ID: 1131133189

View in Genome Browser
Species Human (GRCh38)
Location 15:89912942-89912964
Sequence GATCCGGGAATGGCGCGGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131133181_1131133189 -4 Left 1131133181 15:89912923-89912945 CCGCGATTCCCAGCCGGCGGATC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1131133189 15:89912942-89912964 GATCCGGGAATGGCGCGGCCCGG 0: 1
1: 0
2: 1
3: 3
4: 63
1131133180_1131133189 -3 Left 1131133180 15:89912922-89912944 CCCGCGATTCCCAGCCGGCGGAT 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1131133189 15:89912942-89912964 GATCCGGGAATGGCGCGGCCCGG 0: 1
1: 0
2: 1
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131133189 Original CRISPR GATCCGGGAATGGCGCGGCC CGG Exonic
900381171 1:2384850-2384872 GATCAGGGAATCGCAGGGCCTGG + Intronic
901641470 1:10695048-10695070 GAGCAGGGAAGCGCGCGGCCTGG - Intronic
902501475 1:16914253-16914275 GTTCCGCGACTGCCGCGGCCCGG + Intronic
904837593 1:33349457-33349479 GAGCCGCGACTGGCACGGCCTGG + Intronic
905498465 1:38416354-38416376 GATCCGGGACTGGCAGGGCTTGG + Intergenic
914753217 1:150549525-150549547 GACCCGGGAGAGGGGCGGCCGGG - Intronic
919639619 1:200035768-200035790 GAACCGGGAAGGGCGAGCCCTGG + Intronic
922234362 1:223712343-223712365 GCTCCCGGGATGGCGCGGCCCGG - Exonic
922503118 1:226110857-226110879 TAGCCGGGGATGGCGGGGCCTGG + Intergenic
922674384 1:227541952-227541974 GAGCCGGGTTGGGCGCGGCCTGG + Intergenic
1064003849 10:11684782-11684804 GACCCGGGAGTGGCCCTGCCTGG + Intergenic
1075732919 10:124646952-124646974 TACCCAGGAATGGCCCGGCCAGG - Intronic
1078064168 11:8067038-8067060 GAGCCGGGAGTGGAGCTGCCTGG - Intronic
1083315940 11:61815222-61815244 GGGCCGGGAATGCCGCGGCGGGG - Intronic
1085579409 11:77637495-77637517 GAGCCGGGCAAGGGGCGGCCTGG - Intronic
1089543592 11:119206049-119206071 GCTCCCGGAAAGCCGCGGCCAGG - Exonic
1091121988 11:133064635-133064657 GATCCGGGAATGGGACTTCCGGG + Intronic
1091594220 12:1864964-1864986 GACCCGGGAGCGGCGCGGCGAGG - Intronic
1092219049 12:6700552-6700574 GAGCCGGGAAGGGCAGGGCCGGG + Intronic
1100615764 12:96230713-96230735 AATCCGGGATTGGCGCCCCCAGG - Intronic
1101442341 12:104713150-104713172 GCTCCTGGAATGGTGTGGCCAGG - Intronic
1101618774 12:106363215-106363237 AATTCGGGAATGGAGTGGCCTGG - Intronic
1103947932 12:124537379-124537401 GATCGGGGACTGGTGAGGCCAGG + Intronic
1128089786 15:64911770-64911792 GGTCCGGGACTGGGGTGGCCGGG + Intronic
1131133189 15:89912942-89912964 GATCCGGGAATGGCGCGGCCCGG + Exonic
1135281670 16:21158538-21158560 GATCCGGCAAAGGCGCGCCAAGG - Exonic
1142209740 16:88803422-88803444 GAGCCGAGGACGGCGCGGCCTGG - Exonic
1142782465 17:2191844-2191866 AATCAGGAAATGGAGCGGCCGGG + Intronic
1143586541 17:7853452-7853474 GCTCAGGGAAAGGCGCGGCCGGG - Exonic
