ID: 1131146449

View in Genome Browser
Species Human (GRCh38)
Location 15:90016778-90016800
Sequence CCCTTTGCAGAGATGGGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131146449_1131146453 18 Left 1131146449 15:90016778-90016800 CCTAGACCCATCTCTGCAAAGGG 0: 1
1: 0
2: 2
3: 23
4: 232
Right 1131146453 15:90016819-90016841 TCCACTCCTGCCTCTGCAGCTGG 0: 1
1: 1
2: 5
3: 51
4: 610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131146449 Original CRISPR CCCTTTGCAGAGATGGGTCT AGG (reversed) Intronic
900763533 1:4488530-4488552 CCCTTTGGAGAGAAGGGTTTGGG + Intergenic
900951836 1:5862479-5862501 TCGTTTGCAGAGATCAGTCTCGG - Intergenic
902648697 1:17822662-17822684 CCCTTTGCAGAGTTGGATTGTGG + Intronic
902800572 1:18827042-18827064 CGCTTTCCAGAAATGGCTCTTGG - Intergenic
903821144 1:26103458-26103480 CCCCCTGCAGAAATGGGGCTGGG + Intergenic
905290685 1:36920021-36920043 CCCTTGGCAGAGCTGAGCCTGGG - Intronic
905293930 1:36942366-36942388 CCCTTCACAGAGATGGGTCTGGG + Intronic
906385452 1:45364972-45364994 CTCTTTGCAGAAAAGGGTTTGGG + Intronic
906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG + Intergenic
909018478 1:70405160-70405182 TTCTTTGCAGAGATGGGTGGAGG - Intergenic
910122948 1:83810452-83810474 CCCTTTCCACAGAGAGGTCTAGG - Intergenic
912775937 1:112506588-112506610 CCCTGTGTAGGGATGGGGCTGGG + Intronic
916475222 1:165162530-165162552 ACCTCTGCAGAGAAGGCTCTGGG + Intergenic
917237469 1:172909781-172909803 CCCTTTGCACAGATGTATGTGGG - Intergenic
917256515 1:173121994-173122016 CCCATTTCAGAGATGGGGCGTGG + Intergenic
918755713 1:188337784-188337806 TCCTTTTGAGAGATGGCTCTTGG - Intergenic
919990827 1:202708005-202708027 CCCTTTCTGGAGCTGGGTCTGGG - Intronic
920131488 1:203735496-203735518 CCCTTTGCAGAGGTCGGGGTGGG - Intronic
920192578 1:204202975-204202997 CCCATTGCAGAGATTGGTGTGGG - Exonic
921885515 1:220301037-220301059 CCCCTTCCAGACATGGGGCTAGG - Intergenic
922425429 1:225488104-225488126 CCCTTTGTAGGGATGGGGTTGGG - Exonic
924824875 1:247528893-247528915 TCCACTGCAGAGATGGATCTTGG + Intronic
1063117328 10:3080644-3080666 CCCGTTGGAGAGCTGGGTATGGG - Intronic
1063369370 10:5511306-5511328 CCCTTTGCAGAGAGAAGGCTTGG - Intergenic
1063607613 10:7536605-7536627 CCTTTAGCAGAAATGGGCCTAGG - Intergenic
1063716823 10:8535788-8535810 CCCTTTGCAGCAATGGAGCTAGG - Intergenic
1067041445 10:42955305-42955327 CCCTATGCAGGGATGGGACCAGG - Intergenic
1067414143 10:46091224-46091246 CCCTGTGCAGAGGTGGGACCAGG - Intergenic
1067439504 10:46300591-46300613 CCCTGTGCAGAGGTGGGACCAGG + Intronic
1067576226 10:47410140-47410162 CCCTGTGCAGAGGTGGGACCAGG + Intergenic
1067849485 10:49745649-49745671 GCCTTTGCACAGATTGCTCTTGG + Intronic
