ID: 1131149336

View in Genome Browser
Species Human (GRCh38)
Location 15:90037091-90037113
Sequence CAGCTTGGAGGACCTGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 323}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131149336 Original CRISPR CAGCTTGGAGGACCTGGCAG GGG Intronic
900105289 1:978479-978501 CAGTTTGGGGGAACTGCCAGTGG + Intronic
900179677 1:1305695-1305717 CAGCTTGGAGGACGGGGAGGAGG + Intronic
900403172 1:2481147-2481169 GAGCTGGCAGGAGCTGGCAGGGG - Intronic
900436549 1:2633823-2633845 CAGCGTGGGAGACCTGGCCGGGG - Intergenic
900681079 1:3916776-3916798 CAGCTTGGAAGACACAGCAGTGG + Intergenic
901104422 1:6744108-6744130 CAGCTTAGAAGCCCAGGCAGGGG - Intergenic
901641229 1:10694166-10694188 CGGCTTGGGGGCCCTGGCCGGGG + Intronic
901642263 1:10698749-10698771 CAGTTTGGAGGAGCTCGCTGGGG - Intronic
902080737 1:13818917-13818939 GAGCTGGGAGGCCCTGGGAGAGG + Intronic
904048548 1:27623960-27623982 CAGGGTGGTGCACCTGGCAGGGG - Intronic
904217321 1:28931890-28931912 TAGCTTGGTGGCCTTGGCAGGGG + Intronic
904464852 1:30701695-30701717 CTGCTGGAAGGACCAGGCAGTGG + Intergenic
904773889 1:32895239-32895261 CAGCTTGGGCACCCTGGCAGGGG + Intronic
905446068 1:38029209-38029231 GAGCTCTGGGGACCTGGCAGGGG - Intergenic
905675600 1:39822689-39822711 CAGCTTGGAGGCCAGTGCAGAGG + Intergenic
906156095 1:43614923-43614945 CTGCTTGGAGGAGGTGGAAGAGG - Intronic
907297873 1:53467049-53467071 CAACCTGGAGGACCAGGCAAAGG - Exonic
908085252 1:60625408-60625430 CAGAGTGGCGGAACTGGCAGTGG - Intergenic
911656286 1:100447762-100447784 CTGCTTGTAAGACCTGGAAGTGG + Intronic
912521714 1:110250277-110250299 CAGCCTGGAGGACATGGAGGAGG - Intronic
913735727 1:121781600-121781622 CTTTTTGGAGGACCTGCCAGTGG - Intergenic
913736709 1:121793116-121793138 CTTTTTGGAGGACCTGCCAGTGG - Intergenic
913751270 1:121970163-121970185 CTTTTTGGAGGACCTGCCAGTGG + Intergenic
913767920 1:122213581-122213603 CTTTTTGGAGGACCTGCCAGTGG + Intergenic
913973015 1:143430409-143430431 TAGCATGGAGGAACTGGCAGCGG + Intergenic
914067399 1:144256016-144256038 TAGCATGGAGGAACTGGCAGCGG + Intergenic
914111754 1:144710338-144710360 TAGCATGGAGGAACTGGCAGCGG - Intergenic
916378245 1:164179766-164179788 CAGCCTTGAGGATCTGGAAGAGG - Intergenic
916385419 1:164262139-164262161 CAGCTTGGAGGATTTGCCTGAGG - Intergenic
916560164 1:165928128-165928150 CAGCAAGGAGAATCTGGCAGAGG + Intergenic
917432269 1:174982878-174982900 CAGCAAGGAGGAGCTGGAAGTGG + Intronic
919885612 1:201931973-201931995 CAGCTTTGAGGGCTTGGCTGAGG + Intronic
919920267 1:202163104-202163126 GAGCTGGGAGGAGCTGGCTGGGG + Intergenic
920297541 1:204968131-204968153 CAGCTGGGAGGATCCGGCAGGGG + Intronic
920414997 1:205793220-205793242 CAGCTGGGAGGAGGTGGCAAAGG + Intronic
920531071 1:206703005-206703027 TAGCAGGGAGGGCCTGGCAGGGG - Intronic
922719298 1:227892192-227892214 CAGCTTGGGGGTCATGGCGGAGG + Intergenic
922918345 1:229277544-229277566 CAGCAACGAGGAGCTGGCAGAGG - Intronic
923915026 1:238492307-238492329 CAGCTTGGAGAACCAGCCTGAGG + Intergenic
1063381940 10:5591055-5591077 CAGCCTGGAGGGCCTGGGTGAGG - Intergenic
1065066093 10:21966627-21966649 TAGCTTGGAGGATCTCTCAGTGG - Intronic
1066413409 10:35195940-35195962 CAGCTTGGAGGCAGAGGCAGTGG - Intronic
