807-202002829 CTCAGTTTTATCTATAAAGTGGG - Intronic
920320266 1:205116318-205116340 CTCAGTTTTAACTTCTAAATTGG + Intronic
921566874 1:216732287-216732309 CTCAGTGTCATCTATAAAATGGG - Intronic
921631220 1:217436752-217436774 ATCAGTTACATCTACAAAATGGG - Intronic
923288964 1:232526059-232526081 ATCAGTATTATCTACATAAAAGG + Intronic
924185487 1:241484954-241484976 AGCAGTCTTCTCTGCAAAATGGG - Intergenic
924405204 1:243737234-243737256 CTCATACTCATCTGCAAAATGGG + Intronic
924673551 1:246152804-246152826 CTCAGCCACATCTGCAAAATGGG + Intronic
1063082561 10:2782448-2782470 CTCAGTTTCTTCTACAAAACGGG - Intergenic
1063912415 10:10844973-10844995 CTCACACTTTTCTACAAAAATGG - Intergenic
1065146585 10:22774818-22774840 CTCAGTTTCATCTGCAAAATGGG + Intergenic
1066612213 10:37261098-37261120 CTGAGGCTTATCTTAAAAATAGG + Intronic
1067462874 10:46470805-46470827 CTCAGTCTTGTCAACAACATAGG + Intergenic
1067624320 10:47913833-47913855 CTCAGTCTTGTCAACAACATAGG - Intergenic
1068267880 10:54677689-54677711 CTCAATGTTACCTAAAAAATTGG - Intronic
1068733283 10:60384088-60384110 CTTAGTTTTACCTACAAAAATGG + Intronic
1069065749 10:63940095-63940117 CTCAATCTTATCTAAAAAATGGG + Intergenic
1069100094 10:64309524-64309546 CTCATTTTTATCTGTAAAATGGG - Intergenic
1071843198 10:89494490-89494512 CTCAATCTGCTGTACAAAATTGG - Intronic
1072557014 10:96526349-96526371 CTCATTTTTATCTGTAAAATGGG - Intronic
1073278754 10:102335701-102335723 CTCATTTTTATCTTCAAAATGGG + Intronic
1073445417 10:103577444-103577466 CTGTTCCTTATCTACAAAATGGG - Intronic
1074279338 10:112036321-112036343 CCCACTCTGATCTACAAGATAGG + Intergenic
1074381573 10:112985010-112985032 CTTAGTTTTATCTATAAAATGGG + Intronic
1074618168 10:115091969-115091991 CTCTTTCTCATCTGCAAAATGGG + Intergenic
1074680409 10:115900619-115900641 CTCAGTGCTATCTACAAAATGGG - Intronic
1075560722 10:123466608-123466630 TGCAGCCTTTTCTACAAAATAGG - Intergenic
1075931995 10:126306252-126306274 CTCATTTTTATCTCCAAAGTAGG - Intronic
1075968410 10:126632434-126632456 CTCAGTATTATCTACCAAATGGG - Intronic
1075968414 10:126632475-126632497 CTCAGTATTATCTACCAAATGGG + Intronic
1078226640 11:9397891-9397913 CTAAGTCTCAATTACAAAATAGG - Intronic
1079315621 11:19405716-19405738 CTCAGTCCCATCTGTAAAATGGG + Intronic
1079591024 11:22182779-22182801 CTCAATCTGCTCAACAAAATTGG - Intergenic
1079846410 11:25475892-25475914 CTAAGTATTAGCTATAAAATTGG - Intergenic
1080338776 11:31232046-31232068 CTTAGTCTTACATTCAAAATAGG + Intronic
1080403384 11:31957368-31957390 CTCAGTTTCATCTGGAAAATGGG - Intronic
1080743065 11:35083381-35083403 CACCTTCTTATCTGCAAAATAGG - Intergenic
1081621882 11:44623723-44623745 CTTAGTCTTATCGGGAAAATGGG + Intergenic
1082124706 11:48418460-48418482 CTCAGTCTCATGTTCAAAATTGG - Intergenic
1082251350 11:49984307-49984329 CTCAGTCTCATGTTCAAAATTGG + Intergenic
1084104535 11:66972624-66972646 TTCAGTCTCATCTGTAAAATGGG - Intergenic
1084571828 11:69964542-69964564 ATCAATCTTACCTTCAAAATAGG + Intergenic
1084850112 11:71932301-71932323 CTCAGTTTCATTTATAAAATGGG - Intronic
1084966568 11:72747660-72747682 CTTAGTCTCATCAGCAAAATGGG + Intronic
1085732688 11:79012916-79012938 CTCAGTGTCATCTGCAAAAGAGG - Intronic
1085795841 11:79538826-79538848 CTCAATATCAGCTACAAAATGGG - Intergenic
1086017881 11:82189213-82189235 GTTAGTCATATATACAAAATGGG - Intergenic
