ID: 1131148998

View in Genome Browser
Species Human (GRCh38)
Location 15:90035204-90035226
Sequence CAGCCCCCACACCATGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 684
Summary {0: 1, 1: 0, 2: 2, 3: 65, 4: 616}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131148998_1131149001 -1 Left 1131148998 15:90035204-90035226 CCTGGGGCATGGTGTGGGGGCTG 0: 1
1: 0
2: 2
3: 65
4: 616
Right 1131149001 15:90035226-90035248 GAGACATGAGGCAATGGTCTTGG 0: 1
1: 0
2: 0
3: 24
4: 224
1131148998_1131149000 -7 Left 1131148998 15:90035204-90035226 CCTGGGGCATGGTGTGGGGGCTG 0: 1
1: 0
2: 2
3: 65
4: 616
Right 1131149000 15:90035220-90035242 GGGGCTGAGACATGAGGCAATGG 0: 1
1: 0
2: 3
3: 35
4: 419
1131148998_1131149002 21 Left 1131148998 15:90035204-90035226 CCTGGGGCATGGTGTGGGGGCTG 0: 1
1: 0
2: 2
3: 65
4: 616
Right 1131149002 15:90035248-90035270 GTCTCAAACACCCCAGCTTCCGG 0: 1
1: 0
2: 3
3: 25
4: 254
1131148998_1131149004 29 Left 1131148998 15:90035204-90035226 CCTGGGGCATGGTGTGGGGGCTG 0: 1
1: 0
2: 2
3: 65
4: 616
Right 1131149004 15:90035256-90035278 CACCCCAGCTTCCGGCTGCTGGG 0: 1
1: 0
2: 1
3: 37
4: 704
1131148998_1131149003 28 Left 1131148998 15:90035204-90035226 CCTGGGGCATGGTGTGGGGGCTG 0: 1
1: 0
2: 2
3: 65
4: 616
Right 1131149003 15:90035255-90035277 ACACCCCAGCTTCCGGCTGCTGG 0: 1
1: 0
2: 0
3: 17
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131148998 Original CRISPR CAGCCCCCACACCATGCCCC AGG (reversed) Intronic
900103885 1:974097-974119 GAGGCCCCACACCAGACCCCCGG - Intronic
900195745 1:1374747-1374769 CCGCCCACAGACCATGCTCCTGG - Exonic
900288404 1:1913238-1913260 GAGCCACCACACCCGGCCCCCGG + Intergenic
901259558 1:7861607-7861629 CAGCCTCCGCAGCAGGCCCCAGG + Intergenic
902052021 1:13571212-13571234 CAGCCCCCACACCATAAAACTGG - Intergenic
902203161 1:14848920-14848942 CAGCCCCCGCTCCATGCACTTGG - Intronic
903462002 1:23526765-23526787 CATCCCACACACGCTGCCCCAGG + Intronic
903539687 1:24089958-24089980 CATCCCCCACACCCTGCACTGGG + Intronic
904108940 1:28109881-28109903 GAGCCACCACACCAGGCCTCTGG - Intergenic
904188306 1:28723221-28723243 GAGCCACCACACCCGGCCCCAGG - Intergenic
904520596 1:31092400-31092422 GAGCCACCACACCAAGCCCTTGG + Intergenic
904625424 1:31799522-31799544 CAGCCCCCTCCCCTTTCCCCTGG - Intronic
905244708 1:36604550-36604572 CAGCACCCTCAGCCTGCCCCAGG - Intergenic
905246281 1:36616528-36616550 CACCCCCCACATCAGGCTCCTGG + Intergenic
905519742 1:38588797-38588819 AAGCTCCCACAACATACCCCAGG + Intergenic
905933005 1:41802981-41803003 GTGCCCCCACTCCCTGCCCCTGG + Intronic
906040862 1:42786775-42786797 CAGGCACCACATCTTGCCCCTGG + Intronic
906085170 1:43126876-43126898 CAGGACCCACACCAAGCCCCTGG - Intergenic
906151052 1:43588048-43588070 CTGCCCGCAGACCATGTCCCTGG + Intronic
907460496 1:54602599-54602621 CTGCCCCCTCTCCATCCCCCAGG - Intronic
907468275 1:54654015-54654037 CAGCATCCACACTGTGCCCCTGG + Exonic
907480452 1:54742333-54742355 GTGCCCCCACCCCATCCCCCCGG + Exonic
908124115 1:61013360-61013382 CAGCCCCCACCTCAGGGCCCAGG + Intronic
908328620 1:63048536-63048558 CATCCTCCACACCCTGCCCATGG - Intergenic
908415261 1:63907220-63907242 CTGCTCCCACACCATACTCCTGG - Intronic
910888929 1:91996529-91996551 GAGCCACCACACCCAGCCCCAGG + Intronic
911266756 1:95753065-95753087 CAGTCCCCAGAGCCTGCCCCTGG + Intergenic
912480449 1:109978597-109978619 CAGCCCACTCACCATTGCCCTGG + Intergenic
914004911 1:143724026-143724048 CTGCCCCTACACCTTGTCCCTGG - Intergenic
914666885 1:149840106-149840128 CCGCCCACACCCCGTGCCCCCGG + Exonic
914668882 1:149853684-149853706 CCGCCCACACCCCGTGCCCCCGG - Exonic
914917243 1:151826205-151826227 CTCCCCTCACACCCTGCCCCAGG - Intronic
915305616 1:154975752-154975774 CCGCCCCCAAACCAAGCCCAGGG - Intronic
915631390 1:157155906-157155928 CACCCCGCCCACCCTGCCCCCGG + Intergenic
918517167 1:185375919-185375941 CACCCCCTCCACCTTGCCCCTGG + Intergenic
919016713 1:192047669-192047691 CTGCTCCCACACCCTGTCCCTGG - Intergenic
919515042 1:198511766-198511788 CAACCCCCTCACCATCCCTCCGG - Intergenic
919792756 1:201302759-201302781 CCGCCCCCACAGCGTGCCCAAGG + Intronic
919806312 1:201382871-201382893 CAGCCCCCTCCCCTTCCCCCAGG + Intronic
919824544 1:201494148-201494170 CGCCCCTCACACCCTGCCCCAGG + Intronic
920315487 1:205073411-205073433 CAGCCCCCAGAACATCCCCGAGG + Intronic
922756269 1:228098698-228098720 CAGCCACCCCACTATGCCGCAGG + Exonic
922774605 1:228208890-228208912 CCCCCACCAAACCATGCCCCGGG - Intronic
922799581 1:228359117-228359139 CAGCCCCCACCCCACCCCCACGG + Intronic
922822512 1:228494046-228494068 CAGCCCCCAAAACACGCCTCGGG - Exonic
924011494 1:239670252-239670274 CCACCCCCACCCCAAGCCCCAGG + Intronic
924289813 1:242525044-242525066 GCGCCCCCTCACCCTGCCCCCGG + Intergenic
924553509 1:245099488-245099510 CTGCCCCGACACCAGGCCACAGG + Intronic
1062766613 10:71025-71047 GAGCCACCACGCCCTGCCCCTGG - Intergenic
1062951262 10:1505655-1505677 CAGCCACCTCCCCATGCCCGTGG + Intronic
1062951277 10:1505704-1505726 CAGCCGCCTCCCCATGCCCGTGG + Intronic
1062951293 10:1505753-1505775 CAGCCGCCTCCCCATGCCCGTGG + Intronic
1063363966 10:5478748-5478770 CAGCCCCCAACCCATGCCAGAGG - Intergenic
1063496079 10:6509691-6509713 GAGCCACCACACCCGGCCCCAGG + Intronic
1063604207 10:7508337-7508359 CAGGCCCCCAGCCATGCCCCGGG - Intergenic
1064219601 10:13429174-13429196 CATCCCCCACTCCCAGCCCCTGG - Intergenic
1064458100 10:15507554-15507576 CTCCCCCGTCACCATGCCCCAGG + Intergenic
1066745637 10:38602872-38602894 CAGCCCTCACATCATGTCCCAGG + Intergenic
1067091144 10:43266467-43266489 CCACCCCCACGCCAGGCCCCGGG + Intronic
1067228526 10:44390856-44390878 CAGTCCCCACACCAGTTCCCAGG + Intergenic
1067848476 10:49740561-49740583 CAGCCCAATCACCATCCCCCAGG + Intronic
1069533346 10:69234976-69234998 AAGCCACCACGCCAGGCCCCTGG - Intronic
1069639135 10:69943776-69943798 CAGCCCCCGGCCCCTGCCCCGGG + Intronic
1070096594 10:73343422-73343444 GAGCCACCACACCCAGCCCCAGG - Intronic
1070288323 10:75099428-75099450 CCGGCCCCAGGCCATGCCCCAGG - Intronic
1070306866 10:75244949-75244971 CAGCCCCTACACCCTGCCCGTGG - Intergenic
1070383237 10:75900610-75900632 CAGCCCCCGCAGCATGCCCCTGG + Intronic
1070716233 10:78723944-78723966 CAGCTCCCACACCCAGCCCCAGG - Intergenic