1144515978 17:15917772-15917794 GCTCCGGGCCTGGCGCGGGCAGG + Intergenic
1146895213 17:36535603-36535625 TATACGGGTAGGGCGCGGCCAGG + Intronic
1147006434 17:37407212-37407234 GAGCGGGAAATGGCGAGGCCGGG - Intronic
1147134738 17:38428411-38428433 GACCCGGGAGGGGCGGGGCCGGG - Exonic
1147744497 17:42687015-42687037 GATCCGGGAATGGCGCCGCACGG - Exonic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1148807854 17:50273272-50273294 GAGCCGGGAGGGGCGCGGCCGGG - Intronic
1153984938 18:10343489-10343511 GAGGCGGGAATGGGGTGGCCTGG + Intergenic
1155297696 18:24400373-24400395 GGCCCGGGAATGGCAGGGCCAGG - Intergenic
1161045609 19:2132807-2132829 GAGCCGGGATGGGCGCGGCTGGG + Intronic
1167376384 19:49114498-49114520 GACCCGGGAAGGGCGGGGACCGG - Intronic
931429646 2:62197750-62197772 GCCCCGGGACTGGCTCGGCCAGG - Intronic
934461897 2:94217213-94217235 GATCAGGGAAGGGCAAGGCCAGG - Intergenic
934763731 2:96869395-96869417 CAGCCGGGGACGGCGCGGCCCGG + Intronic
947506619 2:230712889-230712911 GTTCGGGGAGCGGCGCGGCCTGG + Exonic
948801623 2:240435870-240435892 GATCCGAGAGAGGCGCGGGCGGG + Exonic
1174174489 20:48636343-48636365 GCTGCGGGAATGACGAGGCCAGG + Intronic
1176002674 20:62840036-62840058 GGTGCGGGCATGGTGCGGCCGGG - Intronic
1184229601 22:43151567-43151589 GCTCCGGGAAGGGCACTGCCTGG - Intronic
1185010051 22:48307741-48307763 GATTCGGGAATGGGTGGGCCAGG + Intergenic
1185340269 22:50287873-50287895 GATCCCGGAAGGTCGTGGCCTGG - Intronic
949559268 3:5187588-5187610 GGCCCGGGATTGGCCCGGCCTGG - Intergenic
962314959 3:134353637-134353659 GATCCAGGCATGGCACGTCCAGG + Intergenic
963119499 3:141764189-141764211 GATCAGGGGATGGAGAGGCCAGG - Intergenic
963880262 3:150520596-150520618 GAGCTGGGGGTGGCGCGGCCGGG - Intergenic
969243766 4:5919191-5919213 GCTCCGGAAATGGCACAGCCAGG - Intronic
992269662 5:75052599-75052621 TCTCTGGGAAGGGCGCGGCCTGG + Intergenic
1001035458 5:168293018-168293040 GATCGGGGAAGGGGGCGGCGAGG + Intronic
1006519374 6:34562607-34562629 GACCCGGGAAATGAGCGGCCAGG - Intergenic
1011607400 6:89118166-89118188 GATCCGGGTATGGGGGGTCCTGG + Intergenic
1012916793 6:105179658-105179680 GAGCCGGGAAGGGAGCGGCGCGG + Intronic
1015592153 6:134832594-134832616 GATCCTGGAATGAGGCTGCCTGG - Intergenic
1018046337 6:159969366-159969388 GCTCGGGGAACGGGGCGGCCTGG - Exonic
1033457011 7:141511848-141511870 GCTCCAGGAAAGGAGCGGCCAGG + Intergenic
1039484435 8:37899683-37899705 GAGGCGGGGCTGGCGCGGCCAGG + Intergenic
1061264851 9:129499008-129499030 GACCAGGGAATGGCCCAGCCAGG + Intergenic
1061489415 9:130937035-130937057 GATCTGGAAATGGAGCGGCGTGG + Intronic
1062391616 9:136336157-136336179 GATCCGGGATAGGGGCGGGCGGG + Intronic
1186309155 X:8298754-8298776 GATCCGGGCCTGGCGGGGTCAGG - Intergenic