1088512490 11:110592510-110592532 CTTAGTCTCATCTTTAAAATGGG - Intronic
1088682877 11:112259331-112259353 CTGTTTCTCATCTACAAAATGGG + Intronic
1088778619 11:113111617-113111639 CTCAGGATTGTATACAAAATAGG + Intronic
1088987561 11:114923289-114923311 CTCAGGCTTATTTAAAAAATTGG + Intergenic
1089062920 11:115640937-115640959 CTTAGTCTCATCTGTAAAATGGG - Intergenic
1090435485 11:126683513-126683535 TTCTTTCTTATCTGCAAAATGGG + Intronic
1090464191 11:126919207-126919229 CTCAATCTCATCCACAACATGGG - Intronic
1090615407 11:128509850-128509872 CAATTTCTTATCTACAAAATGGG + Intronic
1092104864 12:5914246-5914268 CTCAGTCCTCTCTGCTAAATGGG + Intronic
1093078094 12:14777684-14777706 CTCAGTTTCATCTCTAAAATGGG + Intronic
1094798022 12:33999277-33999299 CTCATTTTCATTTACAAAATGGG + Intergenic
1095932765 12:47645423-47645445 CTAATTCTTATTTAAAAAATAGG - Intergenic
1096318881 12:50593573-50593595 CTCTTTCTCATCTGCAAAATGGG - Intronic
1097925215 12:65120182-65120204 CTGAGTCTTATCAAAATAATGGG + Intronic
1098360653 12:69651314-69651336 CTTATTCTCATCTATAAAATGGG - Intronic
1098607736 12:72413615-72413637 CTCGTTTTTATCTATAAAATAGG - Intronic
1099410510 12:82320965-82320987 CTCAGTATCATGTGCAAAATAGG + Intronic
1100002126 12:89849857-89849879 CTCAGTTTTCTCTGTAAAATGGG + Intergenic
1100088510 12:90939996-90940018 CTCAGGTTTATCTGTAAAATGGG + Intronic
1100370661 12:93966380-93966402 CTAAGTCTTAAGTACACAATGGG - Intergenic
1101169888 12:102080620-102080642 CTCAATCTCATCTGAAAAATGGG - Intronic
1102048363 12:109844388-109844410 CTCAGTTTCATCTTTAAAATTGG - Intergenic
1102548882 12:113676439-113676461 CTCAGTCTTGGCTATAAAATGGG + Intergenic
1102595367 12:113988236-113988258 CTTAGCCTTATCTGTAAAATGGG - Intergenic
1103162327 12:118739863-118739885 CTGAGCCTTATCTATAAAATAGG - Intergenic
1103640658 12:122349148-122349170 CTAATCCTTATCTACATAATTGG + Intronic
1105302072 13:19144282-19144304 CTGAGTTTAATCTACAAAATAGG + Intergenic
1105987774 13:25586114-25586136 CTCAGTTTTATCTTTAAAAGGGG - Intronic
1106087066 13:26552205-26552227 CTGGGCCTTATCTATAAAATGGG + Intergenic
1106498028 13:30299295-30299317 CTCAATTCTGTCTACAAAATAGG + Intronic
1106522974 13:30514145-30514167 CTGGTTCTTATCTATAAAATGGG + Intronic
1106700413 13:32222718-32222740 CACTTTCTTCTCTACAAAATGGG + Intronic
1107619448 13:42211247-42211269 CTGAGTCTTATCTACCGAATGGG + Intronic
1107979783 13:45723635-45723657 CTCAATCTTTTGGACAAAATGGG + Intergenic
1108193571 13:47968933-47968955 CTCTTTCTTATCTATAAAATGGG - Intronic
1108793605 13:54003323-54003345 CTCAGTTTTATCAACCGAATTGG + Intergenic
1108932573 13:55845387-55845409 ATCAATCTTTTCTATAAAATTGG - Intergenic
1109567758 13:64140415-64140437 CTCAATTTTATAAACAAAATAGG + Intergenic
1110164499 13:72423243-72423265 CTAAGTTTTAGCTAGAAAATAGG - Intergenic
1111109219 13:83685558-83685580 CTGAATGATATCTACAAAATTGG - Intergenic
1112276207 13:98022727-98022749 AACAATCTTAGCTACAAAATTGG - Exonic
1112768259 13:102769783-102769805 CTGTGCCTTATCTATAAAATGGG - Intronic
1113365823 13:109675060-109675082 CTCAGTGTTCTCTGTAAAATGGG + Intergenic
1114393341 14:22333734-22333756 TTCAGTCTTTTTTAAAAAATGGG + Intergenic
1115604464 14:34986544-34986566 CTCAGTCATTACTAAAAAATTGG + Intronic
1116866613 14:50036601-50036623 CACAGACTTTTCTATAAAATAGG + Intergenic
1117378930 14:55140677-55140699 CTCAGTTTTGTCTATAAAAAGGG - Intronic