1071278421 10:84077331-84077353 CAGCCACCACACCCAGCCCCTGG - Intergenic
1072727192 10:97821966-97821988 CAACCCCCACCCTGTGCCCCAGG - Intergenic
1073512604 10:104052041-104052063 CAGCCCTAACCCCCTGCCCCAGG - Intronic
1074219368 10:111421104-111421126 CTGCCACCACACCATGACCTTGG + Intergenic
1075124185 10:119686557-119686579 GAGCCACCACACCAGGCCTCAGG + Intergenic
1075209766 10:120481136-120481158 CAGACTCCACCCCATGCTCCAGG - Intronic
1075629961 10:123994855-123994877 CAGCCCCGTCCCCACGCCCCTGG - Intergenic
1075724133 10:124603091-124603113 CAGGCCCCTCACCATTGCCCTGG + Intronic
1075987859 10:126803553-126803575 CAGCTCCCACCCCATGGCCCAGG - Intergenic
1076399621 10:130173051-130173073 CAGCCCCCACTGTATGGCCCAGG - Intronic
1076528605 10:131128958-131128980 AAGCCCCTAAACCATGCCCCAGG + Intronic
1076584642 10:131537257-131537279 CAGCCCCCACCCCCAGCCTCTGG + Intergenic
1076659517 10:132046168-132046190 GAGCCACCACACCTGGCCCCTGG - Intergenic
1076723757 10:132404109-132404131 CAACCCCCAAAGCAAGCCCCTGG - Intronic
1076724441 10:132406928-132406950 AGGCCCCCACACCATGTCCCAGG - Intronic
1076752327 10:132549759-132549781 CAGCCCCCACTCTCTGCCCCTGG + Intronic
1076829956 10:132989106-132989128 CACCCCCCCCACCAGGCCTCAGG - Intergenic
1076858443 10:133128531-133128553 CCACCCGCACACGATGCCCCCGG + Exonic
1077183032 11:1224841-1224863 CAGCCCCCACAGCATGGTCAGGG - Intronic
1077196706 11:1284631-1284653 GAGCCCCCACACCCACCCCCAGG + Intronic
1077224289 11:1433344-1433366 AAGGGCCCACACCCTGCCCCAGG - Intronic
1077228250 11:1447584-1447606 TAGCCCCCACCCCAGCCCCCAGG - Intronic
1077410991 11:2403805-2403827 CAGCCCACACCCCACACCCCAGG - Exonic
1077433750 11:2528430-2528452 CAGCCCCCACCCCAGGCACCTGG + Intronic
1077448468 11:2617228-2617250 CTTCCCCCACACCTTGCCCATGG + Intronic
1077490729 11:2859745-2859767 CAGCTGCCACAGCATGCGCCGGG - Intergenic
1078486185 11:11725582-11725604 CAGTCCCAACCCCATTCCCCTGG + Intergenic
1078897923 11:15614609-15614631 CAGCCTCAACAGCATGCTCCAGG - Intergenic
1080426854 11:32162933-32162955 CACCCCCCGCACCCCGCCCCAGG - Intergenic
1080588038 11:33699083-33699105 CAGCCACCACACCCGGCCCCTGG + Intronic
1080873505 11:36257369-36257391 CTGCCCCCACCCCCTGCCCCAGG - Intergenic
1082693514 11:56332337-56332359 CAGGCCAAACCCCATGCCCCTGG - Intergenic
1082811785 11:57482903-57482925 CAGCCCCCTCCCCAAGCCCCGGG + Intergenic
1082873410 11:57964510-57964532 CAGTCCTCACACCTTGCCTCAGG - Intergenic
1083077402 11:60055335-60055357 CAGCCCCTGATCCATGCCCCAGG - Intergenic
1083176282 11:60952003-60952025 GAGCCCCCACCCCACGCCCAGGG - Intronic
1083624893 11:64067412-64067434 CAGCTCACAAATCATGCCCCCGG + Intronic
1083659372 11:64245192-64245214 CAGCCCCCTCACCTTGACCCTGG + Exonic
1083752237 11:64766998-64767020 CAGCCCCCACCCCCTCCCTCTGG - Exonic
1083896038 11:65620317-65620339 CATCTCCCATACCCTGCCCCAGG + Exonic
1083995737 11:66271201-66271223 GAGCCACCACACCCGGCCCCTGG - Intronic
1084000222 11:66292001-66292023 CAGCCAGGACACCATGCCCGAGG + Exonic
1084033035 11:66492280-66492302 CGGCCCCCACCCCCTTCCCCAGG + Intronic
1084273723 11:68041579-68041601 CAGACCAGACCCCATGCCCCAGG - Intronic
1084499533 11:69526486-69526508 AAGCCCCCACACCCTGCCAAGGG - Intergenic
1084657393 11:70527423-70527445 CTGAGCCCACACCATTCCCCAGG - Intronic
1084665084 11:70571930-70571952 CACCCCCAACACCATGCCATTGG - Intronic
1084945617 11:72636805-72636827 CAGTCTCCACACCATGGTCCAGG + Intronic
1085325536 11:75603581-75603603 CCGCCCCCACTCACTGCCCCAGG - Intronic
1085328048 11:75623633-75623655 CAGCCTCCAAACCAGGCACCAGG - Intronic
1085525355 11:77160626-77160648 CACCCACCACACCAGGCCCTGGG + Intronic
1085688867 11:78649667-78649689 CAGCCCCCACGTCCTGCCCATGG - Intergenic
1086053747 11:82624436-82624458 AAACCCACACAGCATGCCCCTGG - Intergenic
1087180460 11:95136761-95136783 CCACCCCCACAACAGGCCCCAGG + Intergenic
1087666591 11:101056353-101056375 GAGCCACCACACCCAGCCCCAGG - Intronic
1088232680 11:107688835-107688857 CAGCCCCCAGCCTATCCCCCAGG + Intergenic
1088443497 11:109898184-109898206 TAGCCCCCACCCCTGGCCCCCGG - Intergenic
1088569903 11:111213058-111213080 TAGCTCCCACACCATACCCTGGG + Intergenic
1089132591 11:116224254-116224276 CAGTGCCCGCTCCATGCCCCTGG + Intergenic
1089299343 11:117489233-117489255 CAGTCCCCACTGCCTGCCCCAGG - Intronic
1089743509 11:120601119-120601141 GAGCCACCACACCCAGCCCCTGG - Intronic
1090474024 11:127003774-127003796 CAGCCCCCTCCCCAAGCCTCCGG + Intergenic
1090538293 11:127670920-127670942 CAGTCCCCACCCCAAGCTCCTGG - Intergenic
1090666240 11:128916715-128916737 CACCCCTCACACCGAGCCCCTGG - Exonic
1091837845 12:3598257-3598279 TAGTCCCCACCCCATTCCCCTGG - Intergenic
1091876074 12:3933936-3933958 CAGTCCCCACACCCTGCCCTTGG - Intergenic
1092023526 12:5222285-5222307 CCACCCCCACACACTGCCCCAGG + Intergenic
1092154540 12:6273840-6273862 CACCCCACTCCCCATGCCCCAGG - Intergenic
1092260903 12:6952832-6952854 CAGCCCCCAGCCCATGCCTTTGG - Intronic
1094045502 12:26161719-26161741 CATCCCCCACACCATGTCTTTGG - Intronic
1094680056 12:32659928-32659950 GAGCCACCACACCCGGCCCCTGG + Intergenic
1094832778 12:34308089-34308111 CAGCTCCTACATCATGCCCCTGG + Intergenic
1094833140 12:34309562-34309584 CAGCCCCTTCGCCATGCCCCGGG + Intergenic
1094833423 12:34311197-34311219 CAGCCCCTGCGCCATGCCCCAGG - Intergenic
1095528923 12:43161559-43161581 GAGCCACCACACCAGGCCACAGG - Intergenic
1095951403 12:47783804-47783826 CTGCCCGCCCACCATGCCCTTGG - Exonic
1096199740 12:49673129-49673151 CAGCCCCCACACTCAGCCCATGG + Intronic
1096408267 12:51359242-51359264 GAGCCCCCACACCTTCCCCAAGG - Exonic
1096807136 12:54147684-54147706 CAGGCCCCACACCCAGCCACTGG - Intergenic
1096847762 12:54417473-54417495 CAACCCCCACCCCACCCCCCTGG - Intronic
1097187803 12:57204919-57204941 CAGCCCCCAGAGCCTTCCCCAGG - Intronic
1097277732 12:57824556-57824578 AAGCGCACACACCATGTCCCAGG + Intronic
1097279226 12:57834371-57834393 TAGCCCCTACCCCTTGCCCCAGG + Intronic
1097572758 12:61355237-61355259 CAGTCCCCAGAGCCTGCCCCTGG + Intergenic
1097676126 12:62603667-62603689 CCTCCCCGACACCATGGCCCTGG + Exonic
1098378626 12:69844377-69844399 CACCCGCCACACAATTCCCCAGG - Intronic
1098763052 12:74448981-74449003 CAACCCCCTCATCATGCTCCAGG + Intergenic
1101379984 12:104206096-104206118 TAGCCACCACACCCAGCCCCGGG - Intergenic
