ID: 1131134440

View in Genome Browser
Species Human (GRCh38)
Location 15:89922822-89922844
Sequence CTCAGCCTCCCCAGTAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131134438_1131134440 -10 Left 1131134438 15:89922809-89922831 CCTGGGCTCAACTCTCAGCCTCC No data
Right 1131134440 15:89922822-89922844 CTCAGCCTCCCCAGTAATGGTGG No data
1131134437_1131134440 -1 Left 1131134437 15:89922800-89922822 CCTTGAATTCCTGGGCTCAACTC No data
Right 1131134440 15:89922822-89922844 CTCAGCCTCCCCAGTAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131134440 Original CRISPR CTCAGCCTCCCCAGTAATGG TGG Intergenic
No off target data available for this crispr