1118067946 14:62212472-62212494 TTCAGTTTTATCCCCAAAATGGG + Intergenic
1119797118 14:77408649-77408671 CTCAGTCTCATCTGTAAAATGGG - Intronic
1120250661 14:82058919-82058941 CTGACTGGTATCTACAAAATAGG + Intergenic
1120367105 14:83584920-83584942 CTCAGTATCATTTACTAAATAGG + Intergenic
1120690731 14:87589773-87589795 ATCATTCTTATCTATAAAACAGG + Intergenic
1120760974 14:88284872-88284894 TTCACTCTCATCTATAAAATGGG + Intronic
1121351829 14:93179593-93179615 CTCAGTCTCATCCGTAAAATGGG + Intergenic
1121936525 14:98024433-98024455 CTCAATTCTATCTGCAAAATGGG - Intergenic
1122169052 14:99856107-99856129 TTCATTCTCATCTATAAAATGGG - Intronic
1123926910 15:25123482-25123504 GTCAGTCTTATCTATTAAGTGGG + Intergenic
1124703430 15:31937524-31937546 CTGAGTGGTATCCACAAAATGGG - Intergenic
1124872491 15:33557181-33557203 CTCAGTGTTATCTATAAAGTAGG + Intronic
1127859281 15:62979652-62979674 CTAAATATTATCTACAAAACAGG + Intergenic
1128291895 15:66484459-66484481 ATCAGCCTCATCTATAAAATGGG - Intronic
1128336485 15:66789108-66789130 CTGAGACTCATCTATAAAATGGG - Intergenic
1128694772 15:69752775-69752797 ACTAGTCTCATCTACAAAATAGG + Intergenic
1130228942 15:82081904-82081926 CTCAGTCTTGTCTGCAAATTTGG + Intergenic
1131105466 15:89731095-89731117 CTCTGCCTCATCTATAAAATGGG + Intronic
1131132844 15:89911076-89911098 CTCAGTCTTATCTACAAAATGGG + Intronic
1133230119 16:4362422-4362444 CTGAGTCTCACCTGCAAAATAGG - Intronic
1133272789 16:4618858-4618880 CTCAGTTTTATCTGTAAAATAGG - Intronic
1133333491 16:4990995-4991017 CTCAGTGTTATCTGTTAAATGGG + Intronic
1133743140 16:8666612-8666634 CTCAGTCCCATCTGTAAAATGGG - Intergenic
1133749016 16:8710218-8710240 CTCAGTCCTAGGCACAAAATAGG + Intronic
1135943747 16:26845470-26845492 CTCAGTCTAGTCTATAAAATAGG - Intergenic
1136061108 16:27727031-27727053 CTCAGCTTTATCTGAAAAATGGG + Intronic
1136514677 16:30761092-30761114 CTCAGTCTCATCTGTAAAATGGG + Exonic
1137376249 16:47954444-47954466 CTCCCTCTTTTCTGCAAAATGGG - Intergenic
1137760942 16:50939834-50939856 CTCAGTTTTCTCTACAAAATGGG + Intergenic
1138652442 16:58468390-58468412 CTCAGTCTTATCAGTAAAATGGG + Intronic
1140626672 16:76803059-76803081 CTCAGTCACTTCTACAGAATGGG + Intergenic
1140648869 16:77065129-77065151 CACTGCCTTATCTGCAAAATGGG + Intergenic
1140892375 16:79296114-79296136 CTTAGCCTTATCTGTAAAATGGG + Intergenic
1143923341 17:10348411-10348433 CTCAGTTTTGTCTGTAAAATGGG + Intronic
1144949262 17:18985271-18985293 CATTGTCTTGTCTACAAAATGGG - Intronic
1145240656 17:21239425-21239447 CTCAGTATCATCTATCAAATAGG + Exonic
1147349421 17:39828551-39828573 GTCTGACTTAGCTACAAAATCGG - Intronic
1147955615 17:44132456-44132478 CTTGGTCTTATCTGGAAAATAGG + Intergenic
1148008337 17:44453341-44453363 CTCAGTTTCTTCCACAAAATGGG + Intronic
1148972956 17:51500293-51500315 CTCACTATTTTCTGCAAAATTGG + Intergenic
1149129463 17:53280512-53280534 CATATTCTCATCTACAAAATAGG - Intergenic
1151287782 17:73125775-73125797 CTCCATTTCATCTACAAAATGGG + Intergenic
1154403206 18:14062579-14062601 CTCATTCATATTTACATAATAGG + Intronic
1155128983 18:22911290-22911312 ATCAGTTTTATTTATAAAATGGG - Intronic
1155869707 18:31011024-31011046 CTCTGTGTTATCTGTAAAATGGG - Intronic
1156104283 18:33638729-33638751 CTCAGTCATGTCTATAAAACTGG + Intronic
1156907702 18:42374040-42374062 CTAATTCTAATTTACAAAATGGG + Intergenic