1067046377 10:42987545-42987567 CAGCTCAGAGGAGCTGGGAGAGG - Intergenic
1067048176 10:42997560-42997582 CAGCCATGAGGAGCTGGCAGTGG + Intergenic
1067451508 10:46384794-46384816 CAGCTTTGTGGACCCGGCACTGG + Exonic
1068838801 10:61587317-61587339 CCCCTTGCAGGACCAGGCAGAGG + Intergenic
1069773910 10:70915936-70915958 CTGCCTGGAGCACCTGACAGAGG + Intergenic
1070755111 10:78987273-78987295 CTGCTTGGAGGAGGTGGCATTGG - Intergenic
1070922733 10:80198384-80198406 CAGCTAGGAGGGCCTGCCATGGG + Intronic
1071105854 10:82093795-82093817 CAGGTGGGAGAACCTGTCAGGGG + Intronic
1071566212 10:86672704-86672726 CAGCCCGGAGGACCTGGCCTGGG - Intronic
1072386039 10:94929217-94929239 CAGCTTGCAGGAGCTGGGATGGG - Intergenic
1072395132 10:95031810-95031832 CAGCATGGAGGGCCTTGAAGAGG - Intergenic
1072615083 10:97043754-97043776 CAGCATGGGGGACAGGGCAGTGG - Intronic
1073302002 10:102476551-102476573 CAGCCTGGAAGACATGGCAGCGG + Exonic
1074762125 10:116675021-116675043 CAGCTGGGAGGGCTTGGCCGGGG + Exonic
1076408557 10:130230259-130230281 CAGGATGGGGCACCTGGCAGGGG + Intergenic
1076729635 10:132431954-132431976 TAGCCTGGGGGGCCTGGCAGGGG + Intergenic
1077046770 11:550158-550180 CAGCGTGGAGGACCTGGGGCAGG + Exonic
1077097196 11:804091-804113 CACCTTTGAGGACCAGGGAGCGG + Exonic
1077148008 11:1054456-1054478 CATCTTCCAGGAACTGGCAGGGG - Intergenic
1077289181 11:1781002-1781024 CTGCTGGAAGGATCTGGCAGCGG + Intergenic
1077433151 11:2526042-2526064 CAGCTTGAGGGTCCTGCCAGCGG - Intronic
1078085506 11:8231096-8231118 CAGCTGGCAGGGCCTGGCTGGGG + Intronic
1078147231 11:8730305-8730327 CTCCTTGGAGGAGCCGGCAGGGG - Exonic
1078565272 11:12408997-12409019 AAGCACGGAGGACCTGGGAGAGG + Intronic
1083618613 11:64038131-64038153 CAGCTGGGCGGACCTCCCAGGGG - Intronic
1083823613 11:65186179-65186201 CAGCTACGAGGCCCTGTCAGGGG + Exonic
1084891165 11:72237772-72237794 CATCCAGGAAGACCTGGCAGAGG + Exonic
1084905431 11:72342603-72342625 CAGCTAGGAGCAACTGTCAGTGG + Intronic
1085403963 11:76250732-76250754 CTGCTTGGATGACCTGCCTGTGG + Intergenic
1087007698 11:93485481-93485503 CTGCATGGAGGAGCTGGCAAAGG - Intronic
1088889903 11:114036239-114036261 GGGCTTGGAGGACGTGGCCGCGG + Intergenic
1089964921 11:122647955-122647977 GAGCTGGCAGGACCTGGGAGGGG - Intergenic
1091332782 11:134743757-134743779 CTGCTTGGAGGACCTTGCCGGGG - Intergenic
1091883311 12:3997462-3997484 CAGTTTGGAGGACCTGGGAAAGG + Intergenic
1092112316 12:5972325-5972347 CAGATTGGAGGACCTTCTAGAGG - Intronic
1092371143 12:7917346-7917368 CAGTTTTGAGGAGATGGCAGTGG + Intergenic
1093015732 12:14152844-14152866 CACCTTGAAGGACCTGAGAGAGG + Intergenic
1095779959 12:46048628-46048650 CAGGATGGAGGACCCGGCAATGG - Intergenic
1096651525 12:53064206-53064228 CAGCTGGGTGGAACTGGCAGGGG - Exonic
1096675964 12:53226058-53226080 CATCTTTGGGGACCTGGCACAGG + Intronic
1097732921 12:63150536-63150558 CAGCCTGGCCGACCTGGCCGTGG - Exonic
1097860295 12:64512148-64512170 CATCATGGAAGAACTGGCAGAGG + Intergenic
1099687460 12:85908162-85908184 CAGCCTGCATGACCTAGCAGAGG - Intergenic
1101773662 12:107774879-107774901 CAGGCTGGGGGACCAGGCAGAGG + Exonic
1102826492 12:115951571-115951593 CAGCGGGGAGGACGGGGCAGAGG - Intergenic