1069655717 10:70086751-70086773 CCCTTTTTCTAGATGGGTCTGGG - Intronic
1071995838 10:91148406-91148428 TCCTTTACAGAGAAGGGACTTGG + Intergenic
1072007922 10:91273184-91273206 CTCTATGCAGATAAGGGTCTGGG + Intronic
1073329111 10:102659396-102659418 CCCTCTCCAGAGAAGGGCCTTGG - Intergenic
1074151481 10:110763297-110763319 CCCTTGGAGGAGATGGGGCTTGG - Intronic
1077014026 11:392181-392203 CCCTTGGCAGAGAGGGCTGTGGG - Intergenic
1077360210 11:2137500-2137522 CCCTGTGCAGAGATGAGCCGGGG - Intronic
1077474710 11:2780809-2780831 CACATTGGAGAGAGGGGTCTGGG + Intronic
1078619441 11:12893664-12893686 CCCTCTGTAGAGATGGTGCTGGG + Intronic
1078879771 11:15436680-15436702 CCCCTACCAGAGCTGGGTCTGGG - Intergenic
1079109221 11:17594814-17594836 TCCTCTGCAGAGAGGGGACTGGG + Intronic
1082687568 11:56259592-56259614 CCCTTGGCAGATGTGGGTCCTGG - Intergenic
1082711308 11:56557164-56557186 TCCTTAGCAGACATAGGTCTAGG - Intergenic
1083363528 11:62127952-62127974 CTCTTTGTAGAGATGAGGCTAGG + Intronic
1083631681 11:64098524-64098546 CCCATTGCAGAGAGCAGTCTGGG - Intronic
1084923012 11:72487181-72487203 GCCTTTGCAGACATGGGTGGTGG - Intergenic
1085437878 11:76525238-76525260 CTCTTTCCAGAGATGGTGCTGGG + Intronic
1085823007 11:79813174-79813196 CCCTTGCCAGTGATGGGTCAGGG + Intergenic
1087231983 11:95676344-95676366 CCCTTTTGAGAGATGTGTCATGG - Intergenic
1088431123 11:109759943-109759965 CCTGTTGGAGAGTTGGGTCTAGG + Intergenic
1089014515 11:115155389-115155411 CCCTTTGCAGAGGTGGCTGCAGG + Intergenic
1089619752 11:119715303-119715325 CTCTTTCCAGACCTGGGTCTGGG + Intronic
1090454647 11:126837895-126837917 CCATTTACAGAAATAGGTCTAGG + Intronic
1090660463 11:128878511-128878533 CCCCCTGCAGATGTGGGTCTTGG - Intergenic
1091235851 11:134021630-134021652 CCATTTGCAAATTTGGGTCTTGG - Intergenic
1091842942 12:3633556-3633578 CCCTTCCCAAAGATGGGCCTAGG + Intronic
1095814000 12:46401402-46401424 CCATTTGCTGAGAAGGGGCTTGG + Intergenic
1100213330 12:92421101-92421123 ACATATGCAGAGATGGCTCTTGG + Exonic
1101953732 12:109196234-109196256 TCCTGGGCAGAGCTGGGTCTGGG + Intronic
1102207930 12:111103307-111103329 CCCTTTGCAGAGTTGTTCCTGGG + Intronic
1102461331 12:113101676-113101698 CCTTATGCAGAACTGGGTCTTGG - Intronic
1102539057 12:113605327-113605349 CTTTTTGCAGAGATGGGGCGGGG + Intergenic
1102804648 12:115769089-115769111 CTCTTTGCAGAGATGTGCCAGGG + Intergenic
1102837528 12:116079392-116079414 CCTTTTGCAGAGATGGGGGAGGG + Intronic
1105315003 13:19250201-19250223 CCCTTTGTAGACATTGGTTTAGG + Intergenic
1105732906 13:23236986-23237008 TCCTTTTCAAAGATGAGTCTAGG + Intronic
1105951681 13:25234814-25234836 CCCATTGCAGAGCTGGAACTAGG + Intergenic