1157281054 18:46346603-46346625 CTCAGTCTCTTCTAAAAAAATGG + Intronic
1158955120 18:62530319-62530341 CTGAGTCTTACCTGTAAAATGGG + Intronic
1160292144 18:77604788-77604810 CTCAGTATTATCTATTATATAGG + Intergenic
1161243575 19:3236358-3236380 CACAGTCTCATCCACCAAATGGG - Intronic
1162539126 19:11283185-11283207 TTTAGTCTTATCTGTAAAATTGG - Intergenic
1167041765 19:47027048-47027070 CTCAGCCTCATCTGTAAAATGGG - Intronic
1167462282 19:49631973-49631995 CTCAGTCTCATCTGTAAAATGGG - Intergenic
1168689912 19:58369918-58369940 GGCAGCCTCATCTACAAAATGGG + Exonic
926349107 2:11979490-11979512 CATGTTCTTATCTACAAAATGGG - Intergenic
927070506 2:19523999-19524021 CTTAGTCTTAGCTACAATCTTGG + Intergenic
927207733 2:20620667-20620689 CTCAGTCTCTTCTATAAAGTGGG + Intronic
929871475 2:45762788-45762810 CACTTTCTTATCTATAAAATGGG - Intronic
929930845 2:46254385-46254407 CTCAGTGTTACCAACAAAAGTGG + Intergenic
930356060 2:50321940-50321962 CTAATTCTCATCTACAAAATGGG - Intronic
930876272 2:56221032-56221054 CACAGACTTTTTTACAAAATTGG - Intronic
931840009 2:66138355-66138377 CTCAATTTTATCTGTAAAATGGG + Intergenic
932389586 2:71374224-71374246 ATCAGTATTATTTCCAAAATGGG + Intronic
932875439 2:75446469-75446491 CTCAGCCGTATCTGTAAAATGGG + Intergenic
933581808 2:84135606-84135628 CTCACCCATATCTACTAAATTGG - Intergenic
937294522 2:120801791-120801813 CTCAGTCTCATCTACAATACGGG - Intronic
938098502 2:128479249-128479271 CTCGTTCTCATCTGCAAAATGGG + Intergenic
938688238 2:133762081-133762103 CCCAGTCTTTTTTACAGAATTGG + Intergenic
940888363 2:159011106-159011128 CTCACTCTCATCTGTAAAATGGG - Intronic
941078364 2:161032046-161032068 CTTATCTTTATCTACAAAATGGG - Intergenic
941449339 2:165640860-165640882 CTCAGTTTCATTTACAAAATTGG + Intronic
942899769 2:181100667-181100689 CACAGTCTTTTCTAGAAAAGAGG + Intergenic
944883053 2:204034646-204034668 CTAAGTCCTATCTAAATAATGGG - Intergenic
945703844 2:213204434-213204456 CTGCCTCTTATCTTCAAAATGGG + Intergenic
946870575 2:224080700-224080722 CTCAGTCTTGCCTGTAAAATGGG + Intergenic
1172128245 20:32638316-32638338 CCCAGCCTCATCTGCAAAATGGG - Intergenic
1172275726 20:33678007-33678029 CTCAGTTTTATCTATAAAAGGGG - Intronic
1173163932 20:40672756-40672778 CTCAGTCTCTTCCATAAAATGGG - Intergenic
1173533903 20:43794186-43794208 CTCATTCTTGTCTGCAATATGGG - Intergenic
1173665636 20:44761260-44761282 CTCCGGCTCATCTATAAAATGGG - Intronic
1174577585 20:51547542-51547564 CTCATTTTTATCTACAACCTGGG + Intronic
1176520996 21:7824159-7824181 CTCAATCTTGGCTACAAATTAGG - Intronic
1176950045 21:15033731-15033753 CTCAGCCTCATCTGTAAAATTGG - Intronic
1177950794 21:27534161-27534183 CTCATTTTTCTCTGCAAAATGGG + Intergenic
1178655017 21:34454171-34454193 CTCAATCTTGGCTACAAATTAGG - Intergenic
1179130513 21:38632193-38632215 TACATTCTTATCTATAAAATGGG + Intronic
1180690071 22:17706474-17706496 CTCAGTTTCAACTACAAAAAGGG + Intronic
1180764967 22:18340954-18340976 CTCAGTCACATCCACAAACTTGG - Intergenic
1180814064 22:18778730-18778752 CTCAGTCACATCCACAAACTTGG + Intergenic
1181156168 22:20922527-20922549 ATCAATTTTATCTCCAAAATAGG - Intronic
1181200247 22:21213065-21213087 CTCAGTCACATCCACAAACTTGG + Exonic
1181701490 22:24623894-24623916 CTCAGTCACATCCACAAACTTGG - Exonic
1182551325 22:31102360-31102382 TTCAATCCTCTCTACAAAATGGG - Intronic
1182557301 22:31136158-31136180 CTCAGCCTCATCTATGAAATGGG + Intronic