1104468030 12:129005795-129005817 CAGCTTGGAGGAGGTAGCTGAGG + Intergenic
1107467476 13:40664574-40664596 GAGCATGGAGGACCAGGCGGGGG - Intronic
1108380674 13:49851200-49851222 CAACTTGGAAGACCAGGCGGAGG + Intergenic
1110707137 13:78608836-78608858 CGGCTCCGAGGACCTGGAAGCGG + Intergenic
1112322759 13:98422218-98422240 GAGCTTGGAGGGCCACGCAGTGG + Intronic
1112563709 13:100534715-100534737 CAGGTTGGGAGACGTGGCAGGGG - Intronic
1114050992 14:18919752-18919774 CAGCTTAGAGGACCGGGAATGGG - Intergenic
1114111566 14:19482170-19482192 CAGCTTAGAGGACCGGGAATGGG + Intergenic
1115140192 14:30161929-30161951 CACATTGGAGGACCAGGGAGAGG + Intronic
1117546642 14:56798575-56798597 CAGCCTGGCGGGCCAGGCAGGGG - Intergenic
1117958395 14:61140276-61140298 CAGCGGGGAGGACATGGAAGCGG - Intergenic
1119765765 14:77186730-77186752 CATCCCTGAGGACCTGGCAGAGG + Intronic
1119776461 14:77252152-77252174 CAGTTTGGAGGAGGTGTCAGAGG - Intronic
1121253395 14:92515081-92515103 CAGCTGGGAGGGACTGGGAGGGG + Intronic
1121774749 14:96583231-96583253 GTGCCTGGAAGACCTGGCAGGGG - Intergenic
1122218641 14:100221189-100221211 CCGCTTGGACGAGCTGGAAGAGG - Intergenic
1122283286 14:100636771-100636793 GAGCGTGGAGGCCCGGGCAGTGG - Intergenic
1122483668 14:102063959-102063981 CAGCCTGGAGGTCAAGGCAGAGG - Intergenic
1202848782 14_GL000225v1_random:2388-2410 CACCATGGAGTGCCTGGCAGCGG + Intergenic
1202857485 14_GL000225v1_random:59886-59908 CACCATGGAGGGCCTGGCGGTGG + Intergenic
1202863933 14_GL000225v1_random:103757-103779 CACCATGGAGGGCCTGGCGGCGG - Intergenic
1123474832 15:20582239-20582261 CAGCTTGGGTGTCCAGGCAGTGG + Intergenic
1123643179 15:22418118-22418140 CAGCTTGGGTGTCCAGGCAGTGG - Intergenic
1125757348 15:42072467-42072489 CAGGATGGGGGACCTGGCTGGGG + Intronic
1127846519 15:62875799-62875821 GGGCATGGGGGACCTGGCAGTGG - Intergenic
1128360249 15:66956853-66956875 GAGCTGGGAGGACCTAGAAGGGG - Intergenic
1128496255 15:68200294-68200316 CAGCCTGGAGGCCAGGGCAGGGG - Intronic
1128712978 15:69885838-69885860 CATCTTGGCGGCCCTGGGAGGGG + Intergenic
1128744750 15:70105779-70105801 CCACTTGGAGGAGCTGCCAGAGG - Intergenic
1129226648 15:74174241-74174263 CAGCTGAGAGGTCCTGGCGGGGG + Intronic
1129844326 15:78761304-78761326 CAGCTTGAGGGCCCTGGCTGAGG + Intronic
1131070384 15:89461988-89462010 CAGGCTGGAGGCCCTGGGAGGGG + Intergenic
1131149336 15:90037091-90037113 CAGCTTGGAGGACCTGGCAGGGG + Intronic
1131832105 15:96360654-96360676 CTGCTTGGAGGCCCAGGCTGGGG - Intergenic
1132130846 15:99277452-99277474 CAGCTTGGGGGAGGGGGCAGAGG - Intronic
1132415443 15:101615731-101615753 CACATAGGAGGACCAGGCAGAGG - Intergenic
1132522466 16:397828-397850 CAGCTGGGGGGGCCGGGCAGCGG - Intronic
1133115324 16:3575284-3575306 CTGCGTGCAGGGCCTGGCAGCGG - Intronic
1133198810 16:4189880-4189902 CAGCATGGAGGAGCAGGCAGGGG + Exonic
1134513244 16:14865715-14865737 CAGCTTGGGGCTGCTGGCAGTGG + Intronic
1134673901 16:16075947-16075969 CAGCTGGGAGGGCCGAGCAGTGG - Intronic
1134700881 16:16264204-16264226 CAGCTTGGGGCTGCTGGCAGTGG + Intronic
1134970943 16:18530455-18530477 CAGCTTGGGGCTGCTGGCAGTGG - Intronic
1136147048 16:28321865-28321887 GGGCTGGGAGGACCCGGCAGAGG - Exonic
1137454219 16:48605925-48605947 TAGCAGGGAGGTCCTGGCAGAGG - Intronic