1106619434 13:31359227-31359249 CCATTTGCAAGGCTGGGTCTTGG - Intergenic
1106848358 13:33761866-33761888 CACTTTGAAGAGATTGGTCACGG - Intergenic
1107834836 13:44404836-44404858 CCCTGGACAGAGATGGGTCCTGG - Intergenic
1107995085 13:45851384-45851406 CCCTTTGCAAACCCGGGTCTCGG - Intronic
1108686459 13:52823645-52823667 CCCTTTCCAGAGATGGGTTTAGG - Intergenic
1112196027 13:97227241-97227263 CTCTTTTCAGGCATGGGTCTTGG + Intronic
1113553260 13:111209862-111209884 CTCTTTGCAGACATCGGGCTGGG + Exonic
1113882908 13:113637808-113637830 CCCTTTTCAGAAATGGCTCAGGG + Exonic
1114196919 14:20486261-20486283 CTCTGTGCAGAGAGGGGTCCTGG - Intergenic
1114448841 14:22811071-22811093 CCATATGCAGAGATGAGTCCAGG + Intronic
1114666124 14:24378072-24378094 CTCTTTGGAGAGATGGGTTGGGG + Exonic
1120030612 14:79636740-79636762 CCCTTTGCAGTGATGGGCAGAGG - Intronic
1120189445 14:81427272-81427294 CACTTTGCAGAGGTGGGTCCTGG - Intronic
1121427443 14:93862603-93862625 CACCCTGCAGAGAAGGGTCTGGG + Intergenic
1121786280 14:96663468-96663490 CCCTTGGCAGAGAGGTGCCTTGG - Intergenic
1121974925 14:98394049-98394071 AGCTTTGCATGGATGGGTCTGGG + Intergenic
1122205059 14:100144289-100144311 CCCTTTTCAGAGAAGGGCCCGGG + Exonic
1122459434 14:101882931-101882953 CCCCCTGCAGAGTTGGGTCATGG + Intronic
1122681055 14:103463423-103463445 CCCTTTGCTCAGCTGGGTCCTGG - Intronic
1125487870 15:40124893-40124915 GCCTGTCCACAGATGGGTCTGGG + Intergenic
1127723815 15:61728171-61728193 CCCTCTTCAGAGATGGAGCTTGG + Intergenic
1129243668 15:74267188-74267210 CATTTTGCAGACATGGGACTGGG + Intronic
1129370377 15:75089805-75089827 TTCTTTGCAGAGATTGGTTTAGG + Intronic
1129542156 15:76359216-76359238 CCTTATGGAGAGATGGGGCTGGG - Intronic
1129948537 15:79563299-79563321 CCGCATGCAGAGATGGGTGTGGG + Intergenic
1131146449 15:90016778-90016800 CCCTTTGCAGAGATGGGTCTAGG - Intronic
1131889599 15:96958248-96958270 CCCTCTGCAGGGATGGGTGATGG - Intergenic
1132459501 16:43954-43976 GCCTTTGCAGAAATGTTTCTTGG - Intergenic
1133804015 16:9109234-9109256 CCCTTTCCAGAGATAGCACTGGG - Intronic
1134416552 16:14048384-14048406 GTCTTTGCAGAGCTGGCTCTGGG - Intergenic
1135900293 16:26452358-26452380 CATGTTGCAGAGGTGGGTCTAGG + Intergenic
1136276777 16:29183464-29183486 CCCTTTGCAGGGCTGCGGCTTGG + Intergenic
1136624176 16:31451673-31451695 CCCTTTCCCGAGCTGTGTCTCGG + Intergenic
1138458906 16:57136483-57136505 GCCTTTCCAGAGAAGGGGCTTGG - Intronic
1140196556 16:72860221-72860243 CCCCCTGCAGAGCTGGTTCTGGG + Intronic
1140533986 16:75692272-75692294 CTCTGTGCAGAGAGGGGTCCTGG - Intronic
1141829819 16:86503996-86504018 CACTTAGCACAGATGGGACTGGG - Intergenic
1142081155 16:88149524-88149546 CCCTTTGCAGCGCTGTGGCTTGG + Intergenic
