ID: 1131141562

View in Genome Browser
Species Human (GRCh38)
Location 15:89980656-89980678
Sequence CAAATGAAACAGCTTTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131141558_1131141562 -8 Left 1131141558 15:89980641-89980663 CCTTCCCTTTTCCAGCAAATGAA No data
Right 1131141562 15:89980656-89980678 CAAATGAAACAGCTTTTCCCAGG No data
1131141557_1131141562 -4 Left 1131141557 15:89980637-89980659 CCATCCTTCCCTTTTCCAGCAAA No data
Right 1131141562 15:89980656-89980678 CAAATGAAACAGCTTTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131141562 Original CRISPR CAAATGAAACAGCTTTTCCC AGG Intergenic
No off target data available for this crispr