1203226588 22_KI270731v1_random:81859-81881 CTCAGTCACATCCACAAACTTGG - Intergenic
1203264161 22_KI270734v1_random:4417-4439 CTCAGTCACATCCACAAACTTGG + Intergenic
949596499 3:5553511-5553533 ATCAGTCTTGTCACCAAAATGGG + Intergenic
949656754 3:6229604-6229626 CTCAGTCTCATCCATAAAATAGG - Intergenic
949830266 3:8207160-8207182 TTCACTTTTATCTTCAAAATTGG - Intergenic
950289217 3:11770199-11770221 CTCCGTCTCTTCTGCAAAATTGG + Intergenic
950652976 3:14419149-14419171 CTCAGCCTTTTCTATAAAATGGG - Intronic
951764840 3:26186182-26186204 CTTGGTGTTATTTACAAAATAGG - Intergenic
953342225 3:42144417-42144439 ATCAGTCTCATCTGCTAAATGGG - Intronic
954123503 3:48514862-48514884 CTGATTTTTATCTAGAAAATTGG - Intergenic
954526769 3:51278897-51278919 CTCATTTTTATCTGAAAAATGGG - Intronic
955035064 3:55259689-55259711 TTCAGTCTTGTCTGTAAAATGGG - Intergenic
955467545 3:59252681-59252703 TTCAGTCTTATCTACAATTTGGG + Intergenic
955708157 3:61750417-61750439 GTCATTCTTAACTACATAATGGG - Intronic
956050905 3:65247440-65247462 CTCAGTGCTATATACATAATAGG - Intergenic
956700017 3:71950691-71950713 CTCAGTTTTATTTACAAAATGGG + Intergenic
957244378 3:77699276-77699298 CTCAGTGTTATCCACAGAATGGG - Intergenic
958642645 3:96827685-96827707 CTCAGCCTTATTTATAAAATGGG + Intronic
958699234 3:97567393-97567415 ATCAATGTTATCTATAAAATGGG + Intronic
958872700 3:99579920-99579942 CTCAGGCTCATCTGTAAAATGGG - Intergenic
958884505 3:99710720-99710742 CCCTGTCTCATCTATAAAATAGG - Intronic
959137647 3:102444477-102444499 CTCAATCTTATATAAAAACTTGG + Intronic
959590010 3:108068659-108068681 CTGTTTCTTATCTACAAAACGGG + Intronic
960923786 3:122776398-122776420 CTGTGTCTTATCTATAAAATGGG + Intronic
961731304 3:128967047-128967069 CTCAATTTCATCTTCAAAATGGG + Exonic
962080114 3:132129493-132129515 CTCAGACTTAATTACAACATTGG + Intronic
962593957 3:136920835-136920857 CTAAGTCTTATATACTATATGGG + Intronic
963064966 3:141256273-141256295 CTCAGTCTTATTTAAAAAGCAGG + Intronic
963178930 3:142333150-142333172 CTGAGTTTTATGTACAAAAATGG + Intronic
964673956 3:159256957-159256979 CTCTTTCTTATCCATAAAATAGG - Intronic
965534165 3:169807974-169807996 TTCAGTGTTATCTATAAAGTGGG - Intronic
966057410 3:175712473-175712495 ATCAGTTGTATGTACAAAATGGG - Intronic
967454356 3:189665754-189665776 CTGACTTTTATCTATAAAATGGG - Intronic
969182286 4:5451563-5451585 CTGTTTCTTATCTATAAAATGGG + Intronic
969223154 4:5774494-5774516 CTCAGTCTTATCTGTCAAAGGGG - Intronic
970017812 4:11532301-11532323 CTCAGTGTTCTCAACAATATGGG - Intergenic
970242459 4:14023577-14023599 CTCATCCTCATCTACAAAATGGG - Intergenic
970431672 4:15994652-15994674 CTCAATCATATCTCTAAAATAGG + Intronic
970482927 4:16495943-16495965 TTCTGTCTTATTTGCAAAATGGG + Intergenic
971269917 4:25132971-25132993 CTCAATTTTATCTGCAAAATGGG + Intronic
971525308 4:27609842-27609864 ATCAGTCTTATTTATAAAATAGG + Intergenic
971830254 4:31683433-31683455 CTCAGACTTATTTGTAAAATTGG + Intergenic
972855488 4:43100996-43101018 CTTAGTTTTACCTATAAAATGGG - Intergenic
972902958 4:43707955-43707977 CTCAAACTTATCCACAAAATTGG + Intergenic
973147317 4:46843392-46843414 CTCAGTCTTTTCTGTAAAAGAGG - Intronic
973189375 4:47369458-47369480 CACACTCATTTCTACAAAATAGG + Intronic
973668843 4:53192659-53192681 TCCTCTCTTATCTACAAAATGGG + Intronic
974457599 4:62147553-62147575 CCCAGTCTTATCTTCCCAATTGG + Intergenic