1142242053 16:88952017-88952039 CCCTGTGCAGAGGTGGGTTTGGG + Intronic
1143780198 17:9225331-9225353 CCCTTTCCAGACATTGTTCTTGG - Intronic
1143917817 17:10306902-10306924 TCCTTTTCAGAGATGGGGTTTGG - Intronic
1146274014 17:31503436-31503458 CCCATAGCAGAAAAGGGTCTTGG + Intronic
1146573906 17:33975399-33975421 CAGATTGCAGAGGTGGGTCTAGG - Intronic
1146642389 17:34551058-34551080 CCCTTTTTACAGATGAGTCTGGG - Intergenic
1146845529 17:36179400-36179422 CCTGCTGCAGAGATGGGCCTGGG + Intronic
1146873745 17:36391241-36391263 CCTGCTGCAGAGATGGGCCTGGG + Intronic
1146881103 17:36442331-36442353 CCTGCTGCAGAGATGGGCCTGGG + Intergenic
1147065644 17:37921630-37921652 CCTGCTGCAGAGATGGGCCTGGG - Intergenic
1148115034 17:45170484-45170506 CCCCCTGCAGAGAGGGGTCAGGG - Intergenic
1148219176 17:45850080-45850102 CCCATTTCACAGATGGGGCTGGG + Intergenic
1148868255 17:50640454-50640476 CCCCTTGCAGGGATGGCTCACGG - Intronic
1149248083 17:54735275-54735297 CTCTGTGCAGAGAGGGGTCCTGG - Intergenic
1149999104 17:61421341-61421363 CCCATTGCACAGATGAGGCTTGG + Intergenic
1150489844 17:65566671-65566693 CCCTTTGCAGAGGAGGGACTGGG + Intronic
1151318628 17:73339072-73339094 CCCTTGGCAGTGAGGGGGCTGGG - Intronic
1153929626 18:9866754-9866776 CCTTTTGGAGAGCTGGGGCTGGG + Intergenic
1154156099 18:11945429-11945451 CCCTTAGCTCAGATAGGTCTGGG - Intergenic
1154975548 18:21454016-21454038 CCCTTTCCAGGGATGAGTCTTGG + Intronic
1156481193 18:37437404-37437426 CCCTTCTCAGAAATGGTTCTGGG + Intronic
1156901055 18:42300461-42300483 CCTTTTGCATAAATGGGGCTGGG + Intergenic
1156952056 18:42913464-42913486 CCCTTTGTAGATATGTGACTTGG - Intronic
1161842732 19:6692799-6692821 CCCTTTGCAAAGATTGGGCTGGG - Intronic
1163294354 19:16402719-16402741 TTTTTTGCAGAGATGGGTCTTGG - Intronic
1168559733 19:57372899-57372921 CCATTTGCAGAGAAGTGACTTGG + Intronic
1168697925 19:58416074-58416096 CCCTTTGCAGAGGAGTGACTTGG + Intronic
926224329 2:10956366-10956388 CCCAGTGGAGAGAGGGGTCTGGG - Intergenic
927364775 2:22281751-22281773 CCCTCTACAGAGATGATTCTAGG + Intergenic
929507838 2:42542251-42542273 CCCTTCGCAGAGATGGGCTCAGG - Intronic
932119720 2:69087557-69087579 CCATGTGAAGAGTTGGGTCTTGG - Intronic
932486146 2:72085443-72085465 CTCTGAGCAGAGGTGGGTCTGGG - Intergenic
932597925 2:73105781-73105803 CCCTGTGCAGAGCAGGGTCATGG + Intronic
935423226 2:102892731-102892753 CCATTTGCCGAGTTGAGTCTGGG + Intergenic
935814002 2:106829476-106829498 CCCTTTGCAGGGATGGCTAAAGG - Intronic
938900408 2:135794598-135794620 CCTTTTCCAGAGATGGCTCCGGG + Intronic
940712155 2:157175755-157175777 CCAGTTGCAGAGTTGGGTCCTGG + Intergenic
