ID: 1131147501

View in Genome Browser
Species Human (GRCh38)
Location 15:90023804-90023826
Sequence CTAGGCAGCATGGCAAAACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1306
Summary {0: 1, 1: 6, 2: 77, 3: 330, 4: 892}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131147496_1131147501 19 Left 1131147496 15:90023762-90023784 CCAAGGCAGGTGGATCATTGAGC 0: 2
1: 18
2: 125
3: 523
4: 5891
Right 1131147501 15:90023804-90023826 CTAGGCAGCATGGCAAAACCCGG 0: 1
1: 6
2: 77
3: 330
4: 892

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131147501 Original CRISPR CTAGGCAGCATGGCAAAACC CGG Intronic
900219892 1:1502700-1502722 CTTGGCAACATGGTGAAACCCGG - Intergenic
900298186 1:1963258-1963280 CTGGGCAACATGGTAAAACCCGG + Intronic
900639816 1:3683246-3683268 CTTGGGAGCCTGGCAGAACCAGG + Intronic
900849234 1:5129180-5129202 CTGGCCAATATGGCAAAACCCGG + Intergenic
900867296 1:5277481-5277503 GTGGGCAGCATGGCAATGCCAGG - Intergenic
900921514 1:5674513-5674535 CTGGGCAACATGGCAAAACCTGG - Intergenic
901058076 1:6458504-6458526 CTGACCAACATGGCAAAACCCGG - Intronic
901216279 1:7557115-7557137 CTGGGCAACATGGCGAAACCCGG + Intronic
901286641 1:8084997-8085019 CTGGGCAACATGGCGAAACCTGG - Intergenic
901408481 1:9066423-9066445 CTGGGCAACATGGCGAAACTTGG - Intronic
901558446 1:10050260-10050282 CTGACCAACATGGCAAAACCTGG - Intronic
901693856 1:10991911-10991933 CCAGGCAATATGGCAAGACCTGG + Intergenic
901748337 1:11389573-11389595 CTGGGCAACATTGCGAAACCCGG - Intergenic
901803307 1:11721792-11721814 CTGGCCAACATGGCAAAACCCGG + Exonic
901809277 1:11757688-11757710 CTGGCCAACATGGCAAAGCCCGG + Intergenic
901876760 1:12171202-12171224 CTGGCCAACATGGCAAAACCCGG - Intronic
901939008 1:12647846-12647868 CTAGGCAACATGGCAAAACCTGG - Intronic
901960311 1:12821281-12821303 CTGGGCAACATGGTGAAACCTGG + Intergenic
902031176 1:13423626-13423648 CTGGGCAACATGGTGAAACCTGG - Intergenic
902128355 1:14236725-14236747 CTGGGCAACATGGAAAAACCTGG + Intergenic
902244291 1:15109192-15109214 CTGGGCAACATGGCAAAACCCGG + Intronic
902574881 1:17371509-17371531 CTGGGCAACATGGCAAAACCCGG + Intergenic
902875095 1:19336169-19336191 CTGGCCAACATGGCGAAACCCGG + Intergenic
902918757 1:19654218-19654240 CTGGGCAACACGGCGAAACCTGG + Intronic
902970168 1:20042662-20042684 TTAGTCAGGTTGGCAAAACCAGG + Intronic
903141295 1:21340646-21340668 CTGGGCAACATGGCGAAACCCGG + Intronic
903394266 1:22987375-22987397 CTGGCCAACATGGCAAAACTCGG - Intergenic
903915077 1:26757828-26757850 CTGGCCAACATGGCAAAACCCGG - Intronic
904133189 1:28290536-28290558 CTGGGCAACATGGTGAAACCTGG - Intergenic
904649999 1:31998311-31998333 CTGGGCAACCTGGCAAAACCTGG + Intergenic
904650533 1:32002548-32002570 CTGGCCAACATGGCAAAACCTGG + Intergenic
904659513 1:32073937-32073959 CTGGGCAACATGGCGAAACCCGG - Intronic
905077993 1:35291311-35291333 CTAGGCAACAAAGCAAGACCCGG - Intronic
905110666 1:35592096-35592118 CTGGGCAACATGGTGAAACCCGG + Intronic
905191909 1:36242341-36242363 CTGGGCAACATGGCAAGACCTGG - Intronic
905445210 1:38024026-38024048 CTGGCCAACATGGCAAAACCTGG - Exonic
905583699 1:39101417-39101439 CTGGGCAACATGGCAAAATTCGG - Intronic
905595233 1:39200882-39200904 CTGGGCAACATGGCGAAACCCGG + Intronic
905747794 1:40434197-40434219 CTGACCAACATGGCAAAACCTGG - Intergenic
905812186 1:40920745-40920767 CTGGGCAACATGGTGAAACCTGG + Intergenic
906179591 1:43806879-43806901 CTGGGCAACATGGTGAAACCTGG - Intronic
906197916 1:43940551-43940573 CTAGCCAACATGGTAAAACCCGG + Intergenic
906338608 1:44957568-44957590 CTGGCCAACATGACAAAACCTGG + Intronic
906363704 1:45186779-45186801 CTGGCCAACATGGCAAAACCCGG - Intronic
906378942 1:45319282-45319304 TTAGTCAGGATAGCAAAACCAGG - Intergenic
906485407 1:46230748-46230770 CTGGCCAACACGGCAAAACCCGG - Intergenic
906570242 1:46831678-46831700 CTGGGCAACATGGTAAAACCCGG - Intergenic
906671738 1:47660884-47660906 CTTGGGAGCCTGCCAAAACCAGG + Intergenic
906787866 1:48631582-48631604 CTGGCCAACATGGCAAAACCCGG - Intronic
907142105 1:52196610-52196632 CTGGGCAGCAGAGCAAGACCCGG + Intronic
907190199 1:52641749-52641771 CTGGACAACATAGCAAAACCTGG + Intronic
907346608 1:53786884-53786906 CTAAGCAACATGGCAAGACTCGG - Intronic
907492681 1:54818781-54818803 CTGGGCAACATGACAAAACCTGG - Intronic
907634057 1:56115586-56115608 CTGGCCAACATGGCAAAATCTGG - Intergenic
908125014 1:61022093-61022115 CTGGCCAACATGGTAAAACCCGG - Intronic
908149304 1:61283378-61283400 CTGGCCAACATGGTAAAACCCGG + Intronic
908504834 1:64786598-64786620 CTGGCCAACATGGCGAAACCCGG + Intronic
908995907 1:70153789-70153811 CTGGGCAACATGGCAAAACCTGG + Intronic
909757476 1:79244584-79244606 CTGGCCAACATGGTAAAACCTGG - Intergenic
909946613 1:81670898-81670920 CTGGGCAACGTGGCAAAACCTGG - Intronic
910251609 1:85203166-85203188 CTGGACAACATGGCACAACCTGG + Intergenic
910411123 1:86945876-86945898 CTGGGCAGCATGGCAAAACCTGG + Intronic
910574798 1:88748903-88748925 CTGGGCAGCAGAGCAAGACCTGG + Intronic
910704477 1:90113127-90113149 CTGGGCAACATGGCAAAACCCGG - Intergenic
910965324 1:92802583-92802605 CTAGCCAATATGGCGAAACCCGG - Intergenic
910980179 1:92952427-92952449 CTGGGCAACATGGTGAAACCTGG + Intronic
911172688 1:94785664-94785686 CTGGGCAACATGGTGAAACCGGG - Intergenic
911280186 1:95915615-95915637 CTGGCCAGCATGGTGAAACCTGG + Intergenic
911397466 1:97329554-97329576 CTGGCCAACATGGCAAAACCCGG + Intronic
911647294 1:100351001-100351023 CTGGCCAACATGGCAAAACCCGG + Intergenic
911840109 1:102671704-102671726 CTCGGCAAAATGACAAAACCCGG - Intergenic
911967160 1:104383922-104383944 TTAGTCAGGATGGCAAAACCAGG - Intergenic
912352227 1:109025245-109025267 CTGGGCAACATGGCGAAACATGG + Intronic
912477066 1:109945502-109945524 CTGGCCAACATGGTAAAACCTGG + Intergenic
912997920 1:114550163-114550185 CTGGGCAACATGGCAAAACCCGG + Intergenic
913013536 1:114709863-114709885 CTGGGCAACATGGCAAAACCCGG + Intronic
913059275 1:115189712-115189734 CTTGGCAACATGGTGAAACCTGG + Intergenic
913120551 1:115736610-115736632 CTAGGCAACAGAGCAAAACTAGG + Intronic
913249132 1:116897346-116897368 CTGGTCATCATGGCAAAAACCGG + Intergenic
913679133 1:121172139-121172161 CTGGGCAAAATGGCAAAAACTGG + Intronic
914030965 1:143959783-143959805 CTGGGCAAAATGGCAAAAACTGG + Intronic
914158484 1:145108177-145108199 CTGGGCAAAATGGCAAAAACTGG - Intronic
914243105 1:145865737-145865759 CTGGGCAACATGGCAAAACTTGG + Intergenic
914820788 1:151101052-151101074 CTGGGCAGCATGGTGAAACCTGG + Intronic
914890769 1:151620880-151620902 CTGGCCAGCATGGTGAAACCCGG - Intronic
915329143 1:155098794-155098816 CTGGCCAACATGGCGAAACCTGG + Intergenic
915336427 1:155145332-155145354 CTGGCCAACATGGTAAAACCAGG + Intergenic
915386772 1:155501559-155501581 CTAGTCAACATGGCAAAACCTGG - Intronic
915509055 1:156376552-156376574 CTGGCCAACATGGCGAAACCCGG - Intronic
915750649 1:158206759-158206781 CTGGCCAACATGGAAAAACCTGG - Intergenic
915774180 1:158464837-158464859 CTCGGCAACATGGCAAAACCTGG - Intergenic
916068146 1:161152858-161152880 CTGGCCAACATGGCGAAACCCGG + Intronic
916641010 1:166729264-166729286 CCAGGAAGCATGGCAAACCATGG + Intergenic
917102339 1:171459119-171459141 TTGGGCAACATGGCGAAACCTGG - Intergenic
917119776 1:171635241-171635263 CTGGGCAGCACCTCAAAACCAGG + Intergenic
917328899 1:173861957-173861979 CTGGCCAACATGGCAAAACCCGG - Intergenic
917353420 1:174102008-174102030 CTAGGCAACATGGCGAAACCCGG - Intergenic
917539102 1:175896340-175896362 CTAGCCAACCTGGCAAGACCTGG + Intergenic
918807826 1:189072355-189072377 CTGGGCAACATGGCGAAACCCGG + Intergenic
918900767 1:190413985-190414007 CTGGGCAGCAAAGCAACACCTGG - Intronic
918905404 1:190485664-190485686 CTGGGCAACATGGCAAAACATGG + Intergenic
919862018 1:201746016-201746038 CTGGACAACACGGCAAAACCCGG - Intronic
920040726 1:203094136-203094158 CTGGGCAACATGGTGAAACCTGG + Intronic
920251624 1:204625942-204625964 CAAGGCAGCATGGCACTCCCAGG - Intronic
920466431 1:206190677-206190699 CTGGGCAAAATGGCAAAAACTGG + Intronic
920510286 1:206546297-206546319 CTGGGCAACATGGCGAAACCCGG - Intronic
920534083 1:206726192-206726214 CTGGCCAACATGGCGAAACCCGG + Intronic
920933006 1:210406582-210406604 CTGGGAAACATAGCAAAACCCGG - Intronic
921059452 1:211570806-211570828 CTGGGCAACATGGCAAAACCAGG - Intergenic
921549124 1:216511638-216511660 CTAGGAAGAATGGCCAACCCTGG + Intronic
921869250 1:220120564-220120586 CTGGGCAACATGGCAAAACCCGG - Intronic
921894469 1:220385153-220385175 CTGGGCAACATGGCAAAACCTGG - Intergenic
922103426 1:222492553-222492575 CTGGGCAACATAGCAAGACCTGG + Intergenic
922232019 1:223695684-223695706 CTGGGCAACATAGCAAAACCTGG + Intergenic
922235633 1:223720505-223720527 CTGCGCAACATGGCAAGACCCGG - Intronic
922368736 1:224889176-224889198 TTAGTTAGGATGGCAAAACCTGG - Intergenic
922406756 1:225322277-225322299 CTGGCCAACATGGCGAAACCCGG - Intronic
922843033 1:228659926-228659948 CTGGGAAACATGGTAAAACCTGG + Intergenic
922909205 1:229201413-229201435 CTGGGGAACATGGCAAGACCCGG - Intergenic
922970569 1:229733321-229733343 CTGGCCAACATGACAAAACCCGG + Intergenic
923444851 1:234060640-234060662 CTGGGCAACATGGTAAAACCCGG - Intronic
923588254 1:235295317-235295339 CTGGCCAACATGGCAAAACCTGG + Intronic
924051499 1:240084175-240084197 CTGGCCAACATGGCAAAACCCGG + Intronic
924194632 1:241592963-241592985 CTGGGCAGCATGGCAAGACCCGG - Exonic
924345589 1:243070060-243070082 CTGGGCAACATAGCAAGACCTGG + Intergenic
924451095 1:244179841-244179863 CTGGCCAACATGGCAAAACCTGG - Intergenic
1063217112 10:3934673-3934695 CTGGGCAACATGGCGAAACCTGG - Intergenic
1063405585 10:5791417-5791439 CTGGCCAACATGGCGAAACCCGG + Intronic
1063431072 10:5988679-5988701 CTGGGCAACATGGCAAAATCTGG - Intergenic
1063474497 10:6316666-6316688 CTGGCCAACATGGCGAAACCCGG - Intergenic
1063683654 10:8214673-8214695 CTGGCCAACATGGCAAAACCCGG - Intergenic
1063898269 10:10704996-10705018 CTGGGCAACATGGCGAGACCTGG + Intergenic
1064124595 10:12649056-12649078 CTGGGCAACATAGTAAAACCCGG - Intronic
1064653447 10:17533207-17533229 CTGGCCAACATGGCGAAACCTGG + Intergenic
1064728792 10:18308182-18308204 CTGGCCAACATGGCGAAACCCGG - Intronic
1064954092 10:20887605-20887627 CTGGGCAACATGGCAAAAGCTGG - Intronic
1065294900 10:24265052-24265074 CTGGGTAACATGGTAAAACCTGG - Intronic
1065582713 10:27187559-27187581 CTGGCCAACATGGCAAAACCTGG + Intergenic
1065695772 10:28378577-28378599 CTGGCCAACATGGCAAAACTCGG - Intergenic
1065707322 10:28482503-28482525 CTAGCCAACATGGTGAAACCTGG + Intergenic
1065748456 10:28863277-28863299 GTGGGCAACATGGCAAAATCTGG - Intronic
1065964889 10:30763073-30763095 CTGGGCAATGTGGCAAAACCCGG - Intergenic
1066179154 10:32942883-32942905 CTGGGCAACATAGCAAAACTTGG + Intronic
1066189845 10:33046322-33046344 CTGGGCAAAATGGCAAAACCCGG + Intergenic
1066566264 10:36724635-36724657 CTGGGCAGCATGGTGAAACCCGG + Intergenic
1066709125 10:38214632-38214654 CTGGGCAACATGGTGAAACCTGG - Intergenic
1066730751 10:38434752-38434774 CTGGGCAACATAGCAAGACCTGG - Intergenic
1067384039 10:45802716-45802738 CTGGCCAACATGGCAAAACCTGG - Intergenic
1067610350 10:47707575-47707597 TTGGGCAACATGACAAAACCTGG - Intergenic
1067782279 10:49217359-49217381 CTGGGCAACATGGCAGAACCCGG - Intergenic
1067891729 10:50143286-50143308 CTGGCCAACATGGCAAAACCTGG - Intergenic
1068073993 10:52231205-52231227 CTGGGCAACATGGTGAAACCTGG + Intronic
1068095473 10:52486152-52486174 CTGGCCAAAATGGCAAAACCCGG - Intergenic
1068644981 10:59455887-59455909 CTGAGCAACATGGCAAAGCCCGG - Intergenic
1068989421 10:63134995-63135017 CTGGGCAACATGGCGAAACCCGG + Intronic
1069045130 10:63735314-63735336 CTGGGCAACATAGCAAGACCCGG - Intergenic
1069240960 10:66138636-66138658 CTGGCCAGCATGGTGAAACCCGG + Intronic