1102057945 12:109910802-109910824 CAGCCACCACCACATGCCCTCGG - Intronic
1102353745 12:112214867-112214889 GAGCCACCACACCCGGCCCCTGG - Intronic
1102463483 12:113114729-113114751 CAGCCCCCAGACAAGGCTCCGGG + Intronic
1102699286 12:114825222-114825244 GAGCCACCACACCCGGCCCCAGG - Intergenic
1102896652 12:116603621-116603643 CACCCCCCAACCCCTGCCCCGGG - Intergenic
1102933935 12:116881524-116881546 CAGCCCCCCCCCCAACCCCCGGG - Intergenic
1103128852 12:118449030-118449052 CCACCCCCACAACAGGCCCCAGG + Intergenic
1103552228 12:121746143-121746165 GAGCCACCACACCCAGCCCCTGG + Intronic
1103715181 12:122940950-122940972 CAGCCCCCACTCCCTGCATCAGG + Exonic
1104635296 12:130434699-130434721 CGGGCCCCACACCATCCTCCTGG - Intronic
1104942868 12:132403116-132403138 CAGACTCCACACCGTGCACCCGG - Intergenic
1105209515 13:18249691-18249713 GAACCTCCACACCATTCCCCAGG + Intergenic
1105918475 13:24939340-24939362 TAGCCCCAACACCATGCCATGGG - Intergenic
1106024260 13:25941724-25941746 CAGGCCTCACACCAAGCACCAGG + Intronic
1106959614 13:34983176-34983198 CCCACCCCACACCAGGCCCCAGG + Intronic
1107321508 13:39194048-39194070 GAGCCACCACACCCGGCCCCAGG - Intergenic
1107555803 13:41515988-41516010 CAGCCCCCGCCCCATCCACCTGG - Intergenic
1108162487 13:47656429-47656451 CATCACCTACACCATGCTCCAGG + Intergenic
1108272738 13:48778144-48778166 AAGTCCCCACATCATGCCTCAGG + Intergenic
1108855610 13:54789287-54789309 CAGGACCTACACCAAGCCCCTGG - Intergenic
1110256285 13:73437284-73437306 CAGACCCAAGACCCTGCCCCAGG - Intergenic
1111299125 13:86323334-86323356 CCGACCCCACAACAGGCCCCGGG - Intergenic
1112436248 13:99393206-99393228 GAGCCACCACACCCTGCCCGGGG - Intergenic
1112698834 13:101980955-101980977 GAGCCACCACACCCAGCCCCTGG - Intronic
1112706699 13:102078125-102078147 GAGCCCCCACCCCGTACCCCTGG - Intronic
1113682930 13:112256912-112256934 CCGCACCCACACCAGGCCCTGGG + Intergenic
1113706417 13:112436194-112436216 CAGCCCTGACACCGTGCCCCAGG + Intergenic
1114223467 14:20717558-20717580 CAGCCCCCACACCATAAAACCGG + Intergenic
1114664449 14:24369631-24369653 CAGCCCCCTCACCTGGCACCTGG + Exonic
1115545443 14:34462003-34462025 CAGCCTCCACCCCAGGCCCGGGG + Intronic
1117630328 14:57684291-57684313 CAGCCCCCACCCTAGGCCTCTGG + Intronic
1117895918 14:60486067-60486089 CAGCCCCGCCCCCACGCCCCTGG + Exonic
1118453909 14:65928483-65928505 CGGCCCCCACCCCCTGCCCTGGG + Intergenic
1118760964 14:68879909-68879931 CAGCCCCCAACCCCTGCCCCAGG - Intronic
1119035977 14:71231058-71231080 CAGTCCCCAGAGCCTGCCCCTGG + Intergenic
1119530976 14:75361193-75361215 GAGCCCCCACGCCCAGCCCCAGG + Intergenic
1120996094 14:90419810-90419832 GAGCCACCACACCCAGCCCCAGG + Intergenic
1121089943 14:91174232-91174254 CTTCCCCCACACCTTGCCCTGGG + Intronic
1121435660 14:93917543-93917565 CAGCCCCCACCCCAGCCACCTGG - Intergenic
1122204772 14:100142987-100143009 CAGCCCCCACAACCTTCTCCTGG + Intronic
1122370920 14:101228595-101228617 CAGCCCCCACCCCATCTCACTGG + Intergenic
1123941235 15:25217601-25217623 CCGCCCCCCAACCAGGCCCCAGG - Intergenic
1124055853 15:26240488-26240510 CAGGCCCCACACCAGGCCCACGG - Intergenic
1125600962 15:40915630-40915652 CAACCCCCGCCCCCTGCCCCTGG + Intergenic
1128090779 15:64917308-64917330 CACCTCCCACACCCTCCCCCAGG - Intronic
1129394712 15:75237544-75237566 CAGCCCCCTCCTCCTGCCCCAGG - Intergenic
1130805863 15:87321267-87321289 CAGGCCCCACACAAGGCCTCAGG + Intergenic
1130922884 15:88363863-88363885 CATCCATAACACCATGCCCCAGG - Intergenic
1131115302 15:89791735-89791757 GAGCCACCACACCCTGCCCAAGG + Intronic
1131148998 15:90035204-90035226 CAGCCCCCACACCATGCCCCAGG - Intronic
1131255583 15:90859819-90859841 CAGCCCCAAAACGATGACCCGGG - Intergenic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1131443601 15:92477118-92477140 CAGCCCCCACCCCATGCTGGTGG - Intronic
1131786092 15:95912607-95912629 CAGCCTCCTCACCAGGCGCCTGG - Intergenic
1132466445 16:79537-79559 CAGCCCAGGCACCTTGCCCCAGG + Exonic
1132562654 16:604773-604795 GAGCCACCACACCCAGCCCCAGG - Intronic
1132601847 16:776262-776284 CAGCCCCTGCTCCATTCCCCGGG - Intronic
1132629486 16:910309-910331 CCGCCCCCACACCAGGGCCCAGG + Intronic
1132881609 16:2164036-2164058 CAGGACCCCCAGCATGCCCCAGG + Intronic
1133212498 16:4271448-4271470 CCTCCCCCACACCACGCCCAGGG + Intronic
1133965807 16:10530942-10530964 CAGCCTCCCTACCATGCCACAGG + Exonic
1134031422 16:10995419-10995441 CAGCCTCCCCAACATGCTCCTGG - Intronic
1134223813 16:12376223-12376245 CAGCCCCCACGCCACGTCCCTGG + Intronic
1134245137 16:12534127-12534149 CAGCTCCAACACCAGGCCTCAGG + Intronic
1134397919 16:13882304-13882326 GAGCCTCAACACCAGGCCCCAGG + Intergenic
1134798902 16:17066459-17066481 CAGGCACCACACCAAGCACCAGG - Intergenic
1135040917 16:19115826-19115848 CAGCCGCCCCACCAGGGCCCAGG - Exonic
1135810413 16:25581623-25581645 GAGCCACCACACCCAGCCCCAGG - Intergenic
1135989963 16:27212345-27212367 CAACCCACACCCCATGCCCTTGG - Intronic
1136149256 16:28336097-28336119 GAGCCACCACACCTGGCCCCAGG + Intergenic
1136520874 16:30795011-30795033 CACCCCCCACCCCAGGCCACTGG + Intergenic
1136737428 16:32476777-32476799 CAGCCCTCACATCATGTCCCAGG - Intergenic
1137267416 16:46880668-46880690 CATCCCCCACACCCTGGTCCAGG + Intergenic
1137436125 16:48455558-48455580 CAGCCCACAGACAGTGCCCCTGG - Intergenic
1137458115 16:48633808-48633830 CATCCCCCACAACATTCCTCAGG - Intergenic
1138450991 16:57093225-57093247 CAACACCCACCCCCTGCCCCAGG + Intronic
1138971622 16:62151245-62151267 CAGCCCCCACTCCCCGCCCCCGG + Intergenic
1139207187 16:65040542-65040564 CCCACCCCACAACATGCCCCAGG - Intronic
1139971105 16:70775722-70775744 CAGCCAGGACTCCATGCCCCTGG + Intronic
1141167189 16:81668616-81668638 CAGCGCCTGCACCAGGCCCCCGG - Intronic
1141338899 16:83184468-83184490 GAGCCACCGCACCCTGCCCCTGG - Intronic
1141389941 16:83656091-83656113 CACCCCTCACACCCAGCCCCTGG + Intronic
1141431663 16:83973349-83973371 CTGCCCTCCCACCATGCCCAAGG - Intronic
1141442760 16:84040199-84040221 CAGCCCCAACTCCATCTCCCCGG + Intronic
1141606922 16:85159064-85159086 CTGCCCCCACCCCATCCCACTGG + Intergenic
1141659754 16:85435534-85435556 CAGCCCCCAGCCCCTCCCCCAGG - Intergenic
1141714259 16:85717689-85717711 CAACCCTCACACCATCCCTCAGG + Intronic