943725939 2:191251337-191251359 GCCATTGCAGAGCTGGGTTTTGG + Intronic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
947915515 2:233829687-233829709 CCCTTTGAAGAAATGCTTCTTGG - Exonic
948311565 2:236991124-236991146 CCCTTTGCAGAGCAGGTTCAGGG - Intergenic
948443404 2:238012973-238012995 TCCTTTACAGAAATGGGTATAGG + Intronic
948450543 2:238067887-238067909 CCCTTTGCCGGGTTGTGTCTAGG + Intronic
1168770104 20:408979-409001 CTCTGTGCTGAGATGGGGCTAGG + Intronic
1170388862 20:15850631-15850653 ACATCTGCAGAGATGTGTCTTGG + Intronic
1173325217 20:42026882-42026904 CCCTTCTCAGAGATGGCACTGGG + Intergenic
1175323664 20:58107601-58107623 CCATTTTCAGAGATGATTCTGGG - Intergenic
1176043318 20:63079657-63079679 CCCTGTGCTGAGAGGGGTCTGGG - Intergenic
1176254437 20:64143608-64143630 CCCTCTGCAGAGCTGGCTCCAGG + Intergenic
1177794632 21:25760825-25760847 TACTTTGAAGAGATTGGTCTTGG + Intronic
1180214054 21:46313716-46313738 CCATCTGCAGAGGAGGGTCTGGG + Intronic
1181462336 22:23093247-23093269 CTCTTGGCAGAGATGTTTCTAGG + Intronic
1181992416 22:26847459-26847481 CTCTTTGCAGACATGGCACTGGG + Intergenic
1182056479 22:27359339-27359361 CCATTTGAAGAGATGTGTATGGG + Intergenic
1182358784 22:29734836-29734858 CCATTTGCAGGGCTGGGGCTGGG - Intronic
1183341522 22:37284376-37284398 CCATTTGCACAGCTGGGTCAGGG - Intronic
1184130271 22:42513272-42513294 CCCTGTGCAGGGATGGGGGTGGG - Intronic
1184140449 22:42575100-42575122 CCCTGTGCAGGGATGGGGGTGGG - Intergenic
1184152563 22:42647216-42647238 ACCCTTGGAGAGATGGGGCTGGG + Intronic
1184766832 22:46576723-46576745 GCCTTTCTAGAGATGGGTCAGGG - Intronic
950298666 3:11854346-11854368 CCCCTTGAAGAGATTGGCCTAGG - Intergenic
951950049 3:28190094-28190116 TGCTTTCCAGAGATGGGACTGGG - Intergenic
952321393 3:32281067-32281089 CCCCATGCAGAGATGGGGCTTGG - Intronic
952430381 3:33218352-33218374 CCCTTAGCAGAGGAGGTTCTAGG + Intronic
953839602 3:46378805-46378827 CACACTGCAGAGATTGGTCTGGG - Intergenic
955733563 3:62012888-62012910 CCTTTTGCACAGATAGCTCTAGG - Intronic
956387242 3:68733044-68733066 CCCTTTGCAGAAAATTGTCTAGG - Exonic
956754587 3:72372512-72372534 CTCTTTGAAGAGTTGGGTGTTGG + Exonic
961373231 3:126445378-126445400 TCCTGTGCAGAGATGTGTCTAGG - Intronic
961993372 3:131215752-131215774 CTCTTTGCAGAGGTGGGGATTGG + Intronic
961996011 3:131244155-131244177 CCCTTTGAAGAGATTGCTTTTGG - Intronic
963095146 3:141529495-141529517 CCCTTGGCAGACATTTGTCTGGG - Intronic
965272796 3:166639341-166639363 CCCTTTGGAGAGCTGAGACTTGG + Intergenic
968162834 3:196441015-196441037 CCCTTGGCAGAGACTGGTTTAGG - Intergenic
973760535 4:54110581-54110603 CTATTTGCAGAGATGTGTGTAGG - Intronic
975738198 4:77402512-77402534 AACTTTGCAGAGATGGGGATAGG + Intronic