1069547685 10:69340438-69340460 CTGGCCAACATGGTAAAACCCGG - Intronic
1070118240 10:73550112-73550134 CTGGCCAACATAGCAAAACCCGG - Intronic
1070946680 10:80397717-80397739 CTGGCCAGCATGACGAAACCTGG - Intergenic
1071187475 10:83060890-83060912 TTAGTCAGGATGGCCAAACCAGG - Intergenic
1071543576 10:86509954-86509976 CTGGCCAACATGGTAAAACCCGG - Intronic
1071625761 10:87167833-87167855 TTGGGCAACATGACAAAACCTGG - Intronic
1072593631 10:96850638-96850660 CTGGGCAACATAGCAAGACCTGG - Intronic
1072620786 10:97077913-97077935 CTGGGCAACATAGCAAGACCTGG + Intronic
1072671685 10:97434692-97434714 CTAGGCAACATAGCAAGACCTGG + Intergenic
1072749371 10:97966298-97966320 CTGGCCAACATGGCAAAACCCGG - Intronic
1072776988 10:98207816-98207838 CTAGGCAACATGATGAAACCCGG + Intronic
1072932725 10:99680765-99680787 CTGGGCAACATGGTGAAACCTGG - Intronic
1073313906 10:102564647-102564669 ATAGGCAGCTTAGCGAAACCAGG - Intronic
1074342587 10:112647958-112647980 CTGGGCAACATGGCAAAACTTGG - Intronic
1074490628 10:113936401-113936423 CTGGCCAACATGGCAAAACCCGG - Intergenic
1074520345 10:114215197-114215219 CTATGCAGCAAGGAAAAACAAGG - Intronic
1074629430 10:115234777-115234799 CAGGGCAACATAGCAAAACCCGG - Intronic
1075051419 10:119185057-119185079 CTGGCCAACATGGCAAAACCTGG - Intergenic
1075108910 10:119561874-119561896 CTGGGCAACATGGTGAAACCCGG + Intergenic
1075380892 10:122017624-122017646 CTGGCCAACATGGCAAAACCCGG + Intronic
1075437230 10:122453897-122453919 CCTGGCAACATGGCAAAACCTGG + Intergenic
1075442686 10:122492522-122492544 CTGGCCAACATGGCAAAACCCGG - Intronic
1075928346 10:126271572-126271594 CTGGGCAACATGGTGAAACCCGG + Intronic
1076014682 10:127018231-127018253 CTAAGCAGCATCACACAACCTGG - Intronic
1076155909 10:128205746-128205768 CTGGGCAACATGGCAAAACCTGG + Intergenic
1076668991 10:132108810-132108832 CTGGGCAACATAGCAAAACCTGG + Intronic
1076863280 10:133152947-133152969 CTGGGCAATATGGCAAAACCTGG + Intergenic
1077528123 11:3080911-3080933 CTATGCAGCAAGGAAAAACAAGG + Intergenic
1077583462 11:3432905-3432927 CTAGACAATATGGCAAAACCTGG - Intergenic
1077737001 11:4801730-4801752 CTAGACAACATGGTGAAACCCGG - Intronic
1078213796 11:9293997-9294019 CCAGACAACATAGCAAAACCTGG + Intronic
1078251634 11:9621282-9621304 CTGGACAACATGGCGAAACCTGG - Intergenic
1079030672 11:16983885-16983907 TTGGGCAACATGGCAAGACCCGG + Intronic
1079239612 11:18713341-18713363 CTGGCCAACATGGCGAAACCCGG - Intronic
1079488449 11:20960712-20960734 CTGAGCAGCATGGATAAACCAGG - Intronic
1079497973 11:21067840-21067862 CTAGCCAACATGGTGAAACCTGG + Intronic
1080242838 11:30147047-30147069 CTGGCCAACATGGTAAAACCCGG - Intergenic
1081785264 11:45742097-45742119 CTGGCCAACATGGCAAAACCCGG + Intergenic
1081791354 11:45788721-45788743 CTGGACAGCGTGGCAAAATCCGG - Intergenic
1081816280 11:45944951-45944973 CTGGCCAACATGGCGAAACCTGG - Intronic
1081817537 11:45958370-45958392 CTGAGCAACATGACAAAACCTGG + Intronic
1081834287 11:46141366-46141388 CTGGCCAACATGGCAAAACCGGG + Intergenic
1081891895 11:46550007-46550029 CTGGCCAACATGGCAAAACCTGG - Intronic
1082822462 11:57553301-57553323 CTGGGCAATATGGCAAAACCTGG + Intronic
1083250482 11:61463711-61463733 CTGGGCAACATGGCAAAACCTGG - Intronic
1083357940 11:62081490-62081512 CTGGGCTACATGGCAAAACCTGG - Intergenic
1084126212 11:67100739-67100761 CTGGCCAACATGGCAAAACCTGG - Intergenic
1084144922 11:67260038-67260060 CTGGTCAACATGTCAAAACCCGG + Intergenic
1084240384 11:67815718-67815740 CTAGACAATATGGCAAAACCTGG - Intergenic
1084352490 11:68612461-68612483 TTTGGCAGGAAGGCAAAACCTGG + Intronic
1084362069 11:68675237-68675259 CTGGCCAACATGGCGAAACCTGG - Intergenic
1084717208 11:70881752-70881774 CTGGGCAACAGAGCAAAACCTGG - Intronic
1084725709 11:70940443-70940465 CTGGCCAGCATGGTGAAACCTGG - Intronic
1084778468 11:71393096-71393118 CTGGGCAACACGGCAAGACCCGG - Intergenic
1084832056 11:71777127-71777149 CTAGACAATATGGCAAAACCTGG + Intergenic
1085357948 11:75856634-75856656 CTAGACAACATGGCAAAACTCGG - Intronic
1085362747 11:75906536-75906558 CTAGCTAACATGGTAAAACCTGG - Intronic
1085580908 11:77649603-77649625 CTGGACAACATGGCAAAACCTGG - Intergenic
1086305775 11:85480977-85480999 CCAGCCAGCGAGGCAAAACCAGG - Intronic
1086679014 11:89645707-89645729 CTGGCCAACATGGCGAAACCCGG - Intergenic
1087047545 11:93855433-93855455 CTGGCCAACATGGCGAAACCCGG - Intergenic
1087160967 11:94947648-94947670 CTGGGCAACATAGCAAAACCAGG - Intergenic
1087687236 11:101278853-101278875 CTGGCCAACATGGTAAAACCCGG + Intergenic
1087762989 11:102121986-102122008 CTGGGCAACATGGTAAAACCTGG - Intronic
1089263968 11:117244169-117244191 TTGGGCAACATGGCAAAACCTGG - Intronic
1089352629 11:117830103-117830125 CCAGCCAACATGGCGAAACCCGG - Intronic
1089965005 11:122648460-122648482 CTGGTCAACATGACAAAACCCGG + Intergenic
1090411924 11:126515229-126515251 ATTAGCAACATGGCAAAACCCGG + Intronic
1090676005 11:128996967-128996989 CTACACAACATGGCAAGACCTGG - Intronic
1090822558 11:130356837-130356859 CTAGCCAACATGGTGAAACCCGG + Intergenic
1090825936 11:130386146-130386168 CTAGGCAACACAGCAAAACCTGG - Intergenic
1091899262 12:4131545-4131567 TTGGGCAACATAGCAAAACCTGG - Intergenic
1092211577 12:6649820-6649842 CTGGCCAACATGGCGAAACCCGG - Intergenic
1092410615 12:8250273-8250295 CTAGACAACATGGCAAAACCTGG - Intergenic
1092450249 12:8594916-8594938 CTGGCCAACATGGCAAAACCCGG + Intergenic
1092471274 12:8784163-8784185 CTGGGCAACATGGTAAAATCCGG + Intergenic
1092824859 12:12389326-12389348 CTAGCCAACATGGAGAAACCTGG - Intronic
1093014274 12:14140639-14140661 CTGGCCAATATGGCAAAACCCGG + Intergenic
1093043592 12:14414958-14414980 CTGGGCAGCACAGCAAGACCAGG - Intronic
1093271151 12:17063756-17063778 CTGGCCAACATGGCAAAACCCGG + Intergenic
1093925492 12:24904391-24904413 CTGGGCAACATAGCAAAACCCGG - Intronic
1094288661 12:28821260-28821282 CTGGGCAACATGACAAAACCCGG + Intergenic
1094461522 12:30701632-30701654 CTAGTCAACATGGTGAAACCCGG + Intergenic
1094680263 12:32661225-32661247 CTGGCCAGCGTGGCAAAACCCGG - Intergenic
1094737338 12:33249825-33249847 CTGGGCAACATAGCAAAACTTGG + Intergenic
1095207091 12:39450696-39450718 CTGGGCAACATGGCAAGACCCGG - Intergenic
1095307746 12:40658175-40658197 CTGGGAAGCATGGTAAAACATGG - Intergenic
1095762701 12:45857948-45857970 CTGGGCAACATGGCAAAACCTGG - Intronic
1095946548 12:47757101-47757123 CTAGGCAACATAGCGAAACCTGG + Intronic
1096151940 12:49319703-49319725 CTGGCCAATATGGCAAAACCCGG - Intergenic
1096205581 12:49718856-49718878 CTGGGCAACATGGCAATACTTGG + Intronic
1096401548 12:51311402-51311424 CTAGGCAGCAGAGCAAGACCTGG - Intronic
1096484374 12:51968042-51968064 CTGGCCAACATGGCGAAACCCGG + Intronic
1096726940 12:53571874-53571896 CTGGCCAACATGGCGAAACCCGG + Intronic
1097112356 12:56670455-56670477 CTGGGCAACATAGCAAGACCTGG - Intronic
1097309174 12:58099972-58099994 CTGGGCAACATGGTGAAACCTGG + Intergenic
1097668924 12:62513414-62513436 CTGGCCAACATGGCGAAACCCGG - Intronic
1097906109 12:64921292-64921314 CTGGGCAACATGGTGAAACCCGG - Intergenic
1098006658 12:66004463-66004485 CTGGCCAACATGGCAAAACCCGG + Intergenic
1098145000 12:67488954-67488976 CTGGTCAACATGGCAAAACTAGG - Intergenic
1099962830 12:89413087-89413109 CTGGCCAACATGGCGAAACCAGG - Intergenic
1100094952 12:91022691-91022713 CTGGGCAACATGGCCAAACCCGG - Intergenic
1100593072 12:96047332-96047354 CAAAGCAGCATGTCAAAACCTGG - Intergenic
1101509737 12:105381906-105381928 CTGGGCAACATGGGAAAACCTGG + Intronic
1101597257 12:106178241-106178263 CGAGGCAGCCTGGGAAATCCAGG - Intergenic
1101799480 12:108008339-108008361 GTAGGCAGCCTGGTAACACCTGG - Intergenic
1101836137 12:108296633-108296655 CTGGGCAACATGGTGAAACCCGG + Intronic
1102016338 12:109650405-109650427 CTGGGCAGCATGGCAAAACCTGG + Intergenic
1102080731 12:110096053-110096075 CTGGCCAACATGGCGAAACCTGG - Intergenic
1102080843 12:110096879-110096901 CTGGGCAACATGATAAAACCTGG - Intergenic
1102248646 12:111370711-111370733 CTAGCCAACATGGTGAAACCCGG + Intergenic
1102381389 12:112469703-112469725 CCAGTCAACATGGCAAAACCTGG - Intronic
1102481067 12:113223732-113223754 CTGGCCAACATGGCGAAACCTGG - Intronic
1102692690 12:114773738-114773760 CTGGCCAACATGGCGAAACCTGG - Intergenic
1103306482 12:119968998-119969020 CTGGGCAACATGGTGAAACCTGG + Intergenic
1103497169 12:121371817-121371839 CTGGGCAACATGGTGAAACCTGG - Intronic
1103669013 12:122596271-122596293 CTAGGTAACATGGTGAAACCCGG - Intronic
1103788898 12:123455174-123455196 CTAGGCAATATGGCAAAACCGGG - Intergenic
1103874815 12:124118735-124118757 CTGGCCAACATGGCAAAACCCGG - Intronic
1103893538 12:124257525-124257547 CTGGCCAACATGGCGAAACCTGG - Intronic
1105261718 13:18784491-18784513 CTAGGCAGCATAGCACAAGGGGG - Intergenic
1105704115 13:22958655-22958677 CTGGCCAGCATGGTGAAACCCGG + Intergenic
1105739241 13:23304817-23304839 CTGGCCAACATGGCAAAACCCGG - Intronic
1105821483 13:24084829-24084851 CTGGGCAACATAGCAAGACCCGG + Intronic
1106028954 13:25980856-25980878 CTGGGCAACATAGCAAGACCTGG + Intronic
1106211133 13:27647411-27647433 CTGGGCAACATAGCAAGACCTGG - Intronic
1106258238 13:28040937-28040959 CTAGGCAGCAGAGCAAGACCCGG + Intronic
1106274198 13:28188406-28188428 CTAGGCAATATAGCAAGACCTGG + Intronic
1107309929 13:39065875-39065897 CTGGGCAACATGGCAAAACCTGG - Intergenic
1107908454 13:45083356-45083378 CTGGCCAACATGGTAAAACCCGG + Intergenic
1108189531 13:47923392-47923414 CTGGCCAACATGGCAAAACCTGG + Intergenic
1108281840 13:48869260-48869282 CTAGTCAGGATGGTAAAACTAGG + Intergenic
1108639980 13:52374221-52374243 CTGGCCAGCATGGCAAAACGCGG - Intergenic
1109161268 13:58977719-58977741 CAAGGTAGAATGGCAAAAACTGG + Intergenic
1109263756 13:60173193-60173215 CTGGCCAACATGGCGAAACCCGG + Intergenic
1109571094 13:64191368-64191390 CTGGGCAACATTGCAAGACCTGG + Intergenic
1109940854 13:69362003-69362025 CTGGCCAACATGGCGAAACCCGG + Intergenic
1111105278 13:83637469-83637491 CTAGGCAACATAGTGAAACCTGG + Intergenic
1111113130 13:83741690-83741712 CTGGGCAACATGGTGAAACCTGG + Intergenic
1111485187 13:88888467-88888489 CTGGGCAACATAGCAAAACCTGG + Intergenic
1111986289 13:95070051-95070073 ATGGCCAACATGGCAAAACCTGG + Intronic
1112350916 13:98632408-98632430 CTGGGCAACATAGCGAAACCTGG - Intergenic
1112643544 13:101304626-101304648 CTGAGCAACATGGCGAAACCTGG - Intronic
1112831411 13:103457158-103457180 CTGGCCAACATGGCGAAACCCGG - Intergenic
1113487401 13:110664315-110664337 CTGGGCAACATGGCAACACCCGG + Intronic
1114476027 14:22995487-22995509 CTGACCAACATGGCAAAACCTGG + Intronic
1114791984 14:25669614-25669636 CTGGGCAATGTGGCAAAACCCGG - Intergenic
1115233385 14:31185535-31185557 CTGGGCAACATGGTAAAACCTGG + Intronic
1115927877 14:38457239-38457261 CTGGGCAACATGGTAAAACCTGG - Intergenic
1116335223 14:43648814-43648836 CTGGCCAACATGGTAAAACCTGG - Intergenic
1116457879 14:45140251-45140273 CTGGGCAACATGGTGAAACCTGG - Intronic
1117298430 14:54399173-54399195 CTGGCTAACATGGCAAAACCTGG - Intronic
1117485419 14:56192043-56192065 CTGGCCAACATGGCGAAACCCGG - Intronic
1117530092 14:56652303-56652325 CTGGGCAACATGGTGAAACCTGG + Intronic
1117685781 14:58251454-58251476 CTGGGCAACATGGCGAAACCTGG - Intronic
1118027253 14:61781863-61781885 CTGGGCCACATGGCCAAACCTGG + Intronic
1118194549 14:63612563-63612585 CTGGCCAACATGGCGAAACCCGG - Intronic
1118228469 14:63926032-63926054 CTGGGCAACATGGTGAAACCAGG - Intronic
1118281563 14:64433603-64433625 CTGGGCAACACGGCAAAACCCGG - Intronic
1118414485 14:65519967-65519989 CTGGGCAACACGGCAAAACCCGG - Intronic
1118883251 14:69846423-69846445 CTGGGCAACGTGGCGAAACCCGG - Intergenic
1119344008 14:73906667-73906689 CTGGCCAACATGGCAAAACCCGG - Intronic