1141734140 16:85840989-85841011 CAGCCTCCACTCCGTGTCCCTGG + Intergenic
1141831527 16:86512087-86512109 CAGTCACCACAAAATGCCCCTGG - Intronic
1142039266 16:87882126-87882148 CTGCCCCCATCCCAAGCCCCAGG + Exonic
1142228218 16:88887641-88887663 CAGTCCCCACCCCATTCCGCAGG - Intronic
1142285203 16:89168818-89168840 CAGCCCCCAGACCAAGACCAGGG + Intergenic
1203015643 16_KI270728v1_random:352800-352822 CAGCCCTCACATCATGTCCCAGG + Intergenic
1203033978 16_KI270728v1_random:625958-625980 CAGCCCTCACATCATGTCCCAGG + Intergenic
1142709667 17:1716129-1716151 CAACCCCCACACCCAGCACCAGG - Intergenic
1142809043 17:2386780-2386802 CAGCCCCCCCACCCACCCCCAGG - Exonic
1143670520 17:8392984-8393006 CAGCCGCCACGGGATGCCCCTGG - Exonic
1143777646 17:9209902-9209924 CAGGCCCCACCTCATGCCCAAGG - Intronic
1145005505 17:19335547-19335569 CACCCCCCACCCCACGCCCTCGG - Exonic
1145296100 17:21593591-21593613 CAGCCCCTGCAGCATGCACCCGG - Intergenic
1146178915 17:30684967-30684989 CACTCCCCACGCCATTCCCCAGG + Intergenic
1146282886 17:31557102-31557124 GAGCCCCCACCCCCTGCCCCCGG + Intergenic
1146455115 17:33003896-33003918 CACCCCCTGCCCCATGCCCCCGG + Intergenic
1147125530 17:38365388-38365410 CCTCCTCCACCCCATGCCCCAGG + Exonic
1147181739 17:38690846-38690868 CACCCCCCACACCCTGTCCGAGG - Intergenic
1147308513 17:39579794-39579816 CAGCCCCCACTCCCTTCCTCTGG + Intergenic
1147449727 17:40496416-40496438 CACCACCCCCACCATGTCCCAGG - Exonic
1147726890 17:42571409-42571431 GAGCCACCACACCTGGCCCCCGG + Intronic
1147769288 17:42856584-42856606 CATCCCTCACACCCTGGCCCTGG - Exonic
1147772022 17:42874403-42874425 CATCCCTCACACCCTGGCCCTGG - Intergenic
1147882224 17:43661306-43661328 CACCCCACACAGCCTGCCCCAGG - Exonic
1147882883 17:43665338-43665360 CACCCACCCCACCATGACCCAGG - Intergenic
1147896072 17:43752169-43752191 GAGCCACCACACCCAGCCCCAGG - Intergenic
1147987162 17:44313242-44313264 CAGGCCCCTCACCTTGGCCCGGG - Exonic
1148115591 17:45172848-45172870 CTTCCCCCACCCCAGGCCCCAGG + Intergenic
1148689208 17:49517064-49517086 TACCCACCACCCCATGCCCCTGG - Intergenic
1148796480 17:50199691-50199713 CAGCCCCAGCCCCAGGCCCCAGG + Intronic
1149385657 17:56141123-56141145 TAGCACACACACCAAGCCCCTGG - Intronic
1149758522 17:59208282-59208304 CAGCCACCACACCTCGCCTCCGG - Intronic
1150719598 17:67603023-67603045 GAGCTACCACACCAGGCCCCTGG + Intronic
1151539615 17:74758343-74758365 CTGCCCCCACACCCTTCTCCCGG - Intronic
1151813609 17:76459890-76459912 TAGGCCCCTCACCAGGCCCCAGG + Intronic
1151818446 17:76483567-76483589 CAGCCACCACACCCGGCCCTAGG + Intronic
1151829836 17:76543054-76543076 CAGCTCCCACAGCATCCTCCTGG - Exonic
1151901988 17:77022457-77022479 CAGCCCCCACATCATAGGCCTGG + Intergenic
1152076306 17:78161989-78162011 GAGCCACCACACCCAGCCCCTGG - Intronic
1152097173 17:78278920-78278942 CGTCCCCCACCCCATGACCCCGG - Intergenic
1152362005 17:79837177-79837199 CAGCGCCCACCCCAGGCCCTTGG + Intronic
1152448246 17:80359118-80359140 CAGCCCCCACCCCCTTCCGCAGG + Intronic
1152883713 17:82835311-82835333 CAGCCACCACCCCTGGCCCCTGG - Intronic
1152918648 17:83054587-83054609 CAGCACCTACTCCAGGCCCCTGG - Intergenic
1152923785 17:83078775-83078797 CCGCCCCCACCCCGTGCCCGCGG - Intergenic
1152926592 17:83090339-83090361 CACCCCCCACCCCCCGCCCCAGG + Intronic
1152927459 17:83093845-83093867 CAGCCCCAACTCCATGCCAGGGG - Intronic
1153634667 18:7103520-7103542 GAGCCACCACACCAGGCCTCAGG - Intronic
1154070627 18:11149008-11149030 CCGCCCCCAAACGACGCCCCGGG - Intergenic
1154382348 18:13863904-13863926 CTCCACCCACCCCATGCCCCAGG - Intergenic
1155149773 18:23113724-23113746 GAGCCCCCAGGCCATGCCCATGG - Intergenic
1156456812 18:37299427-37299449 CGGCCCCCATACCAGGCCCCTGG - Intronic
1157578242 18:48758228-48758250 CAGCCCTGACACCCTGGCCCCGG + Exonic
1158606800 18:58902774-58902796 GAGCCACCACACCTGGCCCCAGG + Intronic
1159671458 18:71226275-71226297 CACGCCCAACACCAGGCCCCAGG - Intergenic
1160438150 18:78867095-78867117 CGGCCCCCACACCTGCCCCCAGG + Intergenic
1160740856 19:685278-685300 CAGCCCCCACGCCCTGCACAGGG + Intergenic
1160777004 19:861132-861154 CAACCCCCACACCCTCACCCCGG + Intronic
1160777045 19:861259-861281 CAACCCCCACACCCTCACCCCGG + Intronic
1160844121 19:1159186-1159208 CAGCCCCCGCCCCCTGCACCCGG - Intronic
1160977837 19:1802453-1802475 CAGCTCCCACTCCAGGACCCTGG + Intronic
1161040572 19:2108924-2108946 CAGCCCCCGCACCAGCTCCCAGG + Intronic
1161103527 19:2432804-2432826 CAGCCCCGTCACCCTGACCCTGG + Intronic
1161103733 19:2433432-2433454 CAGCCCCGTCACCCTGACCCTGG + Intronic
1161103838 19:2433747-2433769 CAGCCCCGTCACCCTGACCCTGG + Intronic
1161698434 19:5782917-5782939 CAGCCCCCTCCCCATCCCCAAGG + Intergenic
1162135475 19:8552549-8552571 GAGCCCCCACACCCAGCCCAAGG + Intronic
1162159708 19:8702689-8702711 CACCCCCCACGCACTGCCCCCGG + Intergenic
1162256411 19:9493638-9493660 TAGCCACCACACCCAGCCCCAGG + Intronic
1162424139 19:10583870-10583892 CAGCCCCCACACCCACCTCCAGG + Intronic
1162443416 19:10707451-10707473 CTACCCCCTCACCAGGCCCCTGG + Intronic
1162575196 19:11495207-11495229 CAGCCCCCTCACCACTCACCGGG + Intronic
1162579804 19:11522231-11522253 CAGCACCCACAACATGTACCAGG + Intronic
1162948455 19:14057299-14057321 CACCCCCCACTCCATTCCCCAGG + Intronic
1162952233 19:14078360-14078382 GAGCCACCACACCTGGCCCCTGG - Intergenic
1162979702 19:14230587-14230609 CACTCCCCACGCCATTCCCCAGG - Intergenic
1163000396 19:14363373-14363395 CAGCACCCTCACCCCGCCCCCGG + Intergenic
1163849185 19:19653931-19653953 GCGCCCCCACCCCTTGCCCCAGG + Intronic
1164037531 19:21467698-21467720 CAGCCCCCACCCCTCTCCCCAGG + Intronic
1164512801 19:28911443-28911465 CAGTGCCCACACCAGCCCCCAGG + Intergenic
1164617146 19:29674064-29674086 CAGCCAGCACATCATCCCCCTGG + Exonic
1164620703 19:29694642-29694664 CAGCCTCCGCACCCTCCCCCTGG + Intergenic
1165357682 19:35313743-35313765 CTGCCCCCACACCTGGCCCTGGG + Exonic
1166283471 19:41809996-41810018 CAGCCCCAAGCCCTTGCCCCTGG + Exonic
1166354934 19:42221346-42221368 GAGCCACCACACCTAGCCCCTGG - Intronic
1167358779 19:49019116-49019138 CGGCCCTCACACCCCGCCCCAGG + Intergenic
1167366470 19:49057364-49057386 CGGCCCTCACACCCCGCCCCAGG + Exonic
1167366511 19:49057513-49057535 CAGCCACCACAAAATCCCCCTGG + Exonic