1138509972 16:57503089-57503111 CAGCTGGGAGGACCTGGGTAAGG + Intergenic
1144312345 17:14024789-14024811 CAGCCTGGAAGACTTTGCAGGGG + Intergenic
1145077685 17:19868774-19868796 CAGCTTGCAGGGACAGGCAGTGG - Intergenic
1145090313 17:19980400-19980422 CAGCGTGCAGAACCTCGCAGGGG + Intergenic
1145766410 17:27460994-27461016 CAGCTTGCAGGACCCTGCATTGG + Intronic
1146399609 17:32492884-32492906 CAGCTGGGAGGCCCTGGCGCTGG + Exonic
1146809282 17:35890526-35890548 CTGGTTGGAGGATCTGCCAGAGG + Intergenic
1146903360 17:36602143-36602165 CACCCTGGTGGACCTGGTAGCGG - Exonic
1147250930 17:39152000-39152022 GAGCTTGGAGGAGCTGGGGGCGG - Intronic
1147350063 17:39835346-39835368 CAGCTTGGACCCCCTGGCATTGG + Intronic
1147862171 17:43530067-43530089 CAACATGGAGGGCTTGGCAGGGG + Intronic
1147936420 17:44013913-44013935 CAGCCTGCAGGGCCTGGCACAGG + Intronic
1148330472 17:46811082-46811104 CAGCCGGGAGGAGTTGGCAGGGG - Intronic
1148440106 17:47707686-47707708 CAGCAAGGAGGTCCTGGGAGGGG + Intronic
1148669931 17:49402849-49402871 CTGCTGGGAGGCCCTGGGAGGGG + Intronic
1149760625 17:59226101-59226123 CAGCTTGAAGGACCTCTCACTGG - Intronic
1150220525 17:63493457-63493479 GAACTTGGAGGACCTGGTGGTGG + Exonic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1152094702 17:78266372-78266394 CACCTGGGAGGACCAGCCAGGGG - Intergenic
1152381636 17:79945276-79945298 GATCTGGGAGGAACTGGCAGAGG - Intronic
1153435009 18:5059490-5059512 CAGCCTGGAAGGCCTGGAAGAGG + Intergenic
1155847473 18:30727633-30727655 CAGCCTGGAGGGCCTGACATTGG - Intergenic
1156148503 18:34215616-34215638 CAGCTCGGAGGACCTCGGATGGG + Intronic
1156251026 18:35352721-35352743 AAGCCTGGAGGTCCAGGCAGAGG + Intergenic
1156263548 18:35466721-35466743 CAGCAGGGAGAGCCTGGCAGGGG + Intronic
1156401660 18:36745210-36745232 CTGCTCGGTGCACCTGGCAGAGG - Intronic
1157498381 18:48172334-48172356 CAGCTTGGTGGAGCAGGCAGGGG + Intronic
1157659656 18:49429065-49429087 CAGCTTCTAGAAGCTGGCAGAGG - Intronic
1157812685 18:50709114-50709136 CAGTCTGGAGGACATGGAAGGGG - Intronic
1159798332 18:72868578-72868600 CAGCTTGGGAGACACGGCAGGGG + Intergenic
1159864779 18:73691237-73691259 CATCTTGGAGCATCTGTCAGAGG + Intergenic
1160187323 18:76685915-76685937 GTGCTTGGAGCACCTGTCAGAGG + Intergenic
1160679448 19:406097-406119 CAGCTGGGGGGACCTGGCTATGG - Exonic
1160774879 19:850817-850839 CCGCCTGGAGGAACTGGCAGGGG - Intergenic
1160976311 19:1794452-1794474 CAGCATGGAGCACAGGGCAGCGG - Intronic
1161350565 19:3789079-3789101 CAGCTTCGTGGATCTGGCTGTGG + Intronic
1162138518 19:8571162-8571184 CAGCTCGCAGGACCTGGGTGAGG - Intronic
1163202912 19:15781009-15781031 CAGCTTAGAGGACAGAGCAGAGG + Intergenic
1163585292 19:18160629-18160651 GAGCTTGGAGGCCCTGTGAGAGG - Intronic
1164734337 19:30529745-30529767 CAGCTTGTAGGCACGGGCAGAGG + Intronic
1165096651 19:33413369-33413391 CTGCCTGCAGGACCTGGCACTGG - Intronic
1166257441 19:41616648-41616670 CAGCCTGGAGGAGCTCACAGAGG + Intronic
1166409623 19:42547847-42547869 TGGCTTGGAGGAGCTGGTAGAGG + Intronic
1168141514 19:54391097-54391119 CAGCCTGGAGGACCAGGGACAGG - Intergenic
1168156918 19:54478931-54478953 CAGCCTGGAGGACCAGGGACAGG + Intergenic
1168157239 19:54481554-54481576 CAGCCTGGAGGACCAGGGACAGG + Intergenic
