ID: 1131150534

View in Genome Browser
Species Human (GRCh38)
Location 15:90044789-90044811
Sequence TGGCTCCTCTCCTGTGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131150531_1131150534 12 Left 1131150531 15:90044754-90044776 CCTGGTTAGCACATTTACTTTAC 0: 1
1: 1
2: 1
3: 10
4: 132
Right 1131150534 15:90044789-90044811 TGGCTCCTCTCCTGTGTGCATGG 0: 1
1: 0
2: 2
3: 31
4: 284
1131150533_1131150534 -10 Left 1131150533 15:90044776-90044798 CCTGTTAAAGCAGTGGCTCCTCT 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1131150534 15:90044789-90044811 TGGCTCCTCTCCTGTGTGCATGG 0: 1
1: 0
2: 2
3: 31
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131150534 Original CRISPR TGGCTCCTCTCCTGTGTGCA TGG Intronic