1167367287 19:49061525-49061547 CAGCCCCCTCCACCTGCCCCCGG + Exonic
1167373913 19:49101301-49101323 CAGCCTGCACACCAGGCCCTGGG - Intronic
1167447039 19:49543683-49543705 CAGCCCCCAAACCATCTCCAGGG - Intronic
1167590787 19:50403233-50403255 CACGCCCCACACCATTTCCCGGG + Intronic
1167740290 19:51320486-51320508 CAGCCCCCACTCCCTGGCCCTGG + Intronic
1168173818 19:54608465-54608487 CACCTCCCACATCATCCCCCAGG - Intronic
1168486203 19:56764628-56764650 CATCCCTCACACCATCCCCATGG + Intergenic
1168515214 19:57005104-57005126 CTCCCCCCACAACAGGCCCCAGG + Intergenic
1168553759 19:57321138-57321160 CAGCCCCTACCCCATCCACCTGG + Intronic
1168595610 19:57673673-57673695 TATGCCCCACCCCATGCCCCTGG + Intronic
1168706941 19:58475774-58475796 CCGCCCCCACGCCATTCCCCGGG - Intronic
925083837 2:1092075-1092097 CAGCCCCCTCACATAGCCCCAGG + Intronic
925194608 2:1913004-1913026 AAGCCACCACCCCATTCCCCTGG - Intronic
925331877 2:3064701-3064723 CATTACCCCCACCATGCCCCAGG + Intergenic
925601297 2:5611167-5611189 CAGCTCCCAGTCCAGGCCCCAGG + Intergenic
927208166 2:20623055-20623077 CAGCTCCCACTCCATGCTCCAGG - Intronic
927882572 2:26698890-26698912 GAGCCACCACACCCAGCCCCTGG - Intronic
927920356 2:26967512-26967534 CACCCACCACACCCAGCCCCAGG - Intergenic
927961523 2:27243218-27243240 CACTCCCCACATCATGACCCGGG + Exonic
929169648 2:38918755-38918777 GAGCCACCACACCCAGCCCCAGG - Intronic
929533612 2:42767257-42767279 CAGCCCAGATGCCATGCCCCTGG - Exonic
929664377 2:43822475-43822497 CAGGCCCCCCCCCATGCACCTGG + Intronic
929868331 2:45737064-45737086 CAGGCCCCACACCTGGCCACCGG + Intronic
929938169 2:46310120-46310142 CAGCTCCCACTCCATGCACTAGG - Intronic
930596974 2:53401159-53401181 CAGCCCCACCACCATCCCACTGG + Intergenic
930692366 2:54377730-54377752 CAGCCCCGACGCCAAGCCCAAGG - Intronic
930701016 2:54457329-54457351 CACCCCCCACACCACGCCCACGG + Intronic
930711214 2:54552737-54552759 GAGCCACCACACCTGGCCCCAGG + Intronic
930847593 2:55922830-55922852 CAGCCCCACCTCCATCCCCCGGG - Intronic
931052348 2:58428587-58428609 CAGCCCCCTCCTCTTGCCCCCGG + Intergenic
932186118 2:69697837-69697859 GAGCCACCACACCTGGCCCCAGG - Intronic
932485477 2:72081923-72081945 CAGCCCCCATAGCAGGCGCCTGG + Intergenic
933093012 2:78145622-78145644 CAGTCCCCACAGTCTGCCCCTGG + Intergenic
933138412 2:78763342-78763364 CAGCCCCGGCACCATACCCTGGG + Intergenic
933829790 2:86197667-86197689 GAGCCACCACACCCAGCCCCTGG - Intergenic
934308036 2:91842063-91842085 CAGCCCTCACCTCATGTCCCAGG + Intergenic
934572066 2:95379125-95379147 CAGCCCCCCACCCATCCCCCAGG + Intronic
934713859 2:96532020-96532042 CAGCCCCCACCGCAAGCCCAGGG + Intergenic
934929896 2:98413636-98413658 CAGCCACCACCCCAGGACCCAGG - Intergenic
934960041 2:98665043-98665065 GAGCCACCACACCCAGCCCCTGG - Intronic
935374253 2:102379157-102379179 GAGCCACCACACCCGGCCCCAGG - Intronic
935445595 2:103153015-103153037 CAGCACCCAGACCTTGCACCAGG - Intergenic
936315725 2:111422709-111422731 CATCCCCCGCTCCATCCCCCTGG + Intergenic
936379696 2:111973457-111973479 CAACCCCCACACCGTACTCCTGG + Intronic
937152035 2:119692613-119692635 CAGCTCCCACACAGTGCCTCAGG + Intergenic
937202997 2:120217769-120217791 CGGCTGCCACACCATGCCCTCGG - Intergenic
938032724 2:128009185-128009207 CAGCCACCACACCTGGCCCTGGG - Intronic
938077649 2:128348301-128348323 CAGCCCCCTCTTCATGCTCCTGG + Intergenic
938381810 2:130840552-130840574 AAGCCTCCACACCATGGCTCAGG + Intronic
940882402 2:158959891-158959913 GAGCCACCACGCCCTGCCCCAGG + Intergenic
941172990 2:162162516-162162538 CAGCTTCCACACCATGACCGTGG - Intergenic
944173400 2:196803063-196803085 GAGCCACCACGCCAGGCCCCCGG + Intergenic
946407955 2:219502124-219502146 CAGCTCCCACACCAACTCCCGGG - Intronic
946412509 2:219522381-219522403 CAGCCCCCACCCCACCCTCCGGG - Intronic
947324161 2:228956400-228956422 TATCCCCCTCCCCATGCCCCGGG - Intronic
947715146 2:232335564-232335586 CAGCCCCCACCCCTGGCCCTTGG + Intronic
947734221 2:232446515-232446537 CAGCCCCCACCCCTGGCCCTTGG + Intergenic
947744875 2:232502290-232502312 CAGCCCCCTCCCCTTGCCCGTGG - Intergenic
947869785 2:233428167-233428189 CAGCCCCCACACCAACCAGCAGG - Intronic
948187736 2:236034785-236034807 CAGCCCCCAGAATATGCCCAGGG + Intronic
948338629 2:237231299-237231321 CAACCCCCACTCCATACCCCTGG + Intergenic
1168752031 20:289523-289545 CAACCCCCACACCAGCTCCCAGG + Intronic
1168923021 20:1556966-1556988 GAGCCACCACACCTGGCCCCTGG - Intronic
1171102699 20:22400424-22400446 CCACCCCCACCCCAAGCCCCTGG + Intergenic
1171262397 20:23746234-23746256 CAGCCCCCACCCCCTGACACCGG + Intergenic
1171340080 20:24420668-24420690 CAGGCCCCAGCCCATGCACCTGG + Intergenic
1171473371 20:25389998-25390020 CAGGCCCCACACCGAGCGCCCGG - Intronic
1172573809 20:35991374-35991396 CAACACACACACCACGCCCCTGG - Intronic
1172702629 20:36862691-36862713 CAGCTCCCGCACCAAGCCGCTGG + Exonic
1173648165 20:44646511-44646533 CAACCCCCACTCCAGTCCCCAGG + Intronic
1173657628 20:44711363-44711385 CAGCCCCCACACAAGGGCCCAGG - Intergenic
1174383223 20:50171007-50171029 CACCCCCCACACCATGAGCAGGG - Intergenic
1174498584 20:50967362-50967384 CATCCCCCACCCCACCCCCCGGG + Intergenic
1175095396 20:56537380-56537402 CAGCCACCACACCCGGCCACAGG - Intergenic
1175378980 20:58549473-58549495 CAGGATCCAGACCATGCCCCGGG - Intergenic
1175399943 20:58694270-58694292 CAGCCGCCACCCCATCCCTCAGG - Intronic
1175447264 20:59031965-59031987 CAGCACCCACAGAGTGCCCCTGG - Intronic
1175469353 20:59216126-59216148 CAACCCCCACACCCTTCCCTGGG + Intronic
1175665992 20:60860590-60860612 CAGCCCACGCACCATTTCCCAGG - Intergenic
1175777817 20:61664037-61664059 CAGCCCCCACACAATGCCCTTGG - Intronic
1175913249 20:62414426-62414448 GAGCCCCCACAGCAGCCCCCTGG - Exonic
1176274130 20:64254328-64254350 CACCCCTCCCACCATTCCCCTGG - Intergenic
1176297022 21:5079215-5079237 CGCCCCACACCCCATGCCCCAGG + Intergenic
1176591229 21:8652261-8652283 GAGCCCCCAAACCACCCCCCAGG - Intergenic
1176618156 21:9039023-9039045 CAGCCCCTGCACCGGGCCCCAGG - Intergenic
1177151245 21:17457514-17457536 GAGCCACCACACCCGGCCCCTGG + Intergenic
1177196821 21:17912095-17912117 CAGCCCCCACCCCAGTCTCCAGG + Intronic
1179176463 21:39011350-39011372 CAGCCTCCACAACTTCCCCCCGG - Intergenic
1179279794 21:39924817-39924839 GAGCCACCACACCTGGCCCCGGG + Intronic