925158387 2:1664061-1664083 CAGCTGGGAGAACCAGGGAGAGG + Intronic
926318171 2:11726795-11726817 CAGCTTGGAGGAGACTGCAGAGG - Intronic
927471920 2:23384031-23384053 CAGCTGGGAGGAGCTGGCCTGGG - Intergenic
928225754 2:29446606-29446628 CAGCTTGGAGATCTTGGCAGTGG - Intronic
928442159 2:31301571-31301593 TAGCATGGTGGACCTGGGAGAGG + Intergenic
929948130 2:46385926-46385948 GAGCTTGGAGGACGTGGACGGGG - Exonic
931183762 2:59929839-59929861 CTGCTCTGAGGATCTGGCAGGGG + Intergenic
934177711 2:89591365-89591387 TAGCATGGAGGAACTGGCAGCGG + Intergenic
934288010 2:91665666-91665688 TAGCATGGAGGAACTGGCAGCGG + Intergenic
934309528 2:91851064-91851086 TAGCATGGAGGTACTGGCAGTGG - Intergenic
934573466 2:95385801-95385823 CAGCTGGGAGGGCTGGGCAGCGG - Exonic
934687569 2:96333095-96333117 CAGCTTGGAAGCCCTGGGGGAGG - Intergenic
935634549 2:105240056-105240078 AGGCTTAGAGGACCTGGGAGTGG - Intergenic
937148063 2:119664316-119664338 CAGCTTGGAGCTTCAGGCAGTGG - Intergenic
938180242 2:129175908-129175930 AAGTTTGGAGGACCTGGCAGTGG + Intergenic
941809493 2:169741015-169741037 CCTCTTGAAGGACCTGCCAGAGG + Intronic
942845247 2:180416635-180416657 CATCTTGGCGGATCTGCCAGTGG - Intergenic
946058362 2:216920303-216920325 CAGCTGGGAGGACCAGCCATGGG + Intergenic
946182210 2:217955525-217955547 CAGCTTGGAGGGACTGGTGGTGG - Intronic
948286598 2:236790733-236790755 CACCCTGGAGGACTTGGCAAGGG + Intergenic
948423577 2:237874923-237874945 CCTCTTGGAGGACAGGGCAGCGG + Intronic
948484277 2:238270692-238270714 CGGCTGGGAGGGCCTGGCTGGGG + Intronic
948693948 2:239723335-239723357 CAGCCTGAAGGCCCTGGGAGCGG + Intergenic
948834523 2:240619763-240619785 CAGAGTGGAGGACCTTCCAGCGG + Intronic
1169132277 20:3172580-3172602 CATCTTGGAGCACTTGGCTGAGG + Intronic
1169550041 20:6693056-6693078 CAGAGGGGAGGACCTGACAGTGG - Intergenic
1170678612 20:18504928-18504950 GGGCTTGGAGGACCCGGCGGAGG - Intergenic
1170872344 20:20218041-20218063 CAGCTTGGAGAAAGTGACAGTGG - Intronic
1170989231 20:21286927-21286949 CTGTCTGGAGGCCCTGGCAGTGG + Intergenic
1173147218 20:40535163-40535185 TAGCTAGGAAGACCTGGGAGTGG + Intergenic
1173322310 20:41999024-41999046 CAGCCTGGAGGGCGAGGCAGCGG - Intergenic
1174120978 20:48265308-48265330 CAGTTTGGAGGACATGGCCATGG + Intergenic
1174908747 20:54582640-54582662 CAGCTTGGATAACCTAGAAGAGG - Intronic
1175301608 20:57947130-57947152 CACCGTGAAGGGCCTGGCAGGGG - Intergenic
1175327172 20:58137857-58137879 GAGGATGGAGGCCCTGGCAGAGG - Intergenic
1175381714 20:58568454-58568476 CAGCTGGGAGGAACAGCCAGGGG - Intergenic
1175708931 20:61203621-61203643 CAGCTTGCATGTCCTGGCCGTGG + Intergenic
1176035358 20:63033767-63033789 CATCTTGGAGAACAGGGCAGGGG - Intergenic
1176884092 21:14233346-14233368 CAGCTTGGGGTACGTGGCTGGGG - Intergenic
1177632570 21:23746472-23746494 CTGCTTGGATGTCCAGGCAGAGG - Intergenic
1178745599 21:35247095-35247117 CAGCTTGTAGAACCTGGAATAGG + Intronic
1179902997 21:44403347-44403369 AAGAGTGCAGGACCTGGCAGGGG - Intronic
1180469470 22:15642127-15642149 CAGCTTAGAGGACCGGGAATGGG - Intergenic
1180872397 22:19153816-19153838 GAGCTGGGAGGACCTTGCAGAGG + Intergenic
1181325023 22:22038387-22038409 CAGCTGTGAGGACTTAGCAGAGG - Intergenic