978165833 4:105605427-105605449 CCCTTTGCAGAAAGGGGAGTGGG - Intronic
982102720 4:151983990-151984012 CCCTTTGCTCAGATGGCACTGGG - Intergenic
982389704 4:154851053-154851075 TCCTTTGCAGTGGTGGTTCTGGG + Intergenic
986267193 5:6200986-6201008 CCCTTGCCAAAGATGGGACTGGG + Intergenic
986267708 5:6204614-6204636 CCCTTGCCAAAGATGGGACTGGG + Intergenic
986753417 5:10811400-10811422 CCAATTGCAGAGGTGGGTCTAGG + Intergenic
986992064 5:13565661-13565683 CCCATTGTAGAGATGAGTGTTGG - Intergenic
987545724 5:19308366-19308388 CCCAATGCAGTGATGGGTATTGG + Intergenic
988415746 5:30944945-30944967 AGCTTTGCAGTGATGGTTCTAGG - Intergenic
988617987 5:32793771-32793793 CCCCTGGCTGAGATGGGTCTGGG + Intergenic
988738281 5:34044550-34044572 CCACTTCCAGAGATGGCTCTTGG - Intronic
990799432 5:59583881-59583903 CCCTTTGGAGAGGCGGGACTTGG - Intronic
991301446 5:65132923-65132945 TCATTTTCAGAGATGGGGCTGGG + Intergenic
993756613 5:91738350-91738372 CCCATAGCATAGATAGGTCTAGG + Intergenic
994451968 5:99955135-99955157 CCCTTGGCAGTCATGGATCTGGG - Intergenic
995767104 5:115630440-115630462 CACTTTGCAAAGGTGGGTATGGG + Intronic
997464873 5:134080432-134080454 CCCATTACAGACAGGGGTCTGGG - Intergenic
997719230 5:136064705-136064727 GCCTTGGCAGAGATGGGTGTGGG - Intergenic
998011204 5:138696948-138696970 GCCTCTGGAGAGAGGGGTCTGGG + Intronic
999374128 5:151074953-151074975 TTGTTTGCAGAGATGGGTTTTGG + Intronic
1002056587 5:176601341-176601363 CCTGTTGCAGAGAAGGGGCTAGG - Intronic
1002439260 5:179255910-179255932 CCCTTTGCACAGATGCTGCTGGG + Intronic
1003165195 6:3671358-3671380 CCCTTTCCAGTGTTGGGTTTGGG + Intergenic
1003602865 6:7533995-7534017 CCCTTTACAGACTTGGGCCTTGG + Intergenic
1005802939 6:29445513-29445535 CCCTGTGAAGAGATTGGCCTGGG - Intronic
1008925605 6:56889020-56889042 CCTTAAGCAGACATGGGTCTAGG - Intronic
1016470669 6:144371042-144371064 CCCCTTGCAGGGATGAGTCAGGG - Intronic
1016875099 6:148856585-148856607 CCTCTTGAAGAGATGGGACTAGG + Intronic
1017160910 6:151365361-151365383 GCCTTTACAGAGGTGGGGCTGGG + Exonic
1018948932 6:168365775-168365797 CGCTATGCAGAAATGGGTTTGGG + Intergenic
1019336546 7:485526-485548 CCCCTGGCAGAAGTGGGTCTTGG - Intergenic
1019555060 7:1625170-1625192 CTCCTTGCAGTGCTGGGTCTGGG - Intergenic
1021636281 7:22697199-22697221 CCCTATACAAAGATGGTTCTAGG + Intergenic
1022642720 7:32203458-32203480 CCCTCTGCAGAGATGGGAAATGG - Intronic
1025792732 7:64705892-64705914 GCCTTTGCAGATATTGGTTTCGG - Intronic
1028190947 7:87851430-87851452 GCCTTTGCTGATATGGGTCTGGG - Intronic
1028743921 7:94306589-94306611 GCCCTGGCAGAGATGGGTCCAGG + Intergenic
1031392445 7:121232234-121232256 CCCTGTGCCGGGATGGGTTTTGG + Intronic