974703437 4:65481636-65481658 CTCAGTATTAACTAGATAATTGG - Intronic
975115802 4:70679557-70679579 CTCTGTTTCATCTATAAAATGGG + Intronic
975193055 4:71489173-71489195 CTCTGTTTCATCTATAAAATAGG - Intronic
976211839 4:82679597-82679619 CTCAGCTTCATCTATAAAATGGG - Intronic
977957437 4:103046281-103046303 CTTAATCTTATGTTCAAAATTGG - Intronic
978225365 4:106327689-106327711 CTCAGATTTATCAATAAAATGGG + Intronic
978397336 4:108295261-108295283 CTCATTCTAAATTACAAAATGGG - Intergenic
978898969 4:113926053-113926075 CTGAGTCGTGTCTACAGAATGGG + Intronic
982747482 4:159119686-159119708 CTCAGTCTCATTTACAAATAGGG + Intronic
983724399 4:170902465-170902487 CTCATTCTTTTTTTCAAAATGGG - Intergenic
983809136 4:172036616-172036638 ATCTGTCTCATCTACAAAAGTGG - Intronic
983986692 4:174068053-174068075 CTAAGTCTTCTCTGAAAAATTGG + Intergenic
984681975 4:182621360-182621382 CCCAGTCTGATATACACAATCGG + Intronic
987122050 5:14776936-14776958 ATCAGTCTTCTCTACACAATGGG + Intronic
987374740 5:17223271-17223293 CTCAATTTTATTTAGAAAATGGG + Intronic
987464391 5:18254365-18254387 CTCTGTCTTTGCTATAAAATGGG + Intergenic
988512454 5:31876981-31877003 CTCAGGTTTATCTATAAAATGGG + Intronic
988787067 5:34574887-34574909 TTCTCCCTTATCTACAAAATAGG + Intergenic
988947460 5:36220434-36220456 CTCAGCCTTTTCTTCAAGATTGG - Intronic
989704430 5:44311537-44311559 CTCAATTTTATTTGCAAAATGGG + Intronic
990852323 5:60220557-60220579 CTCAGTCTTGGCTGCACAATAGG - Intronic
991237888 5:64419845-64419867 CTCAGTCATATCTACATTAGGGG - Intergenic
992472728 5:77074512-77074534 ACCTGTCTCATCTACAAAATGGG + Exonic
993702549 5:91135554-91135576 CTCACTCTTAACTAAGAAATGGG - Intronic
994560280 5:101361143-101361165 CTAAGTCTTATCTCTAAAAATGG - Intergenic
995051320 5:107708030-107708052 CTCAGTCATTTTTACAAATTAGG - Intergenic
999325230 5:150639621-150639643 ATCTTCCTTATCTACAAAATGGG + Intronic
999416368 5:151399960-151399982 CTCACTCTCATCTGTAAAATGGG - Intergenic
999617120 5:153436372-153436394 CTAAGCCTCATCTATAAAATAGG - Intergenic
1000504290 5:162094856-162094878 ATCAGTCTTCTCTGAAAAATAGG + Intronic
1000551061 5:162664961-162664983 CTCAGTATAATTTAAAAAATTGG - Intergenic
1000585300 5:163089999-163090021 TTAAGTTTTATCTCCAAAATGGG - Intergenic
1001409152 5:171497995-171498017 CTCAGTTTTATCCATAAAGTGGG - Intergenic
1003808475 6:9753386-9753408 CTCATTGTTATTTAGAAAATGGG + Intronic
1003812366 6:9799024-9799046 CGTAGTTTTATCTTCAAAATTGG - Intronic
1005288462 6:24354595-24354617 CTCCGTCTTAGCAATAAAATGGG + Intronic
1005594345 6:27364452-27364474 CTCTGTCTCATCTACAAAATGGG + Intergenic
1006853907 6:37119381-37119403 CTCAGTTTTATCTAGTAAATGGG + Intergenic
1006963643 6:37960116-37960138 ATCTGTCTTAGCTATAAAATGGG + Intronic
1008205960 6:48657088-48657110 CTCACTCTCATTTGCAAAATGGG + Intergenic
1008268539 6:49462541-49462563 CTCAGTTTTATCTAGAAAGAAGG - Intronic
1008438931 6:51510271-51510293 CTCATTCTCTTCTGCAAAATGGG - Intergenic
1008621098 6:53272269-53272291 CTCAGTGTCATCTATAAAATAGG + Intronic
1009383934 6:63066805-63066827 CTCACTCTTATCTGTAAAATAGG - Intergenic
1009619734 6:66059388-66059410 CCTAGACTTATCTAAAAAATTGG + Intergenic
1010227809 6:73507518-73507540 CTAAGTTATATCTATAAAATTGG - Intronic
1011803305 6:91043082-91043104 CTCAGTCTTCTCTAAAAAGGGGG - Intergenic
1011837110 6:91446116-91446138 CTCAGTCTTATCTGTATAAACGG - Intergenic