1181556878 22:23676223-23676245 CAGCTTCCTGGACCTGACAGTGG - Intergenic
1181697508 22:24601360-24601382 CAGCTTCTTGGACCTGTCAGTGG + Intronic
1182225581 22:28795636-28795658 CAGCCTGGAGGAGCTCCCAGAGG - Exonic
1183513662 22:38250748-38250770 CAGCTTGGACTCCCAGGCAGAGG + Intronic
1184402701 22:44282982-44283004 CAGCTGGGAGGACCTTGGAGTGG + Intronic
1184415749 22:44350893-44350915 CACCTGGGAGGAACTGGCAGGGG - Intergenic
1184444934 22:44541464-44541486 CTGCTTGGAGGAACTGGGAAAGG + Intergenic
1184796849 22:46737933-46737955 CGGCTTGGGGGACCCGGCTGGGG - Intronic
1185068672 22:48644587-48644609 CGGCTTGGAGGAACTTGGAGAGG - Intronic
1185329865 22:50247672-50247694 CAGGTGGGAGCACCTGGGAGGGG - Exonic
1185343947 22:50303346-50303368 CAGCTTTGAGGACTTCTCAGAGG - Intronic
1185375346 22:50480480-50480502 TTGTTTGGAGGTCCTGGCAGAGG - Intergenic
950189246 3:10965296-10965318 CTGATGGGAGGCCCTGGCAGGGG + Intergenic
950325569 3:12106160-12106182 CAGCCTGGAGGAACTGGGAGTGG - Intronic
950547355 3:13646378-13646400 CAGCAGGAAGGCCCTGGCAGGGG - Intergenic
950675777 3:14553562-14553584 CAGTTTGGAGGACATGGGAGGGG + Intergenic
952981693 3:38741207-38741229 CAGCTTGGTGGACCCTGCTGCGG + Intronic
953744939 3:45567046-45567068 AAGGTTGGAGGGCCTGGCAGTGG + Intronic
956398280 3:68848777-68848799 CATGCTGGAGGACATGGCAGAGG - Intronic
958026636 3:88058383-88058405 CACCGAGGAGGACCTGGGAGGGG - Intronic
959962917 3:112320934-112320956 CAAATTGGAGGGCCTGTCAGTGG + Intergenic
960117104 3:113906248-113906270 CCGCCTGAAGGACCTGGCTGAGG - Intronic
961452915 3:127010530-127010552 CAGCTTCCTGCACCTGGCAGAGG + Intronic
962818080 3:139020511-139020533 CAGCCTGGAAGACCCGGCGGGGG - Exonic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
965083633 3:164066654-164066676 CAGATTTGAGGTCCTGGAAGTGG + Intergenic
965752443 3:171990125-171990147 CAGCCAGGAGGAGCTGGAAGAGG - Intergenic
967227435 3:187305491-187305513 CAGCTGGGAGGCTGTGGCAGTGG + Intergenic
968902096 4:3436634-3436656 CAGCTTTGAGGACCAGGGTGGGG + Intronic
969718096 4:8877989-8878011 CAGCTCGGTGGCCCTGGCACAGG - Intergenic
972862196 4:43183765-43183787 CAACTTGAAGGAGCTGTCAGTGG - Intergenic
973638819 4:52884089-52884111 CAGGCTGGAGCACATGGCAGTGG - Intronic
975312373 4:72916898-72916920 CAGCTTAGAGGAGCTGACAGTGG - Intergenic
976311161 4:83614892-83614914 ATGCTTGGTGGACCTGGGAGTGG + Intergenic
984392440 4:179153334-179153356 CATCTTGGAGAAACTGTCAGTGG + Intergenic
985789511 5:1917807-1917829 CAGCTCGGAACACCTGGCAGTGG - Intergenic
986543314 5:8870039-8870061 CCGCTTGCAGGACGTGCCAGGGG + Intergenic
986788541 5:11138499-11138521 CAGCAGGAAGGACCTGGTAGTGG + Intronic
987007921 5:13729921-13729943 CAGGATAGAGGACATGGCAGAGG + Intronic
987701054 5:21398761-21398783 CAGCTTGGATGCCCTGGAGGTGG - Intergenic
988657618 5:33229458-33229480 CACATTGGAGGTACTGGCAGGGG - Intergenic
989225435 5:39022421-39022443 CCGCTGGCAGCACCTGGCAGGGG - Intronic
992916150 5:81455031-81455053 CATCAGGGAGGACCTGGCTGAGG + Intronic
994115302 5:96055158-96055180 CAGGTGGGAGGACCTGGTAAAGG - Intergenic
994753195 5:103764181-103764203 ATGCTTGGAGGACCTGCCTGTGG - Intergenic
995556847 5:113338368-113338390 CAACTTAGAGAACCTGGCTGTGG + Intronic