1119454187 14:74740225-74740247 CTGGTCAACATGGCAAAACCCGG + Intergenic
1119631959 14:76240247-76240269 CTGGGCAACATGGTGAAACCTGG - Intronic
1119803497 14:77466164-77466186 CTGGGCAACATAGCAAGACCAGG - Intronic
1120024684 14:79569797-79569819 CTGGCCAACATGGCAAAACCCGG - Intronic
1120495948 14:85235604-85235626 CTGGCCAACATGGCAAAACCCGG + Intergenic
1120955448 14:90078227-90078249 CTGGCCAACATGGCGAAACCCGG + Intronic
1121394762 14:93610799-93610821 CTAGGCAACATGACAAGACCTGG - Intronic
1122351255 14:101094426-101094448 CTGGCCAACATGGTAAAACCCGG + Intergenic
1202834375 14_GL000009v2_random:66964-66986 CTAGGCAGCATAGCACAAGGGGG + Intergenic
1123470683 15:20550001-20550023 CTGGGCAACATGGTGAAACCTGG + Intergenic
1123470767 15:20550461-20550483 CTGGGCAACATGGTGAAACCCGG + Intergenic
1123647293 15:22450242-22450264 CTGGGCAACATGGTGAAACCCGG - Intergenic
1123647377 15:22450702-22450724 CTGGGCAACATGGTGAAACCTGG - Intergenic
1123664572 15:22598356-22598378 CTGGGCAACATGGTGAAACCGGG + Intergenic
1123675855 15:22709956-22709978 CTGGGCAACATGGTGAAACCCGG + Intergenic
1123712558 15:22999589-22999611 CTGGGCAACATGGTGAAACCCGG - Exonic
1123721531 15:23065642-23065664 CTGGGCAACATGGTGAAACCCGG + Intergenic
1123721626 15:23066130-23066152 CTGGGCAACATGGTGAAACCCGG + Intergenic
1123721958 15:23068140-23068162 CTGGGCAACATGGTGAAACCTGG + Intergenic
1123722087 15:23068857-23068879 CTGGGCAACATGGTGAAACCAGG + Intergenic
1123730984 15:23144978-23145000 CTGGGCAACATGGTGAAACCTGG + Intergenic
1123731068 15:23145438-23145460 CTGGGCAACATGGTGAAACCCGG + Intergenic
1123749123 15:23342404-23342426 CTGGGCAACATGGTGAAACCTGG + Intergenic
1123749207 15:23342864-23342886 CTGGGCAACATGGTGAAACCCGG + Intergenic
1123800645 15:23816297-23816319 CTAGTCAGCATTCCAAATCCAGG - Intergenic
1124027031 15:25976445-25976467 CTGGGCAATATGGCAAAAGCTGG - Intergenic
1124091072 15:26601229-26601251 CCGGCCAACATGGCAAAACCCGG + Intronic
1124281496 15:28366286-28366308 CTGGGCAACATGGTGAAACCTGG + Intergenic
1124281579 15:28366747-28366769 CTGGGCAACATGGTGAAACCCGG + Intergenic
1124301124 15:28544873-28544895 CTGGGCAACATGGTGAAACCCGG - Intergenic
1124301208 15:28545333-28545355 CTGGGCAACATGGTGAAACCTGG - Intergenic
1124318407 15:28692793-28692815 CTGGGCAACATGGTGAAACCGGG + Intergenic
1124322726 15:28726904-28726926 CTGGGCAACATGGTGAAACCCGG + Intronic
1124327851 15:28782879-28782901 CTGGGCAACATGGTGAAACCCGG + Intergenic
1124327902 15:28783167-28783189 CTGGGCAACATGGTGAAACCCGG + Intergenic
1124523636 15:30427482-30427504 CTGGGCAACATGGTGAAACCCGG + Intergenic
1124535031 15:30538733-30538755 CTGGGCAACATGGTGAAACCCGG - Intergenic
1124565033 15:30804642-30804664 CTGGGCAACATGGTGAAACCGGG - Intergenic
1124574511 15:30896051-30896073 CTAGGCAACATGGTGAAACCCGG - Intergenic
1124641910 15:31401188-31401210 CTGGGCAACATGGTGAAACCCGG - Intronic
1124763618 15:32468868-32468890 CTGGGCAACATGGTGAAACCCGG + Intergenic
1124775008 15:32580183-32580205 CTGGGCAACATGGTGAAACCCGG - Intergenic
1125385169 15:39129513-39129535 CTGGCCAACATGGCAAAACCTGG - Intergenic
1125527917 15:40389996-40390018 CTTGGCAGCATGGCATCAGCTGG + Intronic
1125544492 15:40492567-40492589 CTAGGAAATATGGCAAAACCTGG + Intergenic
1125627716 15:41122315-41122337 CTGGCCAACATGGCGAAACCTGG + Intergenic
1125629505 15:41135565-41135587 TTAGTCAGGATGGCAAAACCAGG - Intergenic
1126511112 15:49475795-49475817 CTGGCCAACATGGCAAAACCGGG + Intronic
1126589230 15:50322834-50322856 CTGGGCAACATGGCAAAACCTGG + Intronic
1126600462 15:50422967-50422989 CTGGCCAAAATGGCAAAACCTGG - Intergenic
1126600860 15:50425929-50425951 CTGGCCAACATGGCGAAACCCGG + Intronic
1126608757 15:50507090-50507112 CTGGCCAACATGGCAAAACCCGG + Exonic
1127400601 15:58581678-58581700 CTGGGCAACATGGCAAAACTCGG - Intergenic
1127546334 15:59997059-59997081 CTTGTCAGCAGGGGAAAACCAGG - Intergenic
1128018485 15:64369169-64369191 CTAGGCAACATAGCAAGGCCTGG + Intronic
1128043282 15:64594526-64594548 CTGGGCAACATGGTGAAACCCGG - Intronic
1128181063 15:65604536-65604558 CTGGGCAATATGGCAAAACCTGG + Intronic
1128334399 15:66776879-66776901 CTGGGTAACATGGCAAAACCCGG + Intronic
1129013975 15:72449572-72449594 CTGGCCAACATGGCGAAACCCGG - Intergenic
1129077917 15:73013334-73013356 CTGGGCAACATAGCAAGACCTGG + Intergenic
1129081856 15:73048354-73048376 GTAGGCAACAGGGCAAAACCCGG - Intergenic
1129230131 15:74192468-74192490 CTAGGCAGGATGGAGAACCCCGG - Intronic
1129325276 15:74797130-74797152 CTCGGCAACATGGCGAAACCCGG - Intronic
1129346239 15:74921537-74921559 CTGGCCAACATGGCGAAACCCGG + Intronic
1129774488 15:78227027-78227049 CTGGGCAACATGGTGAAACCTGG + Intronic
1130020309 15:80224932-80224954 CTGGCCAACATGGCGAAACCTGG - Intergenic
1130309423 15:82740289-82740311 CTAGGGAACATGGTGAAACCCGG - Intergenic
1130986598 15:88848534-88848556 CTGGGCAACATGGCCAAATCCGG + Intronic
1131147501 15:90023804-90023826 CTAGGCAGCATGGCAAAACCCGG + Intronic
1132109461 15:99091914-99091936 CTAGGCAGCATGGAGATTCCAGG + Intergenic
1132510095 16:336042-336064 CTGGCCAACATGGTAAAACCTGG + Intronic
1132776161 16:1595423-1595445 CTGGCCAGCATGGTGAAACCTGG + Intronic
1132911283 16:2313712-2313734 CTGGACAACATGGCAAAACACGG + Intronic
1132948116 16:2543923-2543945 CTGGCCAACATGGCAAAACCCGG - Intronic
1133154651 16:3864452-3864474 CTGGGCAACATAGCGAAACCCGG + Intronic
1133201291 16:4206271-4206293 GTAGGAAGCATTGCAGAACCAGG - Intronic
1133260218 16:4544413-4544435 CTGGGCAACATGGCAAAACCCGG + Intergenic
1133351832 16:5106455-5106477 CTAGACAATATGGCAAAACCTGG - Intergenic
1133768178 16:8852171-8852193 CTGGGCATCATGGCGAAACATGG - Intergenic
1133795386 16:9042223-9042245 TTGGGCAACATGGTAAAACCTGG + Intergenic
1134103345 16:11468514-11468536 CTGGGCAACATAGCAAGACCCGG - Intronic
1134118584 16:11567792-11567814 CTAGCCAACATGGTGAAACCCGG + Intronic
1134132706 16:11660363-11660385 CTGGGCAATATGGCAAGACCCGG - Intergenic
1134245741 16:12538621-12538643 CTAGGAAGAATGGAAAAACTGGG + Intronic
1134350050 16:13428955-13428977 CTGGTCAACATAGCAAAACCCGG - Intergenic
1134483588 16:14639167-14639189 CTGGGCAACATGGTGAAACCCGG - Intronic
1134488396 16:14677555-14677577 CTGGCCAACATGGTAAAACCCGG - Intronic
1134620165 16:15682335-15682357 CTAGGCAACATGGAGAAACCCGG - Intronic
1134651252 16:15910735-15910757 CTGGGCAACATGGTGAAACCTGG - Intergenic
1134680130 16:16119248-16119270 CTGAGCAACATGGGAAAACCTGG + Intronic
1134700201 16:16258671-16258693 CTGGCCAGCATGGTGAAACCCGG + Intronic
1134971625 16:18535986-18536008 CTGGCCAGCATGGTGAAACCCGG - Intronic
1135126172 16:19811091-19811113 CTGGGGAACATGGCAAAACCTGG + Intronic
1135153810 16:20034551-20034573 CTGGGCAACATAGCAAGACCGGG - Intronic
1135330721 16:21557629-21557651 CTGGGCAACATGGTGAAACCCGG + Intergenic
1135342743 16:21663292-21663314 CTAGCCAACATGGAGAAACCCGG + Intergenic
1135501635 16:23000909-23000931 CTGGCCAACATGGCAAAACCTGG + Intergenic
1135718387 16:24792977-24792999 CTGGGCAACATGGCAAAACCTGG - Intronic
1135729001 16:24878840-24878862 CTAGCCAACATGGCAAAACCCGG + Intronic
1136002921 16:27309720-27309742 CTGGGCAACATAGCAAGACCCGG - Intergenic
1136332387 16:29588837-29588859 CTGGCCAACATGGCGAAACCCGG + Intergenic
1136376715 16:29870152-29870174 CTGGCCAACATGGCAAAACCCGG + Intergenic
1136422984 16:30148307-30148329 TTGAGCAACATGGCAAAACCCGG + Intergenic
1136521051 16:30796041-30796063 CTAGCCAACATGGTGAAACCCGG + Intergenic
1136530167 16:30862783-30862805 TTAGTTAGGATGGCAAAACCAGG - Intronic
1136545433 16:30951680-30951702 CTGGGCAACATAGCAAGACCTGG + Intronic
1137031398 16:35527548-35527570 CTGGGCAATATGGCAAAACCCGG - Intergenic
1137252395 16:46749564-46749586 CTGGGCAACATGGCGAGACCTGG + Intronic
1137254223 16:46761624-46761646 CTGGCCAACATGGCGAAACCCGG + Intronic
1137324451 16:47419974-47419996 CTGGGCAGCAAAGCAAAAGCTGG - Intronic
1137438882 16:48482307-48482329 CTGGCCAACATGGCGAAACCTGG - Intergenic
1138013891 16:53412155-53412177 CTGGGCAACATGGTGAAACCCGG + Intergenic
1138014141 16:53413737-53413759 CTGGGCAACATGGTGAAACCCGG + Intergenic
1138434057 16:56987270-56987292 CTGGGCAACATGGTGAAACCCGG + Intergenic
1138467911 16:57206753-57206775 CTGGGCAACATGGCAAGACCTGG - Intronic
1138468791 16:57214836-57214858 CTGGCCAACATGGCGAAACCTGG + Intronic
1138683521 16:58704833-58704855 CTGGGCAACATAGCAAGACCTGG + Intergenic
1138725466 16:59133705-59133727 CTGGCCAACATGGCAAAACTCGG - Intergenic
1139277803 16:65744072-65744094 GTGGCCAACATGGCAAAACCTGG + Intergenic
1139465418 16:67151396-67151418 GTGGGGAGCATGGCAGAACCAGG - Intergenic
1139726680 16:68905679-68905701 CTGGGCAATGTGGCAAAACCCGG + Intronic
1139869670 16:70096596-70096618 CTAGGCAACATAGCGAGACCCGG + Intergenic
1140244509 16:73235859-73235881 CTGGGCAACATGGTGAAACCTGG - Intergenic
1140352263 16:74273413-74273435 CTGGCCAACATGGCAAAACCTGG - Intergenic
1140385715 16:74535624-74535646 CTAGGCAACATAGCGAGACCCGG - Intronic
1140530220 16:75659449-75659471 CTGGTCAACATGTCAAAACCTGG - Intronic
1140686741 16:77441034-77441056 CTGGGCAACATGGTGAAACCTGG - Intergenic
1141305258 16:82856667-82856689 CTGGGCAACATGGCAAGACTCGG + Intronic
1141353356 16:83319942-83319964 TTAGGCATCATGGAAAAACGAGG + Intronic
1141908062 16:87040750-87040772 CTTGGCAGCGTGGGACAACCGGG + Intergenic
1142381504 16:89734966-89734988 CTGGCCAACATGGTAAAACCTGG + Intronic
1142406849 16:89894833-89894855 CTGGCCAACGTGGCAAAACCTGG - Intronic
1203140436 16_KI270728v1_random:1761661-1761683 TTGGCCAACATGGCAAAACCTGG + Intergenic
1142543167 17:677925-677947 CTGGGCAACACAGCAAAACCCGG + Intronic
1142633875 17:1244510-1244532 CTGGCCAACATGGCAAAACCCGG - Intergenic
1142707638 17:1706573-1706595 CTGGGCAACATGGCAAAACCTGG + Exonic
1142710617 17:1721629-1721651 CTGGGAAACATGGCAAAACCTGG + Intronic
1142717798 17:1756508-1756530 CTGACCAACATGGCAAAACCCGG - Intergenic
1142753838 17:2003878-2003900 CTGGCCAACATGGCGAAACCTGG + Intronic
1142859815 17:2754680-2754702 CTGGGCAACATAGCAAGACCCGG - Intergenic
1142955232 17:3516953-3516975 CTGGCCAACATGGCAAAAGCCGG + Intronic
1143193388 17:5056918-5056940 CTGGGCAACATGGTGAAACCCGG + Intergenic
1143281216 17:5755881-5755903 CTGGCCAAAATGGCAAAACCCGG - Intergenic
1143549849 17:7623648-7623670 CTGGGCAACAGGGCAAAACCCGG - Intronic
1143673681 17:8414709-8414731 CTGGGCAACATAGCAAGACCCGG - Intronic
1144158192 17:12528923-12528945 CTGGGCAACATGGTGAAACCCGG - Intergenic
1144546080 17:16197127-16197149 CTGGCCAGCATGGTGAAACCTGG + Intronic
1144821414 17:18077289-18077311 CTGGGTCACATGGCAAAACCCGG + Intergenic
1144992848 17:19245853-19245875 CTGGCCAACATGGTAAAACCTGG - Intronic
1146120820 17:30192662-30192684 CTGAGCAACATGGCAAAACTCGG + Intergenic
1146181212 17:30699226-30699248 CTGGGCAGCATAGCGAGACCTGG - Intergenic
1146201048 17:30858924-30858946 CTGGGCAACATGGCAAGACCTGG - Intronic
1146206675 17:30910907-30910929 CTGGGCAACATGGTGAAACCTGG + Intronic
1146214136 17:30965157-30965179 CTGGGCAACACGGTAAAACCTGG + Intergenic
1146338384 17:31996016-31996038 CTGGACAGCATGGTGAAACCCGG + Intronic
1146400783 17:32498403-32498425 CCAGGAAGCATGGCAAGGCCAGG - Intronic
1146519604 17:33515903-33515925 CTGGGCAACATGGCAAAACCCGG + Intronic
1146676630 17:34778155-34778177 CTAGGCAACATGGAGAAACCTGG + Intergenic
1146996952 17:37329447-37329469 CTGGCCAACATGGCGAAACCCGG + Intronic
1147206082 17:38838407-38838429 CTGGCCAACATGGCTAAACCCGG + Intronic
1147295825 17:39481498-39481520 CTGTGCAACATGGCAAAACTTGG - Intronic
1147354635 17:39885086-39885108 CTGGGCAACATGGCAAAACCTGG - Intergenic
1147493926 17:40897688-40897710 CTGGCCAACATGGCGAAACCCGG + Intergenic