1032230169 7:130067467-130067489 CCCTTTCCAGATATGGCTCCAGG - Intergenic
1034268812 7:149793556-149793578 GCCTCTGCAGGGCTGGGTCTTGG + Intergenic
1034450514 7:151134831-151134853 CCAGATGCAGAGATGGGCCTAGG - Intronic
1034559468 7:151870840-151870862 ACGTTTGCAGAGATGGGGCTGGG - Intronic
1034829789 7:154299181-154299203 CCCTTTGAGGGGAAGGGTCTGGG - Intronic
1035536238 8:393422-393444 CCCTCTGCAGAGATGGCTCACGG + Intergenic
1038266053 8:26040725-26040747 CCCATGGCAGAGAAGGGTTTGGG - Intronic
1038913804 8:31996900-31996922 CCCTTAGTAGAGATGGGGCATGG - Intronic
1039256215 8:35721754-35721776 GCCTTTGCAGAGAGCAGTCTAGG - Intronic
1039484633 8:37900826-37900848 CCCTCTGCAGAGCTGGGACTGGG + Intergenic
1041196437 8:55406418-55406440 CTCATTGCACAGATGAGTCTAGG + Intronic
1043101674 8:76055050-76055072 CTCTTTGCAGAGATTGCTTTTGG + Intergenic
1043690893 8:83150143-83150165 GCCTTAGCACAGATAGGTCTGGG - Intergenic
1046314226 8:112478920-112478942 CTCTGTGCATAGCTGGGTCTGGG - Intronic
1046416536 8:113922252-113922274 CACTTTTTTGAGATGGGTCTGGG + Intergenic
1047115704 8:121839620-121839642 CTCTCTCCAGAGATGGCTCTGGG - Intergenic
1048879871 8:138863454-138863476 CCCTGAGCAGAGGTGGGGCTGGG - Intronic
1050063155 9:1731459-1731481 ACCTTGGCAGAGATGTTTCTTGG - Intergenic
1053210481 9:36223256-36223278 CCCTGTGCATAGATGGCTCTAGG - Intronic
1060549946 9:124480191-124480213 CTCCTGGGAGAGATGGGTCTGGG - Intergenic
1060739645 9:126089924-126089946 CCCAGTGCTGAGATGGTTCTTGG - Intergenic
1061037726 9:128122771-128122793 CCCTTGGCCAAGATGGGACTTGG - Intronic
1061498820 9:130990795-130990817 CCCATTGCAGAGACGGGGGTGGG + Intergenic
1061782198 9:133002933-133002955 CCCTTGGCAGAAATAGCTCTGGG - Intergenic
1061935281 9:133853972-133853994 CCCAGTGCAGAGATGGGTGTGGG + Intronic
1062316596 9:135970408-135970430 CCCTTTCCAGAGATGGGTGGTGG + Intergenic
1062438317 9:136556910-136556932 CCCTTTGAGGAGATGGACCTGGG - Intergenic
1186023612 X:5284270-5284292 CCATTTGCAGGGCTGGGGCTTGG - Intergenic
1186675006 X:11807028-11807050 CCCTTTGGAAAGGTAGGTCTTGG + Intergenic
1186861905 X:13681066-13681088 CTCTTTGAAGAGCTGAGTCTTGG - Intronic
1186887469 X:13928883-13928905 CCATTTGCAGGGAGGAGTCTAGG + Intronic
1187941571 X:24387776-24387798 CTCTGTGCAGAGAGGGGTCCAGG + Intergenic
1197893277 X:131286451-131286473 CTCTTTTCAGGGATGAGTCTGGG - Exonic
1199255545 X:145715078-145715100 CCCTGTGCAGAGCTGGGTTCAGG - Intergenic
1200075078 X:153546815-153546837 CCCTGTGCGGAGCTGGGTTTGGG + Intronic
1200610409 Y:5321788-5321810 TTTTTTGTAGAGATGGGTCTCGG - Intronic
1201753008 Y:17454688-17454710 CCCTTTACAGAGATGGTCCAAGG + Intergenic
1202071009 Y:20991480-20991502 TCCTTTGCAGAAATGTTTCTTGG - Intergenic