997859964 5:137407449-137407471 CAGCTTGGTGTACCTGAGAGGGG + Intronic
997969887 5:138392382-138392404 GAGCCAAGAGGACCTGGCAGAGG + Intronic
998520560 5:142796686-142796708 GAGGCTGGAGGAGCTGGCAGGGG - Intronic
1002101906 5:176861942-176861964 TGGCTTGGAGGCACTGGCAGAGG - Intronic
1002246853 5:177891630-177891652 CAGGTTAGAGGACCTGGCCAAGG - Intergenic
1002381534 5:178832767-178832789 CCGCTTGGAGGACCTGGAGAAGG - Intergenic
1006563260 6:34932075-34932097 GAGATTGGAGGACCTGGCACAGG + Intronic
1007241642 6:40430902-40430924 CTGCTTAGAGGACCCAGCAGAGG + Intronic
1007391306 6:41551067-41551089 CGGCTTGGTGGAACTGGCAGTGG - Intronic
1008233294 6:49012116-49012138 CAGTTTTGAGGCCCTGGTAGAGG + Intergenic
1013236133 6:108199041-108199063 CACCTAGGAGGGCCAGGCAGTGG + Intergenic
1015657272 6:135533006-135533028 AAGCATGGGGCACCTGGCAGTGG - Intergenic
1015997817 6:139013232-139013254 CATCTTGGAAGACCTAGCAGAGG - Intergenic
1016000944 6:139040581-139040603 GAGCTTGGAGGACTTGCCTGAGG + Intronic
1016174329 6:141060212-141060234 CAACTTTGAGAACCTGGCTGAGG - Intergenic
1016210713 6:141531002-141531024 CAGCTTGGGAGACGTGGCCGGGG + Intergenic
1016285957 6:142473660-142473682 CAGCTTCCAGGAGCTGGAAGTGG - Intergenic
1016556652 6:145346302-145346324 CAGGAAGCAGGACCTGGCAGAGG + Intergenic
1016955492 6:149622743-149622765 CACCTTGGGAGGCCTGGCAGGGG + Intronic
1017477608 6:154813887-154813909 CAGCTTGTAGAACCTAGCAAAGG + Intronic
1018017124 6:159722613-159722635 CAGCTTGAAGGATCTCCCAGGGG - Intronic
1018218738 6:161557803-161557825 TAGCTTGGAGGACCTGAAAGGGG - Intronic
1018981310 6:168603759-168603781 CAGCTTGAAGGAAATGGCAGGGG + Intronic
1019221087 6:170473358-170473380 CAGCTTGTACCTCCTGGCAGTGG - Intergenic
1019967824 7:4514503-4514525 GTGCTTGGAGGACCCAGCAGAGG + Intergenic
1022498218 7:30866384-30866406 CAGCTTCCAGGAGCTGGAAGAGG - Intronic
1024356758 7:48421511-48421533 CAGCTTGAAGGACCTCCCACTGG - Intronic
1025213089 7:57032445-57032467 GATCTTGGTGGACCTGGCAGGGG - Intergenic
1025658863 7:63544379-63544401 GATCTTGGTGGACCTGGCAGGGG + Intergenic
1026541171 7:71281103-71281125 CAGGTTTGAGGAGCTGTCAGAGG + Intronic
1029676213 7:102070823-102070845 GATCTTGGATGACCTGGCAGGGG - Intronic
1029944287 7:104515534-104515556 CAACTTGGAGGAACTGGAGGAGG - Intronic
1032067583 7:128783228-128783250 CTGCCTGGAGGCCCAGGCAGAGG + Intergenic
1032073838 7:128826797-128826819 CAGCCTGGAGATCCAGGCAGTGG + Intergenic
1032267349 7:130378938-130378960 CTTCTTGGAGGACCTGTTAGAGG + Intergenic
1033125439 7:138702977-138702999 CATCTGGGAGGATCTGGAAGGGG + Intergenic
1033266934 7:139894845-139894867 CAGCATGGAGCTCATGGCAGTGG + Intronic
1033356755 7:140606634-140606656 CAGTTTGGAGGAGCTGGGAGGGG - Intronic
1034383661 7:150720460-150720482 CAGGAAGGAGGACCTGGCCGGGG + Exonic
1034414452 7:150957239-150957261 CACCTTGGAGGAGCTTGGAGAGG - Intronic
1034878009 7:154742263-154742285 TCCCTTGGAGGACCTGGTAGAGG - Intronic
1034984015 7:155496474-155496496 CTGCTGGGAGGACCCGGAAGGGG - Intronic
1037960973 8:23097992-23098014 CTGCTTTTAGGACCTGACAGAGG - Intronic
1038397986 8:27261243-27261265 CAGCTTGCAGGTCCTGGCAGTGG - Intergenic
1041440492 8:57890741-57890763 CTGCCTGGAGGACCTGCCTGAGG + Intergenic