1179418244 21:41215435-41215457 CTGCTCTCACCCCATGCCCCAGG + Intronic
1179505530 21:41837523-41837545 CAGCCCCCTCCCCCAGCCCCTGG - Intronic
1179860006 21:44182732-44182754 CGCCCCACACCCCATGCCCCAGG - Intergenic
1180056353 21:45361150-45361172 CAGACCCCTCACCCTGCCCCAGG - Intergenic
1180181193 21:46119360-46119382 CAGCCCTCACAGGATGCCCTGGG - Intronic
1180234677 21:46450717-46450739 CAGCCACCACACCTGGCCTCAGG + Intergenic
1180274077 22:10629372-10629394 GAGCCCCCAAACCACCCCCCAGG - Intergenic
1180535119 22:16389146-16389168 CAGCCCTCACATCACGTCCCAGG + Intergenic
1180574655 22:16761269-16761291 CAGTCCCCACACTAAGCCCATGG - Intergenic
1180636558 22:17266773-17266795 CAGCCCCCAGATCAAGCCTCAGG - Intergenic
1180766752 22:18349709-18349731 GAACCTCCACACCATTCCCCAGG - Intergenic
1180779562 22:18512669-18512691 GAACCTCCACACCATTCCCCAGG + Intergenic
1180812277 22:18769990-18770012 GAACCTCCACACCATTCCCCAGG + Intergenic
1181047533 22:20222726-20222748 CAGACCCCAAGCCATTCCCCAGG - Intergenic
1181198436 22:21204237-21204259 GAACCTCCACACCATTCCCCAGG + Intergenic
1181408899 22:22704378-22704400 CTGCCCCCAGACCCTGCCCCAGG + Intergenic
1181636766 22:24178207-24178229 CAGCCCCACCGCCACGCCCCAGG + Exonic
1181648228 22:24245327-24245349 GAACCTCCACACCATTCCCCGGG + Intergenic
1181786863 22:25233465-25233487 CAGCCCCCATTCCAGGCCACCGG - Intergenic
1182371596 22:29815009-29815031 GAGCCACCACACCTGGCCCCAGG - Intronic
1182446626 22:30393433-30393455 CAGCCCACACACCAGACTCCCGG + Intronic
1182460121 22:30477624-30477646 GAGCCACCACACCCGGCCCCTGG - Intergenic
1182461408 22:30486305-30486327 GAGCCACCACCCCAGGCCCCAGG - Intergenic
1183408844 22:37643256-37643278 CAGACCCCACAGCATCCTCCTGG - Intronic
1183457433 22:37930341-37930363 CAGCACCCACCCAATGACCCAGG - Intronic
1183475062 22:38031585-38031607 CAGCACCAACACCCTGTCCCAGG + Intronic
1183486316 22:38089297-38089319 CAGCCCCCACCCCCAGTCCCAGG + Intronic
1184177137 22:42794855-42794877 CAGGCCCCGCTCCCTGCCCCTGG + Intergenic
1184246412 22:43237960-43237982 CAGGCCTAACACCCTGCCCCAGG + Intronic
1184252391 22:43268162-43268184 CAGGCCCAACCCCAAGCCCCAGG + Intronic
1184366426 22:44054553-44054575 CAGCCCCCAACCCCTGCCCCTGG - Intronic
1184501868 22:44879369-44879391 CAGCCCCCTCGCCAGGACCCTGG - Intergenic
1184587333 22:45456915-45456937 GAGCCACCACACCGGGCCCCAGG + Intergenic
1184829460 22:46974998-46975020 CTGCCCCTACACCATGCCATAGG - Intronic
1184863578 22:47190524-47190546 CAGCGCCCGCACCCTCCCCCTGG + Intergenic
1184864116 22:47192993-47193015 CAGCCCCCACCCTATGTCACGGG + Intergenic
1184941073 22:47765654-47765676 CTGCCCGCACTCCATCCCCCTGG - Intergenic
1185048688 22:48541911-48541933 CAGCACCCACACGATCCCCTGGG - Intronic
1185065267 22:48628896-48628918 CAGCCCCCACCCACAGCCCCAGG - Intronic
1185228339 22:49666480-49666502 CCTCCCTCACACCATACCCCGGG + Intergenic
1185310740 22:50152881-50152903 CTGCCCCCAGACCAAGCCCTTGG - Intronic
1185326538 22:50228370-50228392 CAGCCCCTTTGCCATGCCCCTGG - Intronic
1185415189 22:50705696-50705718 CAGCCCCCACCCCATGGCTCTGG + Intergenic
1203228371 22_KI270731v1_random:90600-90622 GAACCTCCACACCATTCCCCAGG - Intergenic
950228901 3:11259106-11259128 CAGCCCCCAGCTGATGCCCCTGG + Exonic
950589046 3:13922304-13922326 CAGGCCACAAACCATGGCCCAGG + Intergenic
950782029 3:15400274-15400296 CTGCACCCCCACCAAGCCCCAGG + Intronic
951500819 3:23384823-23384845 GAGCCACCACACCTGGCCCCTGG + Intronic
952216912 3:31287368-31287390 CAGCCCCCACACACTGCAGCAGG - Intergenic
952229726 3:31417160-31417182 CTTCCCCCACACCCCGCCCCAGG - Intergenic
952931315 3:38363061-38363083 CAACACCCACACCATTGCCCAGG - Intronic
952951238 3:38527041-38527063 CAGCACCCACAACATGTGCCGGG - Intronic
953668061 3:44940224-44940246 CAGCCCCCACTGCATGCACATGG + Intronic
953710326 3:45264496-45264518 CTCCCCTCACACCCTGCCCCAGG - Intergenic
953917662 3:46930873-46930895 CAGGCCCCACTCCATGCACGTGG + Intronic
953931458 3:47007879-47007901 GAGCCGCCACACCATGCACGTGG - Exonic
954389680 3:50262009-50262031 GAGCCACCACACCCAGCCCCAGG - Intergenic
954443189 3:50532932-50532954 CAGACCGCACACCTGGCCCCTGG - Intergenic
954542103 3:51400354-51400376 CAGCATCCACAGCATCCCCCAGG + Intronic
954577809 3:51686429-51686451 CAGCCCCAACACCAGACTCCAGG - Intronic
954604783 3:51900862-51900884 CAGCCCCCATACCATAACACTGG - Intronic
954632083 3:52053098-52053120 CCACCCCCACACCTTGCCACTGG + Intronic
954687733 3:52379752-52379774 CAGCCCCCACACACTGTCCCTGG + Intronic
954818865 3:53307231-53307253 GAGCCACCACACCCGGCCCCAGG + Intronic
956090613 3:65662852-65662874 CTGCCCCAACTCCCTGCCCCTGG + Intronic
956208051 3:66774160-66774182 CAGACCCCACACAGTGGCCCTGG + Intergenic
956213287 3:66823876-66823898 AAGCCCCCACCTCATGTCCCTGG - Intergenic
956528231 3:70187999-70188021 CAGCCACCCCACCTTTCCCCTGG + Intergenic
956885670 3:73556946-73556968 CAGCCCCTCCCACATGCCCCTGG + Intronic
958927469 3:100174362-100174384 CAGCCCCCACCCCATGCAACAGG + Intronic
958977202 3:100682126-100682148 CAGTCCCCAGAGCCTGCCCCAGG + Intronic
959946441 3:112130401-112130423 CACCCCCCAGACCTTGCCCAAGG - Intronic
960783436 3:121346109-121346131 CCGACCCCACAACAGGCCCCAGG + Intronic
960824972 3:121773036-121773058 GAGCCACCACACCCGGCCCCAGG - Intronic
961176707 3:124841660-124841682 CAGCACCTACCACATGCCCCAGG + Intronic
961452376 3:127008209-127008231 CAGCCCCCACACAGAGGCCCAGG - Intronic
961514421 3:127423824-127423846 CAGCACTTACACCGTGCCCCAGG + Intergenic
961555150 3:127692160-127692182 CATCCCCCAGACCATGAGCCGGG + Exonic
963122258 3:141786214-141786236 CATCTGCCACACCAGGCCCCAGG + Intronic
966245874 3:177807796-177807818 TAGACCCCATACCAGGCCCCGGG - Intergenic
966906324 3:184528462-184528484 CATCACCCACCCCATGCACCTGG - Intronic
968107899 3:196015314-196015336 CACCCCCCACACCAAGTCCGTGG + Intergenic
968808788 4:2790898-2790920 CTGGCCCCACACCAGACCCCGGG - Intergenic
969112379 4:4852058-4852080 CAGCACCCACACCCCACCCCGGG + Intergenic
969300594 4:6294813-6294835 CAGCCTCCACTCCTGGCCCCCGG - Intronic
969699553 4:8760726-8760748 CAGCCCCTCCCCAATGCCCCTGG + Intergenic
970591691 4:17565579-17565601 CAGCAGCCCCACCATGCCCACGG + Intergenic
971135416 4:23863237-23863259 CAGCTTCCTCACCAGGCCCCTGG + Intronic
