ID: 1131141557

View in Genome Browser
Species Human (GRCh38)
Location 15:89980637-89980659
Sequence TTTGCTGGAAAAGGGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131141557_1131141562 -4 Left 1131141557 15:89980637-89980659 CCATCCTTCCCTTTTCCAGCAAA No data
Right 1131141562 15:89980656-89980678 CAAATGAAACAGCTTTTCCCAGG No data
1131141557_1131141563 12 Left 1131141557 15:89980637-89980659 CCATCCTTCCCTTTTCCAGCAAA No data
Right 1131141563 15:89980672-89980694 TCCCAGGAGCTCCATCTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131141557 Original CRISPR TTTGCTGGAAAAGGGAAGGA TGG (reversed) Intergenic
No off target data available for this crispr