1147818485 17:43227674-43227696 CTGGCCAACATGGCGAAACCTGG - Intergenic
1147826936 17:43275710-43275732 CTGGCCAACATGGCGAAACCTGG - Intergenic
1147831769 17:43302376-43302398 CTGGCCAACATGGCGAAACCTGG - Intergenic
1147888761 17:43702415-43702437 CTGGGCAACATGGCAAAAGCCGG - Intergenic
1147956050 17:44135408-44135430 CTGGCCACCATGGTAAAACCTGG - Intergenic
1148004713 17:44417407-44417429 CTGGGCAACATGGCAAAACCCGG - Intronic
1148420171 17:47538402-47538424 CTAGCTAACATGGCGAAACCTGG - Intronic
1148538741 17:48462825-48462847 CTGGGAAACATGGCAAAGCCCGG + Intergenic
1148690774 17:49525503-49525525 CTGGCCAACATGGCAAAACCTGG + Intergenic
1148779157 17:50111959-50111981 CCAGGCAGAGAGGCAAAACCTGG - Exonic
1149267420 17:54942295-54942317 CTGGCCAACATGGTAAAACCAGG - Intronic
1149606840 17:57931096-57931118 CTGGGCAACATGGCAAAACAGGG + Intronic
1150041057 17:61862111-61862133 CCAGGCAGTATACCAAAACCTGG - Intronic
1150055923 17:62015992-62016014 CTGGGCAACATGGCAAAAACCGG - Intronic
1150230581 17:63547756-63547778 CTGGGCAGCATAGCTCAACCTGG + Intronic
1150237402 17:63604145-63604167 CTGGCCAACATGGCGAAACCTGG + Intronic
1150238333 17:63611248-63611270 CTGGCCAACATGGCCAAACCTGG - Intergenic
1150355638 17:64482292-64482314 CTGGCCAATATGGCAAAACCTGG - Intronic
1150728107 17:67667787-67667809 CTGGCCAACATGGCAAAACCCGG + Intronic
1150768905 17:68024885-68024907 CTGGGCAACATGGTGAAACCTGG - Intergenic
1150801208 17:68284208-68284230 CTAGCCAACATGGTGAAACCCGG + Intronic
1150932678 17:69602326-69602348 CTAGCCAACATGGTGAAACCTGG - Intergenic
1151104744 17:71599556-71599578 CTGGCCATCATGGCAAAACCTGG + Intergenic
1151274301 17:73022402-73022424 CTGGCCAACATGGCGAAACCTGG + Intronic
1151311100 17:73292906-73292928 CTAGCCAACATGGTGAAACCTGG - Intronic
1151794665 17:76335794-76335816 CTGGGCAACATAGCAAGACCTGG + Intronic
1152027091 17:77817227-77817249 CTAGGCAACATGGAGAAACCTGG - Intergenic
1152182759 17:78834631-78834653 CTGGCCAACATGGCGAAACCCGG - Intronic
1152664635 17:81560225-81560247 CTGGCCAACATGGCGAAACCCGG + Intronic
1152960067 18:74389-74411 TTGGTCAACATGGCAAAACCCGG - Intergenic
1152968265 18:137012-137034 CTGGGCAACATGGTGAAACCCGG + Intergenic
1153283947 18:3440158-3440180 CTGGCCAACATGGCAAAACCCGG + Intronic
1153483577 18:5572762-5572784 CTGGGCAACATAGCAAGACCCGG - Intronic
1153856377 18:9152024-9152046 CTAGGCAACAAAGCAAGACCTGG + Intronic
1154236037 18:12606719-12606741 CTGGCCAACATGGCGAAACCCGG - Intronic
1154240049 18:12645053-12645075 CTGGGGAACCTGGCAAAACCTGG + Intronic
1154305279 18:13226209-13226231 CTGGGCAACATGGCGAAACCCGG - Intronic
1154424309 18:14260335-14260357 CTAGGCAGCATAGCACAAGGGGG + Intergenic
1154426996 18:14279688-14279710 CTAGGCAGCATAGCACAAGGGGG + Intergenic
1154468637 18:14674938-14674960 CTAGCCAACATGGTGAAACCCGG - Intergenic
1154488346 18:14897369-14897391 CTGGCCAACATGGCAAAACCGGG - Intergenic
1154986980 18:21562068-21562090 CTGGCCAACATGGCAAAACCCGG - Intronic
1155048759 18:22128570-22128592 CTGGGCAACATGGCAAAACTTGG - Intergenic
1155176237 18:23303708-23303730 CTGGCCAACATGGCAAAACCTGG + Intronic
1155311438 18:24527991-24528013 CTGGCCAACATGGCAAAAGCTGG - Intergenic
1155359841 18:24988970-24988992 CTGGCCAACATGGCAAAACCTGG + Intergenic
1155470858 18:26190723-26190745 GTAGGCAGCAGAGCAAGACCCGG + Intronic
1155753978 18:29466678-29466700 CTGGCCAGCATGGTGAAACCCGG + Intergenic
1156009041 18:32475106-32475128 CTGGGCAACATAGCAAGACCTGG - Intergenic
1156138619 18:34077113-34077135 CTGGGCAACATGGTGAAACCCGG + Intronic
1156232137 18:35164089-35164111 CTGGGCAGCATTGGACAACCTGG - Intergenic
1156456648 18:37298527-37298549 CTGGGCAACATGGCGAAACATGG + Intronic
1157268235 18:46247860-46247882 CTGGCCAACATGGCAAAACCCGG - Intronic
1157350485 18:46880203-46880225 CTAGGGAAGATGGCAAGACCTGG + Intronic
1157443045 18:47724731-47724753 CTAGGGAGCAGGACAAAAGCTGG - Intergenic
1157551049 18:48582162-48582184 CAAGGAAGCATGGCAAGACTTGG + Intronic
1157687770 18:49656571-49656593 CTGGGCAACATGGCAAGACTTGG + Intergenic
1158141461 18:54260426-54260448 CTGGCCAGCATGGTGAAACCCGG + Intergenic
1158715965 18:59880138-59880160 CTAGGCAACATGGTGAGACCTGG - Intergenic
1158804521 18:60953545-60953567 CTGGGCAGCATAGTAAGACCTGG + Intergenic
1158907162 18:62024795-62024817 CTGGGCAACATAGCAACACCTGG + Intergenic
1159908248 18:74118187-74118209 CTGGGCATCATGGTGAAACCCGG - Intronic
1159946671 18:74448916-74448938 CTGGCCAACATGGCTAAACCTGG + Intronic
1160209983 18:76869763-76869785 CTAGCCAACATGGTGAAACCCGG + Intronic
1160258718 18:77270322-77270344 GTGGGCAACATGGCAAAACTCGG + Exonic
1160468081 18:79099654-79099676 CTGGGCAACATAGCAAGACCTGG - Intronic
1161034314 19:2075930-2075952 CTGGCCAACATGGCAAAACCTGG + Intronic
1161142608 19:2657141-2657163 CTGGGCAACATGGTGAAACCCGG + Intronic
1161406055 19:4091837-4091859 CTGGGCAACATGGAAAAACCCGG - Intronic
1161443036 19:4303326-4303348 CTAGCCAACATGGCAAAACCCGG + Intergenic
1161485676 19:4534559-4534581 CTGGGCAACATGGCGAAACCCGG - Intronic
1161569257 19:5021401-5021423 CTGGGCAGCATGGTGAGACCTGG + Intronic
1161682130 19:5685383-5685405 CTGGCCAACATGGCGAAACCTGG + Intronic
1161718004 19:5887860-5887882 CTGGCCAACATGGCAAAACCCGG - Intronic
1161927987 19:7315619-7315641 CTAGCCAACATGGTGAAACCCGG + Intergenic
1161997873 19:7725206-7725228 CTGGGCAACAGGGCAAGACCGGG + Intergenic
1162116911 19:8436048-8436070 CTGGGCAACATGGCAAAACCCGG - Intronic
1162204691 19:9046984-9047006 CTGGGCAACATGGCAAAACAAGG - Intergenic
1162262456 19:9543970-9543992 TTAGTCAGGATGGCAAAACCAGG - Intergenic
1162273962 19:9638532-9638554 TTAGTTAGGATGGCAAAACCTGG + Intronic
1162286903 19:9745544-9745566 TTAGTTAGGATGGCAAAACCTGG - Intergenic
1162291431 19:9783891-9783913 CTGGACAATATGGCAAAACCCGG - Intronic
1162292124 19:9788047-9788069 CTGGCCAACATGGTAAAACCTGG - Intronic
1162323589 19:9985594-9985616 CTGGGCAACGTGGCAAAACGTGG - Intronic
1162325118 19:9994372-9994394 TTGTGCAACATGGCAAAACCCGG - Intronic
1162506126 19:11086311-11086333 CTGGCCAACATGGCAAAACCCGG - Intergenic
1162574786 19:11492935-11492957 CTGGGCAACATGGCAAAACCCGG - Intronic
1162845839 19:13391844-13391866 CTGGGCAACATGGTGAAACCTGG + Intronic
1162848908 19:13415548-13415570 CTGGCCAACATGGCAAAACCCGG + Intronic
1162879848 19:13650144-13650166 CTGGCCAACATGGTAAAACCAGG - Intergenic
1162977390 19:14216342-14216364 CTGGGCAGCATAGCAAGACCTGG + Intergenic
1163006805 19:14401938-14401960 CTGGGCAACATGGTGAAACCCGG + Intronic
1163076085 19:14893004-14893026 CTGGCCAACATGGCAAAAACCGG + Intergenic
1163088574 19:15001849-15001871 CTGGGCAACATGGTAAACCCTGG - Intronic
1163186093 19:15640770-15640792 CTGGGCAGCTGGCCAAAACCTGG - Intronic
1163190371 19:15672955-15672977 CTGGGCAGCCAGCCAAAACCTGG - Exonic
1163339995 19:16699588-16699610 CTGGGCAACATGGTGAAACCCGG - Intergenic
1163559816 19:18012394-18012416 CTGGCCAACATGGCGAAACCAGG + Intronic
1163581339 19:18140982-18141004 CTGGGCAACATGGTGAAACCTGG - Intronic
1163587369 19:18171393-18171415 CTGGCCAACATGGTAAAACCTGG + Intronic
1163589956 19:18187368-18187390 CTGGGCAACATGGTAAGACCAGG - Intergenic
1164096931 19:22019979-22020001 GTGGGCAACATGGCGAAACCTGG - Intergenic
1164117097 19:22233203-22233225 GTGGGCAACATGGCGAAACCCGG - Intergenic
1164177076 19:22784401-22784423 CTGGCCAACATGGCAAAACCCGG + Intergenic
1164229726 19:23276490-23276512 CTGGGCAACATGGTGAAACCCGG + Intergenic
1164786373 19:30934358-30934380 CTGGGCAACATGGTGAAACCTGG - Intergenic
1165158709 19:33803475-33803497 CTAGGCAGCATTGTAAAAGCTGG + Intronic
1165284528 19:34830496-34830518 CTTGTCAGCATGGCACAATCAGG - Intergenic
1165457573 19:35922630-35922652 CCGGGCAACATGGCGAAACCCGG - Intergenic
1165532598 19:36416880-36416902 CTGGCCAACATGGTAAAACCCGG + Intronic
1165572414 19:36786456-36786478 CCAGGCAACATGGCAGAACGTGG - Intergenic
1165729611 19:38136411-38136433 CTAGACAACATGGTGAAACCCGG + Intronic
1165845340 19:38814684-38814706 CTGGCCAACATGGCAAAACCTGG - Intergenic
1165914521 19:39249438-39249460 CTGGGCAACATGGCGAAACCAGG - Intergenic
1165943983 19:39430414-39430436 CTTGCCAGCATGGCGAAACCTGG - Intergenic
1166084995 19:40468568-40468590 CTGGCCAACATGGCAAAACCCGG - Intronic
1166115338 19:40650121-40650143 CTGGCCAACATGGTAAAACCCGG - Intergenic
1166217318 19:41344172-41344194 CTGGGCAACATGGCGAAACCCGG - Intronic
1166291615 19:41867119-41867141 CAGAGCAACATGGCAAAACCGGG + Intronic
1166535632 19:43572647-43572669 CTAGCCAACATGGCAAAACTCGG + Intronic
1166806015 19:45487749-45487771 CTGGCCAGCATGGTGAAACCCGG + Intronic
1167059963 19:47138232-47138254 CTGGCCAACATGGCGAAACCTGG - Intronic
1167646673 19:50709739-50709761 CTGGGCAACGTGGGAAAACCTGG - Intronic
1167682700 19:50934418-50934440 CTGGGCAACATGGCGAAACACGG - Intergenic
1167896519 19:52586230-52586252 CTAGACAACAAGGCAAAACCCGG - Exonic
1168112091 19:54198669-54198691 CTGGCCAACATGACAAAACCTGG - Intergenic
1168122803 19:54262319-54262341 CTAGGCAGCTTGGCACGACAGGG - Intronic
1168477139 19:56684540-56684562 CTGGGCAACACGGCAAGACCTGG + Intergenic
1168480661 19:56717105-56717127 GTAGGCAGCCTGGCAAATCAAGG - Intergenic
1168675018 19:58271409-58271431 CTGGGCAACATGGCGAGACCTGG + Intronic
1168685901 19:58349458-58349480 CCAGCCAACATAGCAAAACCCGG + Intronic
925952644 2:8929541-8929563 CTGGGCCACATGGCAAAACCCGG - Intronic
926063779 2:9821313-9821335 CTAGCCAACATGGCCAAACCCGG + Intergenic
926157391 2:10464415-10464437 CTGGGCAACATGGCAAAACTCGG - Intergenic
926279001 2:11429840-11429862 CTGGCCAACATGGCAAAACCTGG - Intergenic
927688713 2:25192059-25192081 CTGGCCAACGTGGCAAAACCCGG - Intergenic
927736979 2:25533131-25533153 CTAAGCAACGTGGCGAAACCCGG + Intronic
927813375 2:26193105-26193127 CCAGACAGCATGGTAAAGCCCGG + Intronic
928041693 2:27884435-27884457 CTGGGCAACATGGCAAAACCCGG - Intronic
928056599 2:28062370-28062392 CTGGGCAACATGGTGAAACCCGG + Intronic
928185937 2:29110877-29110899 CTGGCCAACATGGTAAAACCTGG - Intronic
928323880 2:30304622-30304644 CTGGCCAACATGGTAAAACCCGG + Intronic
928684604 2:33735689-33735711 CTGGCCAACATGGCAAAACCCGG + Intergenic
928696946 2:33858890-33858912 CTAGGCATCATGGAACAAGCTGG + Intergenic
929183738 2:39071056-39071078 CTGGCCAACATGGTAAAACCCGG - Intronic
929650140 2:43671175-43671197 CTGGCCAACATGGTAAAACCCGG - Intronic
929673222 2:43896251-43896273 CTGGCCAGCATGGCGAAACCTGG - Intronic
930341459 2:50121211-50121233 CTGGCCAACATGGCGAAACCCGG - Intronic
930560914 2:52958765-52958787 CTGGCCAACATGGCAAAACCTGG + Intergenic
930656360 2:54010857-54010879 CTGGGCAACATGGTGAAACCTGG - Intronic
930785364 2:55266958-55266980 CTGGCCAACATGGTAAAACCCGG - Intronic
931310265 2:61072127-61072149 CTGGGCAACACAGCAAAACCTGG - Intronic
931356408 2:61540567-61540589 CTGGGCAACATGGCAAAACCTGG + Intergenic
931391878 2:61851523-61851545 CTGGCCAACATGGCAAAACCCGG - Intronic
931406719 2:61986757-61986779 CTGGGCAACATGGCAAAACCTGG - Intronic
931588743 2:63857553-63857575 CTCGGCAATATGGCAAAACCCGG - Intronic
932236660 2:70125802-70125824 GTGGGCAACATGGCGAAACCTGG - Intergenic
932277514 2:70462595-70462617 ATAAGCAGAATGGCAACACCGGG - Intronic
932673924 2:73761566-73761588 CTGGGCAACATGGCAAAACCTGG + Intergenic
932981796 2:76677570-76677592 CTTGGCACCCTGGCAAAAGCTGG - Intergenic
933018438 2:77161516-77161538 CTTGGCAGCAGGCAAAAACCTGG + Intronic
933251907 2:80038528-80038550 CTGGGCAACATGGTGAAACCTGG + Intronic
933675191 2:85049487-85049509 CCAGGCAGCACGGCAACAACTGG + Exonic
933741025 2:85533954-85533976 CTGGCCAACATGGCAAAACCCGG + Intergenic
934656513 2:96119218-96119240 GTGGGCAGCAGGGCACAACCTGG + Intergenic
934668437 2:96190829-96190851 CCAGGCAGCATGGAGAGACCCGG - Intronic