971320327 4:25600283-25600305 CCGACCCCACAACAGGCCCCAGG - Intergenic
975896186 4:79093769-79093791 CTCCCCCCACATCCTGCCCCTGG + Intergenic
977004552 4:91548757-91548779 TCTCCCCCACACCATCCCCCTGG + Intronic
978131292 4:105200941-105200963 GAGCCACCACACCTGGCCCCAGG + Intronic
978935703 4:114372640-114372662 GAGCCACTGCACCATGCCCCAGG - Intergenic
979591091 4:122480883-122480905 CATCCCCCTAACCATTCCCCTGG - Intergenic
981319085 4:143370703-143370725 CTGACCCCACAACAGGCCCCGGG + Intronic
981780686 4:148426189-148426211 GTGCCTCCACCCCATGCCCCAGG + Intronic
983672044 4:170248659-170248681 CCCACCCCACACCATGCTCCAGG - Intergenic
984314093 4:178103678-178103700 GAGCCCCCACACCCAGCCCTAGG + Intergenic
984992714 4:185396646-185396668 CCGCCCCCTCCCCCTGCCCCCGG + Exonic
985469838 5:33381-33403 CACCCCCCACACCAGGTCCATGG + Intergenic
985551302 5:534893-534915 CAGCCCCCTCCGCATCCCCCTGG + Intergenic
985670836 5:1205853-1205875 CAGCCCCCACACCCTCCCATAGG + Intronic
985909317 5:2866524-2866546 TAGCCGCCACACCCAGCCCCTGG + Intergenic
986929927 5:12805363-12805385 CAGCCTCCAGACGCTGCCCCTGG + Intergenic
987437625 5:17915667-17915689 CAGCCCTCACATCCTGCTCCAGG + Intergenic
987626404 5:20406419-20406441 CCTCCCCCACAACAGGCCCCGGG - Intronic
988842048 5:35092849-35092871 CAGCCCCCACACCTTGCCTGTGG + Intronic
991034591 5:62115735-62115757 CATCCCCCACACCAAACCCCTGG - Intergenic
992489349 5:77227018-77227040 CAGCACCCACAAAATGCCACAGG + Intronic
992615059 5:78539630-78539652 AACCCCCCACACCATCACCCAGG + Intronic
993701380 5:91123030-91123052 CAGCCTCTCCACCATGCTCCTGG + Intronic
995408862 5:111832231-111832253 GAGCCACCACACCCAGCCCCAGG - Intronic
997205899 5:132050036-132050058 CAGCCCCCACTCCCTGCATCAGG + Intergenic
998149534 5:139748895-139748917 CACCCCCCCCAACATACCCCAGG - Intergenic
998509038 5:142696071-142696093 TAGCTCCCAGACCATGCACCAGG - Intronic
999725171 5:154430974-154430996 AAGCCCCCACACCACACCACTGG + Intergenic
999754609 5:154655063-154655085 CTGCCCCCACACCCAGACCCAGG + Intergenic
1001436331 5:171702549-171702571 TGGCCCCCAGACCCTGCCCCGGG + Intergenic
1002086196 5:176777128-176777150 CCGCCCCCACCCCATGCTCCTGG + Intergenic
1002270450 5:178068417-178068439 CATCTCCCATCCCATGCCCCTGG + Intergenic
1002448008 5:179301949-179301971 CAGCCTGCACACCTCGCCCCTGG + Intronic
1003046794 6:2740605-2740627 CAGCCCCCACACCTATTCCCTGG + Intronic
1004018515 6:11754697-11754719 CAGCCCCCACACCTTGTTCCTGG - Intronic
1004741647 6:18467421-18467443 CAACCCCCACTCCATAGCCCTGG - Exonic
1006295484 6:33168329-33168351 CTGCACACACACCCTGCCCCGGG + Intronic
1006630711 6:35427850-35427872 CAGCCTCCCTTCCATGCCCCAGG + Exonic
1006717853 6:36131415-36131437 CAGCCCCCACCCCCTCCCCGGGG - Intronic
1006735931 6:36272468-36272490 CAACCCCCAGGCCATGGCCCCGG - Intronic
1006863168 6:37187221-37187243 CGGCCCCCACCCCAGGCCCCAGG - Intergenic
1006882642 6:37353602-37353624 CCGCTCCCACACCTCGCCCCAGG + Intergenic
1006899695 6:37491996-37492018 CAACCTCCACACCTTACCCCTGG + Intronic
1006922765 6:37637330-37637352 CACCCCCCCAACCTTGCCCCCGG - Exonic
1007401330 6:41604229-41604251 CAGCCCCCACGCCCTGTCCCTGG - Intergenic
1007779692 6:44245901-44245923 GAGCCCCTAGGCCATGCCCCTGG - Intergenic
1010649745 6:78439342-78439364 GAGCCACCACACCCTGCCACAGG - Intergenic
1012992402 6:105939299-105939321 CAGCTCCCACTACATGCCTCAGG - Intergenic
1014652009 6:124051579-124051601 CCGACCCCACAACAGGCCCCGGG + Intronic
1014974527 6:127862702-127862724 CAGCCACCCCACCCAGCCCCAGG + Intronic
1015744187 6:136492093-136492115 CTCCCCCCACCCCCTGCCCCTGG - Intronic
1015775961 6:136814552-136814574 GAGCCACCACACCCGGCCCCAGG + Intergenic
1017813647 6:158001720-158001742 CAGCCCCCACACCTACTCCCTGG + Intronic
1017818080 6:158029210-158029232 CACCCCCCACCCCTGGCCCCTGG + Intronic
1017937495 6:159019315-159019337 CAGTCCACACACCCTGCCACCGG - Intergenic
1018430273 6:163716582-163716604 CTGCCCCCACACCCTAGCCCTGG + Intergenic
1018864783 6:167737859-167737881 CACCCTCCACTCCATGCTCCTGG + Intergenic
1018993839 6:168695272-168695294 CACCACCCACATCTTGCCCCAGG - Intergenic
1019554303 7:1621003-1621025 CGGCCCCCACACCACCCGCCGGG - Intergenic
1020270297 7:6590614-6590636 CAGCCCCCAAACCCTTCTCCGGG + Intronic
1020785707 7:12570558-12570580 AAGCTCCCACGCCTTGCCCCAGG - Intronic
1022060763 7:26792174-26792196 CTGCCTCCACACCCAGCCCCTGG - Intronic
1022138572 7:27472528-27472550 CACCCCCCCCGCCATCCCCCAGG + Intergenic
1023867075 7:44243395-44243417 CAGCCAACACACCCTGCCCCTGG + Intronic
1023870762 7:44261978-44262000 CAGCCCCAACTCCAGGGCCCGGG - Intronic
1024527776 7:50363230-50363252 GAGCCCCCAGACCAGGGCCCTGG + Intronic
1025085426 7:56019606-56019628 CAACCCCCACACCTGACCCCCGG - Exonic
1025204701 7:56985504-56985526 CAGCCCCCACACCACCCTCCTGG + Intergenic
1025667236 7:63591431-63591453 CAGCCCCCACACCACCCTCCTGG - Intergenic
1026019569 7:66697025-66697047 CACCCCTGACCCCATGCCCCAGG + Intronic
1026084700 7:67253619-67253641 CAGCCCCCGCCCCCTACCCCAGG - Intergenic
1026880814 7:73905555-73905577 CGCCCCCAACCCCATGCCCCAGG - Intergenic
1027362223 7:77421371-77421393 TAGTCCCCACACCATCCCCCAGG - Intergenic
1029215909 7:98949536-98949558 CAGCACCAGCACCATGCGCCTGG + Exonic
1029302853 7:99598508-99598530 CCGCCCCCAGCCCCTGCCCCGGG - Intronic
1029518991 7:101048134-101048156 CTTCCCCCACCCCATGCCCTGGG + Intronic
1030116600 7:106066273-106066295 TAGCCCCCACACCCTGTCCTGGG - Intergenic
1031826481 7:126572023-126572045 AAGCCACCACACCTGGCCCCAGG + Intronic
1032511626 7:132477261-132477283 CAGCCCCCTCCCCAGGCTCCAGG + Intronic
1032580444 7:133098800-133098822 GAGCCACCACACCTGGCCCCAGG + Intergenic
1033652534 7:143353683-143353705 CATCCCACACACCATCCTCCAGG - Exonic
1033658242 7:143387533-143387555 CACCCCCCACTCCAGTCCCCGGG + Intronic
1034201377 7:149285126-149285148 CCGCCCCCACAGCGTGCGCCGGG - Intronic
1034233239 7:149548843-149548865 GAGGCCCCACACTATGCCCTGGG + Intergenic
1034273015 7:149812355-149812377 CAGCCCCCACCCCAGGGCCTGGG + Intergenic
1034412070 7:150947054-150947076 CATCCCCCACTTCCTGCCCCAGG - Exonic
1034427440 7:151021461-151021483 CAGCACCCACCCCCTGCCCCGGG - Intronic
1034604247 7:152296142-152296164 GAGCCACCACGCCCTGCCCCTGG - Intronic
1035044067 7:155952628-155952650 AAGCCCCCACACCTGGCCCAGGG - Intergenic