1045846278 8:106640002-106640024 CATCTTGGAATTCCTGGCAGTGG - Intronic
1046977725 8:120300980-120301002 CAGCTTGGAGGAGCTGGGCTGGG + Intronic
1048260819 8:132943700-132943722 CAGCTTGCAGGGTCTGGCTGTGG - Intronic
1048442378 8:134469463-134469485 CAACTTGGAGGACTTGGCTTGGG + Intergenic
1048851307 8:138647704-138647726 CTTCTGGCAGGACCTGGCAGGGG - Intronic
1049414253 8:142488141-142488163 CAGCAAGGAGCACCAGGCAGAGG - Intronic
1049454273 8:142679055-142679077 CAGCTGGGAGGTGGTGGCAGTGG - Intronic
1049551906 8:143263943-143263965 GAGTTTGGAAGACCAGGCAGGGG - Intronic
1049806298 8:144542192-144542214 CATCGAGGAGCACCTGGCAGTGG - Intronic
1052512291 9:29437316-29437338 CTACTTGGAGTGCCTGGCAGTGG + Intergenic
1052872609 9:33523532-33523554 CAGCTTGGGCGCCCAGGCAGCGG - Intergenic
1052956100 9:34254289-34254311 GTGCAGGGAGGACCTGGCAGAGG + Exonic
1053072638 9:35110345-35110367 CAACTGGGATGACCTGGAAGTGG - Exonic
1053653932 9:40196946-40196968 CAGCTTAGAGGACCAGGAAAAGG + Intergenic
1053904323 9:42826121-42826143 CAGCTTAGAGGACCAGGAAAAGG + Intergenic
1054366052 9:64343162-64343184 CAGCTTAGAGGACCAGGAAAAGG + Intergenic
1054530662 9:66179393-66179415 CAGCTTAGAGGACCAGGAAAAGG - Intergenic
1054673679 9:67832892-67832914 CAGCTTAGAGGACCAGGAAAAGG + Intergenic
1054813498 9:69453385-69453407 CAGCTTGCAGGAGGTGGCACTGG + Intronic
1056756604 9:89385743-89385765 CAGCTGGGAGCAACAGGCAGAGG - Intronic
1057076448 9:92140708-92140730 AAGCTGGGATGACCCGGCAGTGG - Intergenic
1057147334 9:92767125-92767147 CAGCTTGGAGGAGCTCCCACGGG - Intergenic
1058747555 9:108006898-108006920 CTTCTCAGAGGACCTGGCAGTGG + Intergenic
1059329045 9:113523674-113523696 CAGCTGGGAGTATCTGTCAGTGG + Intronic
1060110854 9:120905285-120905307 CAGCTTGGAGGCCCAGGCTTGGG + Intronic
1061027048 9:128056474-128056496 CTGCCAGGAGGTCCTGGCAGAGG - Intergenic
1061532720 9:131227783-131227805 CAGCTCAGAGGACCTGGGAGGGG + Intronic
1061817077 9:133203920-133203942 CCACTTGGAGGGCCTGGCATGGG - Intergenic
1061897441 9:133655792-133655814 CAGCTTGGAGGAGCTGGGGCTGG - Intronic
1062409077 9:136413085-136413107 CAGCCTGGAGGAACTGACGGGGG - Intronic
1062466862 9:136685437-136685459 CAGCTAGGAAGTCCAGGCAGAGG + Intronic
1203740386 Un_GL000216v2:172259-172281 CACCATGGAGGGCCTGGCGGCGG + Intergenic
1186582947 X:10840577-10840599 TAGTTTGGAGGGGCTGGCAGAGG - Intergenic
1186636379 X:11409477-11409499 CACCTTGGAGGAAGTGGCAGGGG - Intronic
1188707782 X:33357075-33357097 CAGGTTGCAGGTCCTGGGAGAGG - Intergenic
1189711215 X:43814218-43814240 CAGCTTTGAGAACCAGGCACAGG - Intronic
1189749977 X:44211238-44211260 CAGTTTGGAGGCCAGGGCAGTGG + Intronic
1192225789 X:69226904-69226926 CCCGCTGGAGGACCTGGCAGGGG + Intergenic
1196765043 X:119235812-119235834 CAGCTTGGAGGGCCCGGGAACGG + Intergenic
1197145453 X:123167228-123167250 CATCTTTGAGGACCTGAAAGAGG - Intergenic
1198024554 X:132692579-132692601 CAGCATGGAGGATCTGGGAAGGG - Intronic
1200034692 X:153319762-153319784 CAGCTTGGATGGCCTGGCCCTGG - Intergenic
1200210811 X:154345892-154345914 CAGCTTGCAGGGCCCGGCTGAGG - Intergenic
1200220041 X:154386200-154386222 CAGCTTGCAGGGCCCGGCTGAGG + Intergenic
1201153287 Y:11107089-11107111 CAGCTTGGGCGCCCAGGCAGGGG - Intergenic