1014701020 6:124688096-124688118 CTCAGTGTTATCATCAAATTTGG - Intronic
1015240844 6:131021788-131021810 CTTAGTTTCATCTATAAAATGGG - Intronic
1015508932 6:134018339-134018361 TTCAGTTTTATCTAGAAAACAGG - Intronic
1016277266 6:142369423-142369445 CTTTGTCTTATCTGTAAAATGGG - Intronic
1018476204 6:164144706-164144728 TTCAGTTTCATCCACAAAATAGG - Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1019490275 7:1309958-1309980 GTCAGTCTCATCTGTAAAATAGG - Intergenic
1020605234 7:10328576-10328598 CTCAGTTTCATCTTTAAAATGGG + Intergenic
1022482143 7:30751374-30751396 CTCAGTCTTCTCTTTGAAATGGG - Intronic
1023325790 7:39054360-39054382 ATTCGTCTTATCTATAAAATAGG - Intronic
1023405409 7:39828772-39828794 CTCAGTGTTCTCTTCAAACTAGG - Intergenic
1023540694 7:41262214-41262236 TTCAGACCTATCTACCAAATTGG - Intergenic
1024387756 7:48773020-48773042 TTCAGTCTTCTCTGCAAAGTGGG - Intergenic
1026015541 7:66668404-66668426 CTCAGTCTCATGTCTAAAATAGG - Intronic
1026695281 7:72585943-72585965 CTCATTCTTAACTGCAATATGGG - Intronic
1026891956 7:73987568-73987590 CTCAGTCTCATCTCTAAGATGGG - Intergenic
1027172161 7:75880056-75880078 CTCAATCTTATCTAGATAACGGG - Intronic
1027222329 7:76221974-76221996 CTCTTTCTTATCTGTAAAATGGG - Intronic
1028052272 7:86202845-86202867 CTCACTCTTATCTACAAAACTGG + Intergenic
1028060929 7:86314182-86314204 CTCAGTTTCTTCTATAAAATCGG + Intergenic
1028454668 7:91025942-91025964 CTCTTTCTTATCAATAAAATAGG - Intronic
1028465244 7:91143850-91143872 CTCAGTCTCCTCTGCAAAACGGG - Intronic
1029682625 7:102122404-102122426 CTGTGTCTTATCTCCAAAAGGGG + Intronic
1031248915 7:119354001-119354023 CACAGTGTTATCTCTAAAATCGG - Intergenic
1032976494 7:137230097-137230119 CTCAGACTTATGTATGAAATAGG - Intronic
1034108803 7:148516042-148516064 CTCAACATTTTCTACAAAATGGG + Intergenic
1036425650 8:8643073-8643095 CTAGGTCTTATCTCAAAAATGGG - Intergenic
1036564729 8:9928803-9928825 CTTGGCCTTACCTACAAAATGGG + Intergenic
1036934392 8:12987211-12987233 CTCCTTCTTATCTGTAAAATGGG + Intronic
1036980200 8:13461705-13461727 CTCTGTCTTTTCTACAGGATAGG + Intronic
1038573277 8:28681751-28681773 CCCATTCTTATCAACAATATAGG + Intronic
1038584896 8:28779559-28779581 CTCATTCTTATCTAGAACACAGG - Intronic
1038912329 8:31979789-31979811 CTCAGACTCATCTAAAATATAGG + Intronic
1040095934 8:43442524-43442546 CTTAGTCTCATCTTTAAAATGGG + Intergenic
1040860642 8:51995371-51995393 TTCAGTTTTATCTGTAAAATGGG + Intergenic
1040869987 8:52090587-52090609 TTCATTTATATCTACAAAATTGG - Intergenic
1041058769 8:54015837-54015859 CTGACTCTTTTCTAAAAAATGGG + Intronic
1041156956 8:54997564-54997586 CACAGTTTTATCTAATAAATTGG - Intergenic
1041967586 8:63697915-63697937 CTCAGTCATAACTACATATTAGG + Intergenic
1042157905 8:65864911-65864933 CCCAGTCTTATGAACAAACTTGG + Intergenic
1044298906 8:90561018-90561040 TTCAGTCTTATCTACTGAGTGGG - Intergenic
1044891687 8:96842823-96842845 CTCAGTTTCATCTGTAAAATGGG + Intronic
1044942315 8:97355723-97355745 CTCATTGTTATCTATGAAATGGG - Intergenic
1045500404 8:102740233-102740255 CAAGGTCTCATCTACAAAATAGG + Intergenic
1045704588 8:104906934-104906956 CTCAGTCTTTCCTACTACATAGG + Intronic
1045835150 8:106511733-106511755 CTAAGTCTTATCTACAATAATGG - Intronic
1046276195 8:111963884-111963906 AGCAGTATTAACTACAAAATAGG - Intergenic
1047051113 8:121114472-121114494 CTCATTATTTTCTCCAAAATTGG - Intergenic