934800050 2:97146155-97146177 CTGGCCAACATGGCAAAAGCCGG - Intronic
934846733 2:97665968-97665990 CTGGGCAACATAGCAAAACCCGG - Intergenic
934956739 2:98628860-98628882 CTAAGCAGCAGTGCAAAGCCGGG + Intronic
934959954 2:98664014-98664036 CTGGCCAACATGGCGAAACCCGG + Intronic
935072724 2:99710016-99710038 GTAGGCAGCATGGCCAAGCCAGG - Intronic
936372030 2:111910072-111910094 TTTGGCAACATGGCAAGACCTGG + Intronic
936406207 2:112206597-112206619 CTGGCCAACATGGCAAAACCCGG - Intergenic
936702668 2:115032688-115032710 CTGGCCAACATGGCGAAACCCGG + Intronic
936844956 2:116820061-116820083 CTGGACAGTATGGCAATACCTGG - Intergenic
937105488 2:119308447-119308469 CTGGCCAATATGGCAAAACCCGG + Intronic
937367430 2:121273900-121273922 CTGGCCAACATGGCTAAACCCGG + Intronic
937594766 2:123660087-123660109 TTAGTCAGGATGGCAAAACCAGG + Intergenic
937632392 2:124117891-124117913 CTGGGTAACATGGCAAAATCCGG + Intronic
937933398 2:127222586-127222608 CTGGGCAACATAGCAAGACCTGG + Intergenic
938012285 2:127838449-127838471 CTGGCCAACATGGCAAAACCTGG - Intergenic
938041499 2:128079798-128079820 TTGGCCAACATGGCAAAACCCGG - Intergenic
938713675 2:133998894-133998916 CTGGGCAACATGGCAAAACCCGG - Intergenic
938907647 2:135854034-135854056 CCAGGCAACACGGCAAAACTCGG + Intronic
939153287 2:138497214-138497236 CTGGGCAACATGGTGAAACCCGG + Intergenic
939980430 2:148774434-148774456 CTGGGCAACATGGCAAAACCCGG + Intronic
940459163 2:153940445-153940467 CTGGTCAACATGGCAAAACCCGG - Intronic
941011770 2:160308201-160308223 CTGGGCAACATGGCGAAACCTGG + Intronic
941102516 2:161311803-161311825 CTGGCCAACATGGCGAAACCTGG - Intronic
941109556 2:161403930-161403952 CTAGGCAACAGAGCAAGACCTGG - Intronic
941377324 2:164747664-164747686 CTGGCCAACATGGCAAAACCTGG - Intronic
941487774 2:166103258-166103280 CTGGCCAACATGGCAAAACCTGG + Intronic
941598041 2:167502846-167502868 CTAGCCAACATGGTGAAACCCGG + Intergenic
941759936 2:169231101-169231123 CTGGGCAACATGGCAAAACCCGG + Intronic
941930850 2:170937231-170937253 CTGGGCAACAGAGCAAAACCGGG - Intronic
943032824 2:182705702-182705724 CTTGTCAACCTGGCAAAACCTGG - Intergenic
943225617 2:185170190-185170212 CTAGCCTACATGGCAAAACCTGG - Intergenic
943311858 2:186335108-186335130 TCAGGCAGCAAGGCAAAACTTGG - Intergenic
943640067 2:190347945-190347967 CTGGCCAACATGGCGAAACCTGG + Intronic
943759243 2:191590831-191590853 CTGACCAACATGGCAAAACCTGG - Intergenic
944182855 2:196914428-196914450 CTGGCTAACATGGCAAAACCTGG + Intronic
944234787 2:197432097-197432119 CTGGGCAACAGGGCAAGACCCGG + Intronic
944557941 2:200906424-200906446 CTAGGCAGTGTAGCAAAACCCGG - Intergenic
944588009 2:201189806-201189828 CTGGGCAACATGACAAAACCCGG + Intronic
944607490 2:201365238-201365260 CTGACCAACATGGCAAAACCCGG - Intergenic
944748614 2:202684055-202684077 CAGAGCAACATGGCAAAACCTGG - Intronic
944785795 2:203068918-203068940 CTGGTCAGCATGGTGAAACCCGG - Intronic
945037788 2:205718749-205718771 CTGGCCAACATGGCGAAACCTGG + Intronic
945076879 2:206048421-206048443 CTGGTCAACATGGCAAAACCCGG - Intronic
945301245 2:208218214-208218236 CTTGTTAGGATGGCAAAACCAGG + Intergenic
945592845 2:211755309-211755331 TTGGGCAACATGGCAAAACCCGG + Intronic
945609902 2:211987128-211987150 CTAGCCAACATAGCAAAACCTGG + Intronic
945701242 2:213173347-213173369 CTGGGCAACATGGCAAAACCTGG + Intergenic
946877460 2:224144122-224144144 CCAGGCAAAAGGGCAAAACCCGG - Intergenic
946903235 2:224392562-224392584 CTGGGCAACATGGCAAAACCCGG + Intronic
947090899 2:226510496-226510518 CTGGCCAACATGGCAAAACCCGG + Intergenic
947211246 2:227710503-227710525 CTGGCCAACATGGCAAAACTCGG + Intronic
947229207 2:227868472-227868494 CTAGGCAACAAGGCAAGATCCGG - Intergenic
947306177 2:228749949-228749971 TTGGGCAACATGGCAAGACCGGG + Intergenic
947649220 2:231770625-231770647 CTGGGCAACATGGCAAAATCTGG + Intronic
947678937 2:232011839-232011861 CTGGGCAACATGGCGAAACCCGG - Intronic
947816190 2:233039018-233039040 CTAGGCAACAGAGCAAGACCTGG - Intergenic
947966726 2:234288511-234288533 CTGGCCAACATGGCGAAACCCGG - Intergenic
948054710 2:235002533-235002555 CTGGGCAACATAGCAAAACCTGG + Intronic
948224843 2:236300843-236300865 CTAGCCAACATGGTGAAACCTGG - Intergenic
948227612 2:236323622-236323644 CTGGGAATCCTGGCAAAACCTGG + Intergenic
948426180 2:237887746-237887768 CTGGGCAACATGGCGAAACCAGG + Intronic
948807390 2:240458933-240458955 CTGGGCAGGATGGCAGACCCAGG - Intronic
948997998 2:241593874-241593896 CTGGACAACATAGCAAAACCTGG - Intronic
1168994410 20:2122141-2122163 CTGGGCAACATGGTGAAACCTGG + Intronic
1169069014 20:2710338-2710360 CTGAGCAATATGGCAAAACCCGG - Intronic
1169375825 20:5065996-5066018 CTGAGCAGCATGCCAAAACCGGG - Intergenic
1169627425 20:7587795-7587817 CTGGGCAACATAGCAAAACCTGG - Intergenic
1169736172 20:8839838-8839860 CTGGCCAACATGGCAAAGCCCGG + Intronic
1169743205 20:8917614-8917636 CTGGGCAACATGGAGAAACCTGG - Intronic
1170204106 20:13779723-13779745 CTAGCCAACATGGCAAAACCCGG - Intronic
1171323954 20:24274369-24274391 CTGGGCAACATGGCAAAACATGG + Intergenic
1171773110 20:29341785-29341807 CTGGGCAACATGGCAAAACCTGG + Intergenic
1171884894 20:30644791-30644813 CTAGGCAGCATAGCACAAGGGGG - Intergenic
1171903238 20:30876682-30876704 CTGGGCAACATGGCAAAACCTGG - Intergenic
1172741807 20:37174575-37174597 CTGGCCAACATGGCAAAACCTGG + Intronic
1172858605 20:38028895-38028917 CTGGGCAACATGGCGAAACTCGG - Intronic
1172908339 20:38386495-38386517 CTGGCCAACATGGCAAATCCTGG + Intergenic
1172985236 20:38981750-38981772 CTGGCCAACATGGCAAAACCTGG + Intronic
1173220627 20:41129964-41129986 CTGGCCAACATGGCGAAACCCGG - Intergenic
1173504796 20:43578292-43578314 CTGGCCAACATGGCGAAACCCGG + Intronic
1173506285 20:43589850-43589872 CTAGGCAACATGGCGAAACCCGG - Intergenic
1173696595 20:45021008-45021030 CTGGGCAACATAGCAAGACCTGG - Intronic
1173789917 20:45821754-45821776 CTGGCCAACATGGCGAAACCTGG + Intergenic
1174018885 20:47512964-47512986 CTGGCCAACATGGCAAAACCTGG + Intronic
1174119716 20:48254176-48254198 CTGGCCAACATGGTAAAACCCGG + Intergenic
1174168338 20:48600337-48600359 CTTGGCAGGAGGGAAAAACCAGG - Intergenic
1174326061 20:49779831-49779853 CTAGCCAGCATGGCGAAACCTGG + Intergenic
1174689001 20:52484091-52484113 CTGGCCAACATGGCGAAACCCGG + Intergenic
1174739508 20:52998357-52998379 CTGGCCAACATGGCGAAACCCGG - Intronic
1175355042 20:58358702-58358724 CTGGCCAACATGGCGAAACCTGG + Intronic
1176193145 20:63823302-63823324 GTGGGCAACATGGCAAAACCTGG + Intronic
1176805879 21:13482718-13482740 CTAGCCAACATGGTGAAACCCGG + Intergenic
1176967619 21:15229109-15229131 CTGGCCAACATGGCGAAACCCGG - Intergenic
1177028772 21:15955508-15955530 CTGGCCAACATGGCAAAACCTGG - Intergenic
1177062838 21:16395696-16395718 TTAGTCAGGATGGCAAAATCAGG + Intergenic
1177075215 21:16563560-16563582 CTGGCCAGCATGGCCAAACCCGG - Intergenic
1177100860 21:16895896-16895918 TTTGTCAGGATGGCAAAACCAGG - Intergenic
1177656457 21:24022626-24022648 CTTGGTAACATGGCAAAACCTGG - Intergenic
1178385671 21:32147751-32147773 CTGGGCAGCATGGTGGAACCCGG + Intergenic
1178848378 21:36192572-36192594 CTGGGCAACATGGCAAAAACCGG - Intronic
1178852104 21:36221300-36221322 CTGGCCAACATGACAAAACCTGG + Intronic
1179045379 21:37839826-37839848 CTGGGCAGCAGAGCAAGACCTGG - Intronic
1179324970 21:40333553-40333575 CTGGCCAACGTGGCAAAACCTGG - Intronic
1179449134 21:41456049-41456071 CTGGCCAACATGGCGAAACCCGG + Intronic
1179530439 21:42014938-42014960 CTAGGCAACAGAGCAAGACCAGG - Intergenic
1179558594 21:42196892-42196914 CTGGGCAACATGGCAAAACCTGG + Intergenic
1179612216 21:42559683-42559705 CTGGCCAACATGGCAAAAACCGG + Intronic
1179816087 21:43907217-43907239 CTGGGCAACATGGCAAAACCCGG - Intronic
1179941884 21:44645542-44645564 CTGGCCAGCATGGTGAAACCCGG - Intronic
1180234150 21:46447061-46447083 CTAACCAACATGGCAAAACCCGG + Intergenic
1180336637 22:11582654-11582676 CTGGGCAACATGGCAAAACCTGG - Intergenic
1180363656 22:11921151-11921173 CTAGGCAGCATAGCACAAGGGGG + Intergenic
1180637776 22:17274657-17274679 CTGGCCAGCATGGCGAAACATGG - Intergenic
1181263878 22:21618780-21618802 CTGGGCAACATAGCAAGACCTGG - Intronic
1181480990 22:23198927-23198949 CTGGCCAACATGGCGAAACCCGG + Intronic
1181563024 22:23716754-23716776 CTGGGCAGCAGGGCCAAACCCGG + Intergenic
1181683228 22:24510567-24510589 CTGGGCTTCATGGCAAAACAAGG - Intronic
1181818011 22:25453911-25453933 CTAAGCAGCATGGATAGACCTGG - Intergenic
1181866261 22:25857841-25857863 CTGGCCAACATGGCGAAACCAGG - Intronic
1182098768 22:27643272-27643294 CTGGGCAACATGGTGAAACCTGG + Intergenic
1182244842 22:28948354-28948376 CTAGGCAGCAAAGCAAGACTCGG - Intronic
1182271291 22:29155342-29155364 CTGGGCAACATGGCAAAACCCGG + Intronic
1182464561 22:30506328-30506350 CTGGTCAGCATAGCAAAACCCGG - Intergenic
1182504064 22:30769456-30769478 CTGGCCAACATGGCAAAACCCGG + Intronic
1182786107 22:32909090-32909112 CTAGGCGGCATGCTAAACCCTGG + Intronic
1183366997 22:37412152-37412174 CTGGTCAACATGGCGAAACCTGG + Intronic
1183405957 22:37630756-37630778 CTGGGCAACATGGCGAAACCCGG - Intronic
1183554824 22:38517010-38517032 CTGGGCAACATGGTGAAACCTGG - Intergenic
1183636588 22:39067260-39067282 TTAGCCAGGATGGCAAAACCAGG + Intronic
1183907704 22:41054746-41054768 CTGGGCAACATGGGGAAACCCGG - Intergenic
1184072430 22:42154376-42154398 CTGGCCAACATGGCAAAAACCGG - Intergenic
1184107442 22:42376347-42376369 CTGGGCAACACGGCAAAACCCGG + Intergenic
1184462515 22:44647268-44647290 CTAGTCAACATGGTGAAACCCGG - Intergenic
1184484817 22:44770594-44770616 CTGGGCATCATGGTAAAACCTGG - Intronic
1184638907 22:45858466-45858488 CTGGGCAACAGAGCAAAACCTGG - Intergenic
1185299841 22:50073538-50073560 CTGGCCAACATGGCAAAACCCGG + Intronic
949271524 3:2223315-2223337 CTAGGAAGCATGGGAAAAGCAGG - Intronic
949470488 3:4390771-4390793 CTAGGCAACATGACAAAACCTGG - Intronic
949540625 3:5029286-5029308 CTGGGCAACACAGCAAAACCTGG - Intergenic
950067891 3:10127878-10127900 CTGGCCAACATGGCGAAACCCGG + Intergenic
950244367 3:11402239-11402261 CTAGCCAACATGGTGAAACCCGG + Intronic
950276752 3:11668043-11668065 CTGGGCAACATGGTGAAACCCGG - Intronic
950390002 3:12689098-12689120 CTGGGCAACACGGCGAAACCTGG - Intergenic
950502297 3:13372240-13372262 CAAGGCAGCCAGGCAAAGCCTGG + Intronic
950772403 3:15322946-15322968 CTGACCAACATGGCAAAACCCGG + Intronic
950894086 3:16432325-16432347 CTAGGCAACATGGCGAAACCCGG + Intronic
950904095 3:16521817-16521839 CAAGGCTGCCTGCCAAAACCGGG - Intergenic
951121052 3:18929660-18929682 CTAGTCAGCATGGCAACAGGAGG - Intergenic
951874459 3:27406737-27406759 CTGGGCAACATGGCAAAAGCTGG + Intronic
951878808 3:27460222-27460244 CTAGCCAACATGGAGAAACCTGG - Intronic
951916244 3:27803796-27803818 CTGGGCAACATGGTGAAACCTGG - Intergenic
952320580 3:32274117-32274139 CTGGGCAACATGGCAAGACCCGG + Intronic
952335301 3:32398791-32398813 CTGGGCAACATGGTGAAACCCGG + Intronic
952366719 3:32681422-32681444 CTGGGAAAAATGGCAAAACCCGG + Intergenic
952860075 3:37805861-37805883 CTGGCCAACATGGCAAAACCTGG - Intronic
953058278 3:39405603-39405625 CTGGCCAACATGGCGAAACCCGG - Intergenic
953166836 3:40472538-40472560 CTGGTCAACATGGCAAAACCCGG + Intergenic
953235039 3:41098841-41098863 GTGGGCAACATGGCGAAACCTGG + Intergenic
953369445 3:42374999-42375021 CTGGGCAACATGGTGAAACCTGG - Intergenic
953640305 3:44700951-44700973 CTAGGCAAAATGGCAAGACCTGG + Intergenic
953830789 3:46296076-46296098 CTAGCCAACATGGGGAAACCCGG + Intergenic
953834252 3:46329484-46329506 TTAGTCAGGATGGCAAAACCAGG + Intergenic
953895532 3:46796561-46796583 CTGAGCAACATGGCTAAACCCGG + Intronic
953968687 3:47330488-47330510 CTGGGCAACATGGTGAAACCCGG - Intronic