1035133751 7:156679232-156679254 GACCCTCCACACCACGCCCCAGG + Exonic
1035181982 7:157096258-157096280 CAGCCCATAAACCAAGCCCCAGG - Intergenic
1035260165 7:157656101-157656123 CAGCCCCCACACACAGTCCCTGG - Intronic
1036569706 8:9969339-9969361 CACCTCCCTCACCATTCCCCAGG - Intergenic
1037530355 8:19766831-19766853 CATCCCCCACCCCCTGCCCGTGG + Intergenic
1037715531 8:21394417-21394439 GAGCCGCCACCCCATGCCCAGGG + Intergenic
1037903692 8:22703147-22703169 CACCCTCCGCACCCTGCCCCCGG - Intergenic
1038288887 8:26230864-26230886 CTGCCCCCTCTCCCTGCCCCAGG + Intergenic
1038291466 8:26253219-26253241 GAGCCCCCACACCTGGCCGCTGG - Intergenic
1038460389 8:27711204-27711226 GAGCCACCACACCAGGCCCTGGG + Intergenic
1038654156 8:29433451-29433473 CAGCCCCCAGACAATCCACCAGG + Intergenic
1039140387 8:34380952-34380974 GAGCCACCACACCCAGCCCCTGG - Intergenic
1040014736 8:42691227-42691249 CAGCCCCTACTCCTTGCCCAGGG + Intergenic
1041178773 8:55226485-55226507 CAGCCCCACCACCATTCTCCTGG - Intronic
1041432534 8:57799259-57799281 CAGCACCCACCCCAAGCCCAGGG + Intergenic
1044730547 8:95225567-95225589 CAGCCCCCAGGCCAAGCCCCAGG - Intergenic
1046893627 8:119449776-119449798 GAGCCACCACACCCGGCCCCCGG + Intergenic
1047408978 8:124608743-124608765 CACCCTCCACACAGTGCCCCAGG - Intronic
1049045643 8:140149333-140149355 GAGCCACCACACCTGGCCCCGGG - Intronic
1049351712 8:142168091-142168113 CATCCCCCCCACCATCACCCCGG + Intergenic
1049541039 8:143209105-143209127 CAGCCCCACCACCATAACCCTGG - Intergenic
1049553464 8:143271120-143271142 CAGCCCCCACTCCCTCCCACGGG - Intronic
1049672000 8:143874034-143874056 CTGAGCCCACACCCTGCCCCGGG + Intronic
1049757262 8:144316248-144316270 CATACCCCCCACCAGGCCCCAGG + Exonic
1049816831 8:144607560-144607582 CAGCCCCCACCCCGCCCCCCAGG + Intergenic
1050462195 9:5886344-5886366 CAGCCCCCACACCAGCCCCAGGG - Intronic
1050537794 9:6645470-6645492 CAGCCCCCACGCCCTGGCACAGG + Exonic
1051711201 9:19933033-19933055 CAGCCCCCACCTCCTGCCCCAGG - Intergenic
1053005319 9:34600445-34600467 CCGCCCCCACACCTGGACCCAGG + Intergenic
1054723639 9:68628221-68628243 GAGCCACCACACCCGGCCCCTGG + Intergenic
1054809992 9:69427015-69427037 CAGGGCCCCCAGCATGCCCCCGG + Intergenic
1056807855 9:89742771-89742793 CAGCCCCCAACCCCAGCCCCTGG - Intergenic
1057083491 9:92189403-92189425 CAGCCCCGGCACCAGGCACCAGG + Intergenic
1057314072 9:93958025-93958047 CAGCCCTCACCCCATTCCACAGG + Intergenic
1057723114 9:97548585-97548607 CATCCCTCACACCATCCTCCAGG - Intronic
1057802485 9:98198679-98198701 CAACCCCCACACCAAGTTCCTGG + Intergenic
1059779818 9:117514695-117514717 CACCCCCAACACCAAGCCCAAGG + Intergenic
1059862673 9:118482449-118482471 CAGCCCCTACCCCTGGCCCCAGG - Intergenic
1060212941 9:121721553-121721575 CAGCCCCTGCACCATGGCACTGG + Intronic
1060711406 9:125868553-125868575 CACCCCCTACTCCACGCCCCTGG - Intronic
1060718459 9:125956607-125956629 CAGCCACCAGACCAAGCCTCTGG - Intronic
1060789791 9:126478395-126478417 GAGCCCCCAGGCCCTGCCCCTGG + Intronic
1061150615 9:128826111-128826133 CAGCCCCCACCACATGCGTCAGG - Exonic
1061181473 9:129027518-129027540 CAGCCCTCTCTCCATCCCCCAGG + Intronic
1061190077 9:129077493-129077515 CAGCCCCCACATCAGGAACCAGG - Intergenic
1061367821 9:130181724-130181746 CAACACCCACACCAGGCACCCGG - Intronic
1061429509 9:130522458-130522480 CCTCCCCCACACCCTGACCCTGG + Intergenic
1061874572 9:133537327-133537349 CTGCCCCCACCCCATGCCCGAGG - Intronic
1061928953 9:133822380-133822402 CTGCCCCCACCCCAGTCCCCTGG - Intronic
1061976274 9:134069440-134069462 CTGCACCCACCCCAAGCCCCTGG + Intergenic
1062107647 9:134764403-134764425 GACCCCCCCCACAATGCCCCTGG - Intronic
1062277863 9:135739202-135739224 CTGCCCCCACACCATCCCTGAGG + Intronic
1062280266 9:135748812-135748834 CTGCCCCCACACCATCCCTGAGG + Intronic
1062428596 9:136517124-136517146 CCGCCCCCACCCCCTGCCCTCGG - Intronic
1062609873 9:137368987-137369009 AAGCCCCCCCACCCCGCCCCGGG - Intronic
1062617246 9:137403435-137403457 CAGCCAGCACACCCTGGCCCAGG + Intronic
1062626621 9:137445953-137445975 CAGCCCCCAGACCACACCCCAGG + Intergenic
1062738638 9:138153287-138153309 GAGCCACCACGCCCTGCCCCTGG + Intergenic
1186319605 X:8410072-8410094 GAGCCACCACACCTGGCCCCTGG + Intergenic
1187481261 X:19657905-19657927 CCGCCCCCACCCCCAGCCCCTGG - Intronic
1187575772 X:20553080-20553102 CTTCCCCCACACCCAGCCCCTGG + Intergenic
1187674950 X:21707099-21707121 CACCCCCCACCCCAAGCCCCTGG + Intronic
1187925890 X:24249794-24249816 GAGCCACCACGCCAAGCCCCTGG + Intergenic
1188673969 X:32915512-32915534 CAGACCTCACACCAAGCCACAGG - Intronic
1189373071 X:40445408-40445430 CAGCCTCCCCACCATGCCCTAGG + Intergenic
1189480222 X:41386778-41386800 CAGCCCCCACCGCATGCCTGGGG + Intergenic
1190271014 X:48863636-48863658 GAGCCACCGCACCCTGCCCCTGG - Intergenic
1191090142 X:56611570-56611592 GAGCCACCACACCAGGCCCATGG - Intergenic
1191258376 X:58289688-58289710 CAGCCCCTGCACCAAGCCCAGGG + Intergenic
1191615144 X:63162640-63162662 CATTCTCCACACCATGGCCCAGG + Intergenic
1191621154 X:63216283-63216305 CATTCTCCACACCATGGCCCAGG - Intergenic
1191640457 X:63426033-63426055 CAGCCCCAAGGCCAAGCCCCTGG - Intergenic
1193502906 X:82302185-82302207 GAGCCACCACACCCGGCCCCAGG - Intergenic
1194002362 X:88446270-88446292 CATCCCCCACCCCAAGCCCCTGG - Intergenic
1195759185 X:108227544-108227566 AAGCCCCCCCACCCTGCCCCAGG - Intronic
1197092239 X:122553142-122553164 CCACCACCACACCTTGCCCCAGG - Intergenic
1197167547 X:123394284-123394306 CAACCTCCACACCACCCCCCGGG - Intronic
1198592958 X:138204257-138204279 CCGACCCCACGACATGCCCCAGG - Intergenic
1199985482 X:152947044-152947066 CAGCCTCATCACCTTGCCCCTGG - Intronic
1200111245 X:153741997-153742019 CAGCCCTCACATCATGTCCCAGG + Intronic
1200182770 X:154160972-154160994 CATCCCCCACCCCCAGCCCCTGG - Intergenic
1200188424 X:154198086-154198108 CATCCCCCACCCCCAGCCCCTGG - Intergenic
1200194074 X:154235226-154235248 CATCCCCCACCCCCAGCCCCTGG - Intergenic
1200199829 X:154273030-154273052 CATCCCCCACCCCCAGCCCCTGG - Intronic
1200389444 X:155929451-155929473 CACCCCCCACACAATGCCCAGGG - Intronic
1201038748 Y:9808448-9808470 CTGCTCCCACTCCATGTCCCAGG - Intergenic
1201264459 Y:12192746-12192768 CAGACCCAACACCAGGCCACAGG + Intergenic