1047120078 8:121892974-121892996 ATCATTCTTATTTATAAAATAGG + Intergenic
1047331240 8:123888858-123888880 CTATGTCTTGTCTACCAAATTGG + Intronic
1047733206 8:127743515-127743537 TTGATTATTATCTACAAAATAGG - Intergenic
1050172235 9:2833422-2833444 CACAGTCTTTTCTACAAATGAGG + Exonic
1050682961 9:8135386-8135408 AGTAGTCTTATCTATAAAATGGG + Intergenic
1050758265 9:9034739-9034761 CCCAGACTCATCTATAAAATGGG + Intronic
1052019736 9:23511946-23511968 CCCAGTCTTTTCAACAAGATTGG + Intergenic
1053530023 9:38871277-38871299 CTGAGTATTATCTACAAGTTAGG + Intergenic
1054202248 9:62095704-62095726 CTGAGTATTATCTACAAGTTAGG + Intergenic
1054636110 9:67492656-67492678 CTGAGTATTATCTACAAGTTAGG - Intergenic
1054726062 9:68651289-68651311 AGGATTCTTATCTACAAAATGGG + Intergenic
1055285472 9:74724126-74724148 CTCTGTCTTTTCCACAACATAGG - Exonic
1055557230 9:77487455-77487477 CTCTTCCTTATCTATAAAATAGG + Intronic
1056116327 9:83444781-83444803 CTCAGTCTTAACTCCAACTTGGG - Intronic
1056367254 9:85917947-85917969 CTCAGGCTACTCTCCAAAATGGG + Intergenic
1057020600 9:91694319-91694341 CTCAGACTCATGAACAAAATAGG - Intronic
1057148582 9:92775999-92776021 CTCAGTTTTATATACACATTTGG + Intergenic
1057785551 9:98084924-98084946 CTCAGTGCCATCTATAAAATGGG - Exonic
1058355875 9:104083034-104083056 CTCAGTATTAACCACCAAATGGG + Intergenic
1058881710 9:109291096-109291118 CTCAGTCTCATCTGCGAAATGGG - Intronic
1059098782 9:111449073-111449095 CTCAGTTTCATCTGTAAAATGGG + Intronic
1059306717 9:113359424-113359446 CTCAGTGTTTTCTGTAAAATAGG + Intronic
1059404623 9:114092238-114092260 CTCAGTCTTATCTCTGAAATGGG - Intronic
1059849956 9:118327020-118327042 TTGAGTTTTATCTAGAAAATAGG + Intergenic
1187392986 X:18897725-18897747 CTCAGTCTCATCTGCACAGTGGG + Intronic
1187966973 X:24621273-24621295 CTCAGTTTCATCTATAAAATGGG + Intronic
1189246947 X:39570587-39570609 CTCAGAGTTATCTCCAAAGTGGG - Intergenic
1189533983 X:41917259-41917281 CTCAGTGTTCTCTGTAAAATGGG + Intronic
1189819265 X:44854736-44854758 GTCAGTCTTTTTTAAAAAATTGG + Intergenic
1191011315 X:55762364-55762386 CTCAGACTTAACTACATCATTGG - Intergenic
1192471272 X:71400868-71400890 CTCAGTTTCATCTGTAAAATGGG - Intronic
1192784548 X:74323588-74323610 CTCAGTCTCATCTCAAAATTTGG + Intergenic
1192804087 X:74494738-74494760 CTCAGTCTCATCTCAAAATTTGG - Intronic
1193257630 X:79367968-79367990 TCATGTCTTATCTACAAAATGGG - Intergenic
1193375974 X:80762124-80762146 CTCAATCTTAACTATAAAGTTGG - Intronic
1193416012 X:81224965-81224987 CTCAGTCTTTTCTAAAAAAAAGG + Intronic
1194702872 X:97135723-97135745 CTCTATCTTATCTATAAAAGTGG + Intronic
1195306952 X:103593229-103593251 CTCAGTCTTATGTTTAAAGTGGG + Intergenic
1195762799 X:108264988-108265010 AGCTTTCTTATCTACAAAATAGG + Intronic
1196350119 X:114719677-114719699 CTCATTCTTCTCAATAAAATTGG + Intronic
1197339124 X:125244243-125244265 CTCAGTCTGATCTACAGAAGTGG + Intergenic
1198050803 X:132951541-132951563 CAGTGTCTTATCTATAAAATTGG - Intronic
1198320795 X:135517146-135517168 CTCAGTATAAACTACAAAAATGG - Intergenic
1198667556 X:139041324-139041346 CTCATTCTATTCTACATAATAGG - Intronic
1198686622 X:139234416-139234438 CTCAGCCTCACCTGCAAAATAGG - Intergenic
1199313623 X:146350461-146350483 CTAAGGCTTGTCTACAAAAGTGG + Intergenic
1200128009 X:153826317-153826339 CTCAGGATTATCTACATATTAGG - Intronic