954023022 3:47759201-47759223 CTGGACAACATGGCAAAAGCTGG - Intronic
954394147 3:50284013-50284035 CTGGCCAACATGGCAAAACCTGG + Intronic
954394259 3:50284843-50284865 CTAGCCAGCATGGTGAAACCTGG + Intronic
955207845 3:56912945-56912967 CTGGGCAACATTGCAATACCTGG + Intronic
955295412 3:57730275-57730297 CTGGCCAACATGGCAAAACCCGG - Intergenic
955523281 3:59795700-59795722 CTGGGCAACAGAGCAAAACCCGG + Intronic
955704620 3:61715407-61715429 CTGGGCAACATGGCGAAACCTGG - Intronic
956486837 3:69731968-69731990 CTGGGTAACATGGTAAAACCTGG - Intergenic
956496749 3:69835206-69835228 CTCGGCAACGTGGCAACACCCGG - Intronic
956628697 3:71292523-71292545 CTGGTCAACATGGCGAAACCTGG - Intronic
956662537 3:71613455-71613477 CTGGCCAACGTGGCAAAACCAGG + Intergenic
957055849 3:75442382-75442404 CTAGACAACATGGCAATACCTGG - Intergenic
957823647 3:85412016-85412038 CTGGCCAACATGGCTAAACCTGG - Intronic
958168610 3:89910229-89910251 CTGGGCAACATGACAAAACCAGG + Intergenic
958514764 3:95100042-95100064 CTGGCCAACATGGTAAAACCCGG - Intergenic
958683215 3:97357390-97357412 CTAGTCAACATGGTGAAACCCGG - Intronic
958791147 3:98652614-98652636 CTGGGCAACATGGTGAAACCCGG + Intergenic
959447712 3:106460533-106460555 CTGGCCAACATGGCAAAACCTGG + Intergenic
960105074 3:113786968-113786990 CTAGGCAACATAGTCAAACCCGG - Intronic
960387637 3:117039003-117039025 CTGGCCAACATGGCAAAACCTGG + Intronic
960578815 3:119255972-119255994 CTGGCCAACATGGCAAAACCCGG + Intergenic
960906651 3:122608404-122608426 CTGGCCAACATGGCAAAACCCGG - Intronic
960964651 3:123096377-123096399 CGGGGCAACATGGCAAAACCTGG - Intronic
961113816 3:124311267-124311289 CTGGCCAACACGGCAAAACCTGG + Intronic
961298537 3:125906220-125906242 CTAGACAATATGGCAAAACCTGG + Intergenic
961681426 3:128602770-128602792 TTAGGCAGCATGGCCAAAGTTGG - Intergenic
961687501 3:128644451-128644473 CTGGGTGACATGGCAAAACCCGG + Intronic
961740628 3:129031236-129031258 CCTGGCAACATGGCAAAAGCTGG + Intronic
961813350 3:129534500-129534522 CTAGGCATCAAGGCCAGACCAGG + Exonic
962102561 3:132357841-132357863 CTGGGCAACATGGTGAAACCTGG + Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962528203 3:136254722-136254744 CTGGACAACATGGCAAAACCTGG - Intronic
963222874 3:142830308-142830330 GTAGCCAACATGGCAAACCCAGG - Intronic
963628117 3:147698780-147698802 CTGGCCAAAATGGCAAAACCTGG - Intergenic
963678517 3:148345401-148345423 CAAGGCAGAATGGCAAAATAGGG - Intergenic
963758080 3:149256882-149256904 CTGGGCAACATGGTGAAACCCGG + Intergenic
963868058 3:150384391-150384413 CTGGGCAACATGGGAAAACCCGG + Intergenic
963885527 3:150577609-150577631 CTGGGCAACATGGCAAAACTCGG - Intronic
963888449 3:150606331-150606353 CTGGGCAACAAGGCAAGACCAGG - Intronic
964868826 3:161290899-161290921 CTGGGAAGCATAGCAAGACCTGG + Intergenic
964940749 3:162156279-162156301 TTTGTCAGGATGGCAAAACCAGG + Intergenic
964974486 3:162602536-162602558 CTGGCCAACATGGCAAAACCTGG + Intergenic
965572327 3:170184605-170184627 CTGGCCAGCATGGTAAAACCCGG + Intergenic
965730823 3:171770689-171770711 CTGGGCAACATGGCAAAACCTGG + Intronic
966166863 3:177029427-177029449 CTGGGCAACATGGCAAAACCCGG + Intronic
967031875 3:185615532-185615554 CTAGCCAACATGGTGAAACCCGG - Intronic
968020007 3:195377333-195377355 CTGGGCAACATGGCGAAACTCGG - Intronic
968168575 3:196489515-196489537 CTGGCCAACATGGCAAAAACCGG - Intronic
968507592 4:978393-978415 CTGGCCAACATGGCTAAACCCGG + Intronic
968543717 4:1184157-1184179 CTGGGCAACATGGTGAAACCTGG - Intronic
968642843 4:1722904-1722926 CTAGGCAGCGGGACAAGACCAGG - Intronic
968768960 4:2491424-2491446 CTGGCCAACATGGCAAAAACTGG - Intronic
968998649 4:3962695-3962717 CTAGACAACATGGCAAAACCTGG - Intergenic
969124248 4:4934873-4934895 CTGGCCAACATGGCGAAACCCGG - Intergenic
969182595 4:5453711-5453733 CTGGCCAACATGGTAAAACCCGG + Intronic
969755340 4:9145942-9145964 CTAGACAACATGGGAAAACCTGG + Intergenic
969815243 4:9682141-9682163 CTAGACAACATGGCAAAACCTGG + Intergenic
970212034 4:13720043-13720065 CTAGGCAAAGTGGCGAAACCTGG - Intergenic
970902668 4:21177637-21177659 CTGGCCAACATGACAAAACCCGG + Intronic
971494117 4:27246195-27246217 CTAAGCAACATGATAAAACCCGG - Intergenic
972307967 4:37850608-37850630 CTGGCCAACACGGCAAAACCCGG + Intronic
972420915 4:38885465-38885487 CTGGGCAACATGGCAAGATCTGG - Intronic
972484581 4:39528895-39528917 CTGGTCAACATAGCAAAACCCGG - Intergenic
973189825 4:47374194-47374216 CTGGGCAACATGGTGAAACCTGG + Intronic
973312058 4:48720303-48720325 CTGGCCAACATGACAAAACCCGG + Intronic
973368540 4:49227073-49227095 CTAGGCAGCATAGCACAAGGGGG - Intergenic
973392509 4:49568353-49568375 CTAGGCAGCATAGCACAAGGGGG + Intergenic
973880772 4:55269171-55269193 CTGGCCAACATGGCGAAACCGGG + Intergenic
973882652 4:55289467-55289489 CTGGCCAACATGGCAAAACCTGG - Intergenic
974040686 4:56854775-56854797 CTGGCCAACATGGCAAAAACAGG + Intergenic
974048558 4:56918299-56918321 CTGGGCAACATGGCAAAACCTGG + Intronic
974071019 4:57123738-57123760 CTGGGCAACATGCCAAAAACAGG - Intergenic
974862539 4:67540476-67540498 CTAGCCAACATGGTGAAACCTGG + Intronic
975581142 4:75907861-75907883 CTGGCCAACATGGCAAAACCCGG + Intergenic
976182638 4:82413453-82413475 CTGGGCGACATGGCAAAATCCGG - Intergenic
976191193 4:82488807-82488829 CTGGGCAAGATAGCAAAACCTGG - Intronic
976235773 4:82895278-82895300 CTGGCCAACATGGCAAAACATGG + Intronic
976686510 4:87820503-87820525 CTGGCCAACATGGCAAAACTTGG - Intergenic
977224333 4:94376600-94376622 CTGGGCAACATGGTATAACCTGG + Intergenic
977268016 4:94879408-94879430 CTAGGCAACATGGCTAGACCTGG + Intronic
977382467 4:96293710-96293732 GTAGACAGCATGGCAAACCGGGG - Intergenic
977596255 4:98884511-98884533 CTGGCCAACGTGGCAAAACCTGG + Intronic
977807728 4:101322598-101322620 CTGGCCAGCATGGTGAAACCCGG - Intronic
978502122 4:109420691-109420713 CTGGCCAACATGGCAAAACCCGG - Intergenic
978584024 4:110258872-110258894 CTGGCCAACGTGGCAAAACCCGG - Intergenic
979257126 4:118617618-118617640 CTGGGCAACATAGCAAGACCTGG - Intergenic
979331221 4:119422924-119422946 CTGGGCAACATAGCAAGACCTGG + Intergenic
979674259 4:123394404-123394426 CTGGCCAACATGGCGAAACCTGG - Intergenic
979750068 4:124268475-124268497 AAAGGCAGAATGGCAAAATCAGG - Intergenic
980114612 4:128667127-128667149 CTGGCCAACATGGCAAGACCTGG + Intergenic
980484760 4:133441204-133441226 CTGGGCAACATGGTGAAACCCGG - Intergenic
980714637 4:136613996-136614018 TTAGTTAGGATGGCAAAACCTGG - Intergenic
980762394 4:137253074-137253096 CTGGCCAGCATGGTGAAACCCGG + Intergenic
981040786 4:140219541-140219563 CTGGGGAACATGGCAAGACCAGG + Intergenic
981046800 4:140272243-140272265 CTAGGCAACATAGTAAGACCTGG - Intronic
981992569 4:150940211-150940233 CTGGGCAACATAGCAAGACCTGG + Intronic
982438622 4:155406939-155406961 CAAGGCAGCATAGCAATATCAGG + Intergenic
982766744 4:159357334-159357356 CTAGGTAGCAGAGCAAGACCCGG + Intronic
983144723 4:164199449-164199471 CTGGCCAACATGGTAAAACCTGG + Intronic
983228781 4:165109553-165109575 CTGGCCAACATGGCGAAACCCGG - Intronic
983244830 4:165275928-165275950 CTGGCCAACATGGTAAAACCAGG + Intronic
983335398 4:166385211-166385233 CTGGCCAACATGGCAAAACGTGG + Intergenic
983745316 4:171191109-171191131 CTGGGCAACATGACAAAATCAGG + Intergenic
983794910 4:171850160-171850182 CTGGCCAGCATGGTGAAACCTGG - Intronic
983878548 4:172905927-172905949 ATATGCAGGATGGCAAAACAGGG + Intronic
984248752 4:177306804-177306826 CTAGCCAACATGGCAAAACCTGG + Intergenic
984370880 4:178863180-178863202 CTGGGCAACATGGCAAAATCTGG - Intergenic
984671091 4:182488501-182488523 CTGGAGAGCATGGCCAAACCTGG + Intronic
984711771 4:182891284-182891306 CTAGCCAGTATGGCAAAAGTAGG - Exonic
984740768 4:183159593-183159615 CTAGGCAACATGACAAAAACTGG - Intronic
984965883 4:185139252-185139274 CTGGGCAACATAGCAAAACCAGG + Intergenic
985250777 4:188022446-188022468 CTGTCCAACATGGCAAAACCTGG - Intergenic
985285425 4:188332082-188332104 CTTGGCAGCAAGGCAAAACTTGG + Intergenic
1202765647 4_GL000008v2_random:146586-146608 CTAGGCAGCATAGCACAAGGGGG - Intergenic
986204820 5:5613664-5613686 CTAGGAAGCATGGCTACACTGGG + Intergenic
986701013 5:10408727-10408749 ACAGGCAACATGGTAAAACCCGG - Intronic
986747686 5:10758994-10759016 CTGGCCAACATGGCAAAATCCGG + Intronic
987135707 5:14897628-14897650 CTGGGCAACATGGCGAAACCTGG + Intergenic
987310965 5:16680801-16680823 CTGGCCCACATGGCAAAACCTGG + Intronic
987384199 5:17313663-17313685 CTGGCCAACATGGCGAAACCTGG + Intergenic
987676201 5:21075728-21075750 CTGGCCAACATGGCGAAACCTGG + Intergenic
987727876 5:21726196-21726218 CTGGGCAACATGGCAAAACTCGG - Intergenic
987750625 5:22034223-22034245 CTGGCCAACATGGCAAAACCTGG - Intronic
987891208 5:23880876-23880898 CTGGCCAACGTGGCAAAACCTGG - Intergenic
988000977 5:25347839-25347861 CTGGCCAACATGGCGAAACCCGG - Intergenic
988573928 5:32400670-32400692 CGGGGGAACATGGCAAAACCTGG + Intronic
988831382 5:34990650-34990672 CTGGGCAACATGGTGAAACCCGG - Intergenic
989050133 5:37311827-37311849 CTGGCCAACATGGCGAAACCCGG + Intronic
989248956 5:39285331-39285353 CTAGACAGTATGGCACAACGTGG - Intronic
989580091 5:43024366-43024388 CTGGGCAACATGGCGAAACACGG - Intergenic
989688692 5:44116700-44116722 TTAGTCAGGATGGCAAAAACAGG + Intergenic
989780319 5:45256763-45256785 CAGGGCAGCATGTCAAGACCTGG - Intergenic
990002797 5:50914304-50914326 CTGGGCAACATGGTGAAACCTGG - Intergenic
990426490 5:55694941-55694963 TTGGCCAACATGGCAAAACCTGG - Intronic
990472977 5:56134385-56134407 CTGGCCAACATGGCGAAACCTGG + Intronic
990581092 5:57168241-57168263 CTGGCCAACATGGTAAAACCCGG + Intergenic
990664984 5:58062111-58062133 CTGGCCAGCATGGTGAAACCCGG + Intergenic
990751784 5:59024090-59024112 CTGGCCAACATGGCAAAACCTGG - Intronic
990965101 5:61437530-61437552 CTGCGCAACATGGCAAAACCTGG + Intronic
991365942 5:65868097-65868119 CTGGGCAACATGGAGAAACCCGG + Intronic
991498162 5:67248591-67248613 CTGGGCAACATAGCAAGACCCGG - Intergenic
991552899 5:67861674-67861696 CTGGCCAGTATGGCAAAACCCGG - Intergenic
991708623 5:69384504-69384526 CTGGGCAACATGGTGAAACCCGG - Intronic
991905010 5:71500907-71500929 CTGGGCAACATGGCAAGATCTGG + Intronic
991914469 5:71592188-71592210 CTGGCCAACATGGCGAAACCCGG + Intronic
992120966 5:73591790-73591812 CTAGGCAACATAGCGAGACCTGG - Intergenic
992877461 5:81070776-81070798 CTAGGAAGGATGCCAAAACCAGG + Intronic
993483355 5:88451698-88451720 CTGGGCAACATGGAAACACCTGG + Intergenic
993980955 5:94543251-94543273 CTGGCCAACATGGCAAAACCTGG + Intronic
994816149 5:104591070-104591092 CTGGGCACCATGAAAAAACCAGG - Intergenic
994992032 5:107009181-107009203 CTAGCCAACATGGTGAAACCCGG - Intergenic
995083879 5:108085742-108085764 CTGGGCAACATGGCAAAACCCGG + Intronic
995301631 5:110591265-110591287 CTGGGCAACATGGCAAAACCTGG + Intronic
995721509 5:115139311-115139333 CTGGCCAACATGGTAAAACCCGG - Intronic
995757601 5:115526049-115526071 CTGGGCAACATAGCAAGACCTGG - Intronic
995791782 5:115896586-115896608 CTGGGCAACATGGCAAAACCTGG + Intronic
996052400 5:118948874-118948896 TTAGTCAGGATGGCAAAACCAGG + Intronic
996732198 5:126727138-126727160 CTGACCAACATGGCAAAACCTGG - Intergenic
997157536 5:131575591-131575613 TTAGTTAGGATGGCAAAACCTGG - Intronic
997180558 5:131824322-131824344 CTAGGCAGCATAGTGAGACCTGG + Intronic
997281732 5:132652828-132652850 CTGGGCAACATGGTGAAACCTGG + Intergenic
997369887 5:133352598-133352620 CTGGGCAACATGGTAAAATCTGG - Intronic
997459109 5:134040238-134040260 CTGGCCAACATGGCGAAACCCGG + Intergenic
997489340 5:134260096-134260118 CTGGGCAACATGGTGAAACCCGG - Intergenic
997535618 5:134618805-134618827 CTGGCCAACATGGCGAAACCTGG + Intronic
997976086 5:138442020-138442042 GCAGGCAGCATGGCAGAAGCGGG - Intronic
998024720 5:138805639-138805661 CTGGGCAACATAGCAAGACCTGG - Intronic
998088847 5:139349437-139349459 CTGGCCAACATGGCGAAACCCGG - Intronic
998447431 5:142209499-142209521 CTAGGCAAAATGGACAAACCTGG - Intergenic
998603343 5:143607563-143607585 CTAGTCCTCATGGCAGAACCTGG + Intergenic
998792854 5:145784089-145784111 CTGGCCAACATGGCAAAACCTGG + Intronic
998798213 5:145841089-145841111 CTAGGCAACATGGTGAAACCTGG + Intergenic
998798543 5:145844288-145844310 CTAGGCAACATGGTGAAACCCGG + Intergenic
998967792 5:147559512-147559534 TCGGGCAACATGGCAAAACCTGG + Intergenic
999207661 5:149861456-149861478 CTGGGCAACATAGCAAGACCTGG + Intronic
999210364 5:149882865-149882887 CTAGGCAACATGGCAAAACCCGG + Intronic
999217794 5:149950139-149950161 CTGGCCAACATGGCGAAACCCGG + Intergenic
999307669 5:150530748-150530770 CTGGGCAATATGGCAAAACCTGG - Intronic
999531504 5:152468035-152468057 CTGGGCAATGTGGCAAAACCCGG + Intergenic
1000086645 5:157893506-157893528 CTGGGCAACGTGGCGAAACCCGG + Intergenic
1000093494 5:157950585-157950607 CTGGCCAACATGGCAAAACCTGG + Intergenic
1001393279 5:171397981-171398003 CTGGCCAACATGGCGAAACCCGG - Intronic
1001480723 5:172087463-172087485 CTGGCCAACATGGCAAAACCTGG - Intronic
1001861593 5:175060405-175060427 CTAGGGAGGATGGCAAGTCCAGG + Intergenic
1001923407 5:175618042-175618064 CTGGGCAACATGGTGAAACCCGG + Intergenic
1001935946 5:175705872-175705894 CTGGGCAACATGGCAAAACCTGG - Intergenic
1001973518 5:175977538-175977560 CTGGGCAACAGGGTAAAACCCGG + Intronic
1002030886 5:176429247-176429269 CTGGGCAACATGGTGAAACCCGG + Intergenic
1002035666 5:176467520-176467542 CTGGCCAACATGGCAAAACCCGG - Intronic
1002243915 5:177866242-177866264 CTGGGCAACAGGGTAAAACCCGG - Intergenic
1002386407 5:178870468-178870490 CTGGCCAACATGGCAAAACGCGG - Intronic
1002694957 5:181081039-181081061 CTTGCCAACATGGTAAAACCTGG - Intergenic
1002808008 6:596555-596577 CTGGGCAATATAGCAAAACCTGG - Intronic
1002902138 6:1418144-1418166 CTGGCCAACATGGCAAAACCCGG - Intergenic
1003099976 6:3169595-3169617 TTTGGTAGGATGGCAAAACCAGG - Intergenic
1003555235 6:7133442-7133464 CCAGGCACCATGGCACACCCGGG + Intronic
1003615936 6:7655328-7655350 TTAGGAAGCAAGGCAAAGCCAGG - Intergenic
1003912389 6:10754080-10754102 CTGGGCAACATGGTGAAACCCGG + Intronic
1003929286 6:10908076-10908098 CTGGCCAACATGGCTAAACCTGG - Intronic
1004297879 6:14430706-14430728 CTGACCAACATGGCAAAACCCGG + Intergenic
1004324605 6:14663404-14663426 CTGACCAACATGGCAAAACCCGG + Intergenic
1004327731 6:14691172-14691194 CTGGTGAACATGGCAAAACCCGG - Intergenic
1004339019 6:14791103-14791125 CTAGGCAGGATCCCAAAACCGGG + Intergenic
1004400250 6:15282131-15282153 CTGGGCAACATGGTGAAACCTGG - Intronic
1005449077 6:25955493-25955515 GTAGGCAACATGGCGAAACCCGG + Intergenic
1005616151 6:27575179-27575201 CTGGCCAACATGGCGAAACCCGG - Intergenic
1005627485 6:27677059-27677081 CTGGCCAACATGGCAAAACCTGG - Intergenic
1005741179 6:28792170-28792192 CTGGCCAACATGGCGAAACCCGG + Intergenic
1005887562 6:30108366-30108388 CTGGCCAACATGGTAAAACCTGG + Intronic
1006452134 6:34111497-34111519 CTGGGCAGGATGGCAAGATCAGG - Intronic
1006522321 6:34578264-34578286 CTGGCCAACATGGCAAAACGCGG + Intergenic
1006555552 6:34863095-34863117 CTGGGCAACATGGCAAAACCTGG - Intronic
1007652325 6:43430912-43430934 CTGGCCAACATGGTAAAACCCGG - Intronic
1007756872 6:44105300-44105322 GTTGGCAGCATGCCAAGACCAGG + Intergenic
1008025923 6:46635751-46635773 CTGGGCAACATAGCAAGACCTGG - Intronic
1008133336 6:47743001-47743023 CTACCCAACATGGCGAAACCCGG + Intergenic
1008520404 6:52357545-52357567 CTAGGCAACATCGTGAAACCTGG + Intergenic
1009246449 6:61244352-61244374 CTGGCCAACATGGCAAAACCCGG + Intergenic
1009767511 6:68100207-68100229 CTGGGCAACATGGCGAAACCCGG + Intergenic
1010174996 6:73017794-73017816 CTCAGCATCATGGGAAAACCTGG + Intronic
1010209136 6:73348996-73349018 CTAGCCAACATGGCAAAACCCGG + Intergenic
1011040674 6:83026872-83026894 CTAGGCAACATAGTGAAACCTGG - Intronic
1011221728 6:85061780-85061802 CTGGCCAACATGGCGAAACCCGG + Intergenic
1012033482 6:94102145-94102167 TTGGCCAACATGGCAAAACCTGG + Intergenic
1012281581 6:97333748-97333770 CCAGGCAACATGGTGAAACCCGG - Intergenic
1012485229 6:99713783-99713805 CTGGGCAACATGACAAAACCTGG - Intergenic
1012541615 6:100367958-100367980 CTGGGCAACATTGCAAAACCTGG + Intergenic
1012707715 6:102553425-102553447 CTAGATACCATGGCAACACCTGG - Intergenic
1013339924 6:109203936-109203958 CTAGGCAACCTGGCAACAACAGG + Intergenic
1015148041 6:130009167-130009189 CTGGGCAACATGGTGAAACCCGG - Intergenic
1015173807 6:130284041-130284063 CTGGCCAACATGGTAAAACCGGG - Intronic
1015274238 6:131367784-131367806 CTGACCAACATGGCAAAACCCGG + Intergenic
1015348559 6:132189358-132189380 CTGGTCAACATGGTAAAACCTGG + Intergenic
1016122416 6:140360147-140360169 CTGGGCAACATGGCAAAATCCGG - Intergenic
1016442735 6:144100911-144100933 CTGGTCCACATGGCAAAACCTGG - Intergenic
1017197865 6:151721668-151721690 CTAGGCAGCATGCCCAAAGCTGG + Intronic
1017401869 6:154073810-154073832 CTGGCCAGCATGGCAAAAACTGG + Intronic
1017409743 6:154155604-154155626 CTGGGCAACATGGTAAACCCCGG + Intronic
1017789698 6:157786237-157786259 CTGGGCAACATAGCAAAACCCGG - Intronic
1018151447 6:160943798-160943820 CTGAGCAACATGGCAAAACTTGG - Intergenic
1018309171 6:162490941-162490963 CTGGCCAACATGGCAAAACCTGG + Intronic
1018993151 6:168689933-168689955 CTGGCCAACATGGTAAAACCCGG - Intergenic
1019368682 7:648971-648993 CTAGCCAACCTGGTAAAACCTGG + Intronic
1019980004 7:4614428-4614450 CTGGGCAACATGGTGAAACCTGG - Intergenic
1020051194 7:5082850-5082872 CTCACCAGCATGGCAAATCCAGG - Intergenic
1020065759 7:5187364-5187386 CTAGGCAACATGGGGAAACCCGG - Intergenic
1020134927 7:5581845-5581867 CTGGGCAACATGGTGAAACCTGG + Intergenic
1020384260 7:7580875-7580897 CCAGCCAACATGGCAAAACCCGG - Intronic
1020436919 7:8174601-8174623 TTGGGCAACGTGGCAAAACCGGG + Intronic
1020580965 7:10000917-10000939 TTAGACACCATGGCAGAACCTGG + Intergenic
1021500077 7:21322967-21322989 CTGGGCAACATGGCAACACTCGG + Intergenic
1021538471 7:21730951-21730973 CTGGCCAACATGGCGAAACCCGG + Intronic
1021688898 7:23213506-23213528 CTGGCCAACATGGCAAAACTCGG - Intergenic
1021724276 7:23534371-23534393 CTGGGCAACATGGCAAAACCTGG - Intergenic
1022115320 7:27255836-27255858 CTGGGCAACATGGCAAAACCTGG - Intergenic
1023158936 7:37279007-37279029 CTGGGCAACATGGTGAAACCCGG + Intronic
1023631330 7:42167015-42167037 CTGGCCAACATGGCGAAACCCGG - Intronic
1023796722 7:43799662-43799684 CTGGGCAACATGGCAAAACCTGG - Intronic
1024072048 7:45794697-45794719 CTGGGCAACATAGCAAGACCTGG - Intergenic
1024182886 7:46915436-46915458 CTAGGAAACATTGCAAAACCCGG - Intergenic
1024651343 7:51405810-51405832 CTGGGCAACATAGCAAGACCTGG + Intergenic
1024739016 7:52335626-52335648 TTAGTCAGGATGGTAAAACCAGG + Intergenic
1024822411 7:53348474-53348496 CTTGAGAGCTTGGCAAAACCTGG + Intergenic
1024868046 7:53926353-53926375 CTAGGCAACGTGGCAAGACCTGG + Intergenic
1024880924 7:54084358-54084380 CTGGGCAACATGGTGAAACCCGG - Intergenic
1025133549 7:56391618-56391640 CTGGGCAACATAGCAAGACCTGG + Intergenic
1025139267 7:56448946-56448968 CTGACCAACATGGCAAAACCCGG + Intergenic
1025827787 7:65024562-65024584 CTGGCCAACATGGCAAAACCTGG + Intergenic
1025915319 7:65861015-65861037 CTGGCCAACATGGCAAAACCTGG + Intergenic
1025971329 7:66328733-66328755 CTGGTCAACATGGCGAAACCTGG - Intronic
1025982496 7:66418363-66418385 CTGGCCGACATGGCAAAACCCGG - Intronic
1026044663 7:66898697-66898719 CTGGGCAACATAGCAAGACCCGG - Intergenic
1026109790 7:67449904-67449926 TTGGGCAACATGGCAAAACCTGG - Intergenic
1026350694 7:69512740-69512762 CTGGTCAACATGGCAAAACCTGG + Intergenic
1026351591 7:69520565-69520587 CTAGGCAACATAGTAAGACCAGG - Intergenic
1026354420 7:69544895-69544917 CTGGCCAACATGGCAAAACCTGG - Intergenic
1026598643 7:71754769-71754791 CTTGGCAACATGGTGAAACCCGG - Intergenic
1026871873 7:73857695-73857717 CTGGGCAGCATGATGAAACCTGG - Intergenic
1026927636 7:74204976-74204998 CTGGCCAACATGGCAAGACCCGG - Intronic
1027163452 7:75818583-75818605 CTGGGCAACATGGCAAGACCCGG + Intronic
1027222749 7:76224268-76224290 CTGGGCAACATGGTGAAACCCGG - Intronic
1027421106 7:78019352-78019374 CTGGGCAGCTTGTCAGAACCCGG + Exonic
1027427001 7:78071343-78071365 CTAGCCAACATGGTGAAACCCGG + Intronic
1028150451 7:87365794-87365816 CTGGGCAACATGGCAAAACTCGG - Intronic
1028187322 7:87802199-87802221 CTAGACAACAGGGCAAAACCTGG + Intronic
1028389348 7:90296516-90296538 CTGGTCAACATGGCAAAACGAGG - Intronic
1028634273 7:92970037-92970059 CTAGGCAGCATATCACAAGCTGG - Intergenic
1029259437 7:99291766-99291788 CTGGCCAACATGGCAAAACCTGG + Intergenic
1029487337 7:100851600-100851622 CTGGGCAACATGGCGAAACCCGG + Intronic
1029651954 7:101899356-101899378 CTGGTCAACATGGCAAAACCCGG + Intronic
1029837513 7:103328438-103328460 CTGGCCAATATGGCAAAACCTGG + Intronic
1030000432 7:105053980-105054002 CTGGCCAACATGGCAATACCTGG + Intronic
1031062132 7:117063682-117063704 CTGGGCAACATAGCAAGACCCGG + Intronic
1031105887 7:117542354-117542376 CTGGCCAACATGGTAAAACCCGG + Intronic
1031367798 7:120924728-120924750 TTGGGCAATATGGCAAAACCCGG - Intergenic
1031430384 7:121661132-121661154 CTGGCCAACATGGCGAAACCCGG - Intergenic
1031529057 7:122854167-122854189 CTAGGTAACGTGGCGAAACCTGG + Intronic
1032049433 7:128638396-128638418 CTGGGCAACATAGCAAGACCTGG - Intergenic
1032243934 7:130190804-130190826 CTGGGCAACATGGCAAAACCCGG + Intronic
1032952651 7:136932837-136932859 CTGGCCAACATGGCGAAACCTGG + Intronic
1033059887 7:138096008-138096030 CTGGACAGCATGGTGAAACCTGG + Intronic
1033125952 7:138707590-138707612 CTGGCCAACATAGCAAAACCTGG - Intronic
1033257251 7:139812864-139812886 CTGGCCATCATGGCAAAACCCGG + Intronic
1033732990 7:144196356-144196378 CTGGCCAACATGGCGAAACCCGG - Intergenic
1033743842 7:144294936-144294958 CTGGCCAACATGGCGAAACCCGG - Intergenic
1033750059 7:144354631-144354653 CTGGCCAACATGGCGAAACCCGG + Intergenic
1034038873 7:147855594-147855616 CTGGCCAACATGGTAAAACCCGG + Intronic
1034096584 7:148414268-148414290 CTGGGCAACATGGTGAAACCCGG - Intronic
1034109270 7:148520703-148520725 CTGGCCAACATGGCAAAACCCGG + Intergenic
1034179010 7:149123720-149123742 CTGGCCAACATGGCGAAACCCGG - Intronic
1034325690 7:150230032-150230054 CTGACCAACATGGCAAAACCCGG + Intergenic
1034549116 7:151809133-151809155 TTACGCAGGATGGCCAAACCTGG - Intronic
1034767511 7:153739226-153739248 CTGACCAACATGGCAAAACCCGG - Intergenic
1034776707 7:153834094-153834116 GTGGACAACATGGCAAAACCCGG + Intergenic
1035139951 7:156749877-156749899 CTGGCCAGCATGGTGAAACCCGG - Intronic
1035755062 8:2024657-2024679 CTGGCCAACATGGCGAAACCCGG + Intergenic
1035823172 8:2616772-2616794 CTGGCCAACATGGCAAAACTTGG - Intergenic
1036378588 8:8221275-8221297 CTAGACAACATGGCAAAACCTGG + Intergenic
1036523649 8:9515366-9515388 CTGGCCAACTTGGCAAAACCCGG - Intergenic
1036631814 8:10521210-10521232 CTGGCCAACATGGTAAAACCCGG + Intergenic
1036735146 8:11307260-11307282 CTGACCAACATGGCAAAACCTGG - Intronic
1036850986 8:12201342-12201364 CTAGACAACATGGCAAAACCTGG - Intergenic
1036872350 8:12443623-12443645 CTAGACAACATGGCAAAACCTGG - Intergenic
1037299786 8:17439622-17439644 CTGGGCAACATGGTGAAACCCGG - Intergenic
1037369662 8:18162549-18162571 CTAGCCAACATGGCAAAACCCGG + Intergenic
1037738756 8:21588347-21588369 CTGGCCAGCATGGCGAAACCCGG + Intergenic
1037803365 8:22046803-22046825 CTAGGTAGCAGAGCAAGACCCGG - Intronic
1037909726 8:22737101-22737123 CTGGCCAACTTGGCAAAACCCGG + Intronic
1037962384 8:23107150-23107172 CAGGGCAACATAGCAAAACCCGG + Intronic
1038011272 8:23477989-23478011 CTGGCCAACATGGCGAAACCCGG - Intergenic
1038087511 8:24216284-24216306 CTGGGCAACAAGGCGAAACCCGG + Intergenic
1038279148 8:26147931-26147953 GTGGGCAGCAATGCAAAACCAGG - Intergenic
1038412774 8:27371084-27371106 CTGGCCAACATAGCAAAACCTGG - Intronic
1038818604 8:30931775-30931797 CTGGCCAACATGGTAAAACCAGG - Intergenic
1038999179 8:32960452-32960474 CTGGGCATCATGGCAAGACTTGG + Intergenic
1039012189 8:33105960-33105982 CTGGCCAACATGGCAAAACCTGG - Intergenic
1039045436 8:33445122-33445144 CTGGACAGTATGGCAAAACCCGG - Intronic
1039220630 8:35326562-35326584 CTGGGCAGCATAGCAAGACAAGG + Intronic
1039415223 8:37387567-37387589 ACAGTCAGCATGGCCAAACCTGG + Intergenic
1039671005 8:39598575-39598597 CTGGCCAACATGGCAAAACCTGG + Intronic
1039816957 8:41102631-41102653 CTAGGCACCATGGCTTAGCCAGG + Intergenic
1039973478 8:42339759-42339781 CTGGGCAACATAGCAAAACCCGG - Intronic
1040057785 8:43075623-43075645 CTGGCCAACATGGTAAAACCTGG + Intronic
1040912746 8:52537665-52537687 CTAGGCAGCATGGATGAAGCTGG + Intronic
1041680248 8:60581815-60581837 CTGGGCAACATGGTGAAACCTGG + Intronic
1041939824 8:63374877-63374899 CTGGGCAAAATTGCAAAACCGGG - Intergenic
1042215463 8:66426554-66426576 CTGGGTTACATGGCAAAACCTGG + Intergenic
1042289957 8:67160070-67160092 CTGGGCAACATAGCAAGACCTGG - Intronic
1042380497 8:68107708-68107730 CAAGGCAAAATGGCAAAACAGGG - Intronic
1042403544 8:68377199-68377221 CTGGGCAACATGGCAAAACCTGG + Intronic
1042925287 8:73961701-73961723 CTGGCCAACATGGCGAAACCTGG - Intronic
1043476842 8:80613542-80613564 CTGGGCAACATAGCAAGACCTGG - Intergenic
1044301524 8:90589778-90589800 CTGGGCAACATGGTGAAACCTGG + Intergenic
1044437702 8:92185350-92185372 CTGGGCAACATAGCAAGACCTGG - Intergenic
1044524188 8:93233019-93233041 CTAGGCACCCTGGCAAGATCTGG + Intergenic
1044663356 8:94612766-94612788 CTGGGCAACATGGTGAAACCCGG - Intergenic
1044696110 8:94923878-94923900 CTGGCCAGCATGGTGAAACCCGG - Intronic
1044719094 8:95128655-95128677 CTAGGCAACATGGCAAAACCCGG - Intergenic
1045097641 8:98814870-98814892 CTGGGCAACATGGCAAAACCTGG - Intronic
1045274897 8:100694849-100694871 CTGACCAACATGGCAAAACCCGG + Intronic
1045464140 8:102453602-102453624 CTGGGCAACATGATAAAACCCGG - Intergenic
1045464310 8:102455562-102455584 CTGGCCAACATGGCAAAATCTGG - Intergenic
1045838637 8:106553508-106553530 CTGGGCAACATGGCAAAACCTGG - Intronic
1045905881 8:107343869-107343891 CTGGGCAACATAGCAAGACCTGG + Intronic
1046447252 8:114339043-114339065 CTGGCCAACATGGCAAAACCTGG - Intergenic
1046958845 8:120088585-120088607 CTAGGGAACATGGTGAAACCCGG - Intronic
1047189531 8:122665541-122665563 CTATGCAGCTTAGCAAAACAAGG + Intergenic
1047191130 8:122679832-122679854 CTGACCATCATGGCAAAACCCGG + Intergenic
1047375258 8:124289674-124289696 CTGGCCAACATGGCAAAAACCGG - Intergenic
1047993244 8:130308849-130308871 CTGGCCAACATGGTAAAACCTGG + Intronic
1048472598 8:134716976-134716998 CTAGGAACCATGCCAAAACCAGG + Intergenic
1049145032 8:140993918-140993940 CTGGGCAACATGGCAAAACTTGG - Intronic
1049215736 8:141407113-141407135 CTTGGCAGCCTGGCACAGCCCGG + Intronic
1049443157 8:142618313-142618335 CCAGGCTGCATGGCCAGACCTGG + Intergenic
1049868592 8:144956242-144956264 CTTGTTAGGATGGCAAAACCAGG + Intergenic
1051163341 9:14233618-14233640 CTGGCCAACATGGCAAAACCCGG - Intronic
1051349535 9:16185892-16185914 CTGAGCAACATGACAAAACCTGG - Intergenic
1051393300 9:16590066-16590088 CTGGGCAACATGGCAAAACCCGG + Intronic
1051624777 9:19088675-19088697 ATGGTCAACATGGCAAAACCCGG + Intronic
1051837590 9:21358672-21358694 CTAGACAACATGGTGAAACCTGG - Intergenic
1052107215 9:24533726-24533748 CTGGCCAACATGGTAAAACCCGG + Intergenic
1052274193 9:26659281-26659303 CGAGCCAGCATCGCAAAGCCAGG + Intergenic
1052377577 9:27734664-27734686 CTGGCTAACATGGCAAAACCCGG + Intergenic
1052601085 9:30632046-30632068 CTAGGAATCATGTCAAAATCTGG - Intergenic
1052691892 9:31825887-31825909 CTGGGCAGCATGCCAAATGCTGG + Intergenic
1052851675 9:33381895-33381917 CTGGCCAACATGGCGAAACCTGG + Intergenic
1053029357 9:34760799-34760821 CTGGGCAACATGGCGAAAACTGG + Intergenic
1053301447 9:36953880-36953902 CTGGGCAACATGGTGAAACCTGG + Intronic
1054149946 9:61593937-61593959 CTGGCCAACATGGCAAAACCCGG - Intergenic
1054469711 9:65525040-65525062 CTGGCCAACATGGCAAAACTCGG - Intergenic
1055447477 9:76397089-76397111 CTGGACAACATGGCAAAACTCGG + Intergenic
1055636995 9:78288656-78288678 CCAGGCAGCAGGGCAAGACAGGG + Intergenic
1056606369 9:88089245-88089267 CTGGTCAACATGGTAAAACCCGG - Intergenic
1056870717 9:90275247-90275269 CTAGGCTATATGGCTAAACCTGG + Intergenic
1056928006 9:90851110-90851132 CAAGGCAGGAAGGCAAAACCAGG + Intronic
1057107347 9:92432132-92432154 CTGACCAACATGGCAAAACCCGG + Intronic
1057833968 9:98429329-98429351 CTGGCCAGCATGGTGAAACCCGG - Intronic
1057944859 9:99317058-99317080 CCAGTGAGCAGGGCAAAACCTGG + Intergenic
1058277824 9:103067520-103067542 CTAGCCAACATGGTGAAACCCGG - Intergenic
1058298680 9:103341992-103342014 CTGGCCAGCATGGTGAAACCTGG - Intergenic
1058507735 9:105683519-105683541 CTAAGCAACATGGCAAATCCTGG - Intergenic
1058913145 9:109539696-109539718 CTAAGCTGCATGAGAAAACCTGG - Intergenic
1060203468 9:121667200-121667222 CTGGCCAACATGGCAAAACCTGG - Intronic
1060268955 9:122127960-122127982 CCTGGCAGTAGGGCAAAACCAGG - Intergenic
1060288258 9:122274464-122274486 CTGGCCAACATGGCAAAACCCGG + Intronic
1060537669 9:124404078-124404100 CTAGGCAACATAGCAAGACCCGG - Intronic
1060603215 9:124891833-124891855 CTGGCCAACATGGCGAAACCCGG - Intronic
1060626256 9:125114961-125114983 CTGGCCATCATGGCAAAACCCGG - Intronic
1060710717 9:125861093-125861115 CTGGGCAACATGGTGAAACCTGG + Intronic
1061054039 9:128212448-128212470 CTGGGCAACACGGCAAGACCCGG + Intronic
1061082448 9:128379920-128379942 CTGGGTAACATGGCAAAACCTGG + Intronic
1061167091 9:128929480-128929502 CTAGGGAACATGGTGAAACCCGG + Intronic
1061236679 9:129347229-129347251 CTGGCCAACATGGCAAAATCCGG - Intergenic
1061586531 9:131573106-131573128 CTGGCCAACATGGTAAAACCTGG + Intergenic
1061628060 9:131853735-131853757 CTGGGCAACATGGCAAGACCTGG + Intergenic
1061694064 9:132357761-132357783 CTAGCCAACATGGTGAAACCCGG + Intergenic
1062667809 9:137686578-137686600 ATGGGCAACATGGCAAACCCTGG - Intronic
1062676541 9:137748908-137748930 CTGAGCAGAATGGCTAAACCGGG - Intronic
1062738010 9:138149192-138149214 TTGGTCAACATGGCAAAACCCGG + Intergenic
1203546391 Un_KI270743v1:131476-131498 CTAGGCAGCATAGCACAAGGGGG - Intergenic
1185509047 X:649227-649249 CTGGCCAACATGGCGAAACCCGG - Intronic
1185555188 X:1015698-1015720 GTGGCCAGCATGGTAAAACCTGG - Intergenic
1185599953 X:1331989-1332011 CTGGCCAACATGGCAAAACCCGG + Intergenic
1185797153 X:2974816-2974838 CTGGACAACATGGCAAAACCTGG + Intergenic
1185869365 X:3650686-3650708 CTAGGCAACATGGTGAAACCAGG + Intronic
1185879753 X:3730617-3730639 CTGGCCAACATGGCAAAACCCGG + Intergenic
1185891495 X:3826167-3826189 CTCACCAACATGGCAAAACCTGG + Intronic
1185896603 X:3864581-3864603 CTCACCAACATGGCAAAACCTGG + Intergenic
1185901721 X:3903008-3903030 CTCACCAACATGGCAAAACCTGG + Intergenic
1186386115 X:9112014-9112036 CTGGGCAACACGGCAAAACCTGG - Intronic
1186480103 X:9890174-9890196 CTGGCCAACATGGTAAAACCTGG + Intronic
1186483054 X:9910871-9910893 CTGGGCAACATGGCAAGACCTGG - Intronic
1186490481 X:9968461-9968483 CTGGGCAGCATAGCAAGACCTGG + Intergenic
1187008255 X:15253041-15253063 CTGGGCAACATGGTGAAACCCGG + Intronic
1187063519 X:15810824-15810846 CTGGGCAACATGGTAAAACCTGG + Intronic
1187465405 X:19522179-19522201 CCTGGCAACATGGCGAAACCCGG - Intergenic
1187494750 X:19785325-19785347 CTAGGCAACATGGTGAAACCCGG + Intronic
1187495113 X:19788931-19788953 CTGGCCAACATGGCAAAATCAGG + Intronic
1187690206 X:21858697-21858719 CTGGGCAACATGGCATAACTCGG + Exonic
1187690324 X:21859900-21859922 CTGGGCAACATGGCATAACTCGG + Intronic
1187798664 X:23034552-23034574 CTGGCCAACATGGCAAAACCTGG + Intergenic
1187809555 X:23159965-23159987 CTGGACAACATGGCGAAACCCGG + Intergenic
1187864737 X:23713839-23713861 CTAGGCAACATAGCGAGACCTGG + Intronic
1187970633 X:24654558-24654580 CTGGGTAACATGGCAAAACCTGG + Intronic
1188393809 X:29655470-29655492 CTGGCCAACATGGCGAAACCAGG + Intronic
1189007722 X:37011926-37011948 CTGGGCAACATGGTGAAACCTGG + Intergenic
1189040761 X:37540651-37540673 CTGGGCAACATGGTGAAACCTGG - Intronic
1189291394 X:39888351-39888373 CTGGGCGACATGGCAAAACCCGG - Intergenic
1189994448 X:46625517-46625539 CTGGCCATCATGGCGAAACCCGG + Intronic
1190016412 X:46831293-46831315 CTGGGCAACATGGTGAAACCCGG + Intergenic
1190191375 X:48280025-48280047 CTGGGCAACATAGCAAAATCCGG - Intergenic
1190194745 X:48307326-48307348 CTGGGCAACATAGCGAAACCCGG - Intergenic
1190200616 X:48357588-48357610 CTGGCCAACATAGCAAAACCTGG - Intergenic
1190203326 X:48382139-48382161 CTGTGCAACATAGCAAAACCCGG + Intergenic
1190207210 X:48413265-48413287 CTGTGCAACATAGCAAAACCCGG - Intergenic
1190308169 X:49098302-49098324 CTGACCAACATGGCAAAACCTGG + Intronic
1190667430 X:52708064-52708086 CTGGCCAACATAGCAAAACCTGG - Intergenic
1190671988 X:52750344-52750366 CTGGCCAACATAGCAAAACCTGG + Intergenic
1190812904 X:53901854-53901876 CTGGACAACATGGCGAAACCTGG - Intergenic
1190836794 X:54108738-54108760 CTGGGCAACATGGTGAAACCCGG + Intronic
1191797829 X:65040966-65040988 CTAGGCAACATGGTGAAACCCGG - Intergenic
1192090026 X:68144218-68144240 CTGGGCAACATGGCAAAACCCGG - Intronic
1192111672 X:68371407-68371429 GTGGGCAGCATGGCAAAACTCGG - Intronic
1192132942 X:68569836-68569858 TTAGGCAGTTTTGCAAAACCTGG + Intergenic
1192251152 X:69414959-69414981 CTAGGCAACATGGCAAAACCTGG - Intergenic
1192454872 X:71268226-71268248 TTAGTCAGGATGGCAAAACCAGG - Intergenic
1192471063 X:71399128-71399150 CTGGGCAACATGGCAAAACCCGG - Intronic
1192581594 X:72287280-72287302 CTGGCCAACATGGCAAAACCCGG - Intronic
1192750928 X:73990334-73990356 CTGGCCAACATGGCGAAACCCGG + Intergenic
1192764296 X:74126467-74126489 TTAGTTAGGATGGCAAAACCTGG + Intergenic
1192904302 X:75533971-75533993 CTGGCCAATATGGCAAAACCTGG - Intergenic
1193483808 X:82060558-82060580 CTTGGCAGCATGGCAAGAGAGGG - Intergenic
1193579348 X:83244683-83244705 CTGGGCAACATGGCGAAACCCGG - Intergenic
1194609501 X:96023625-96023647 CTAGGCAACACAGCAAGACCTGG + Intergenic
1194944366 X:100050128-100050150 CTGGCCAACATGGCAAAACCTGG + Intergenic
1195118048 X:101719460-101719482 CTGGGCAACATGGCAAAATCCGG + Intergenic
1195118800 X:101728355-101728377 TTGGGCAACATGGCGAAACCCGG - Intergenic
1195467901 X:105200719-105200741 CTGGCCAGTATGGCGAAACCCGG + Intronic
1195617769 X:106926670-106926692 GTGGGCAACATGGCAAAACCTGG + Intronic
1195643984 X:107207739-107207761 CTGGGCAATATGGCGAAACCTGG + Intronic
1195650371 X:107277173-107277195 CTGGCCAACATGGCAAAACCCGG - Intergenic
1195695518 X:107664053-107664075 CTGGGCAACATGGTGAAACCCGG - Intergenic
1195714854 X:107808980-107809002 CTGGGCAACATGGTGAAACCCGG - Intergenic
1196303829 X:114077302-114077324 CTGGGAAACATGGCGAAACCTGG - Intergenic
1196700337 X:118661016-118661038 CTGGGTAACATGGCAAGACCTGG + Intronic
1196936522 X:120735904-120735926 CTGGGCAATATGGCTAAACCTGG + Intergenic
1197730791 X:129807627-129807649 CTGGCCAACATGGCAAAACCCGG + Intronic
1198240144 X:134777334-134777356 CTGGGCAACATGGCGAAACCCGG + Intronic
1198744250 X:139873515-139873537 CTGGCCAACATGGCAAAAACAGG + Intronic
1200177085 X:154124640-154124662 CTGGCCAACATGGCAAAACTGGG + Intergenic
1200769600 Y:7111388-7111410 CTAGGTGACATGGTAAAACCTGG - Intergenic
1200840562 Y:7777001-7777023 CTAGGCACCATGGTGAAACCCGG + Intergenic
1201307310 Y:12562099-12562121 TTAGACAGGATGGCAAAACTAGG + Intergenic
1201892071 Y:18953588-18953610 CTGGGCAACATGGGAAAACCCGG + Intergenic