ID: 1131151807

View in Genome Browser
Species Human (GRCh38)
Location 15:90051993-90052015
Sequence CTTCCTCTGCAGGTGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 275}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131151807 Original CRISPR CTTCCTCTGCAGGTGGTAGA AGG (reversed) Intronic
900205773 1:1431349-1431371 CTGCCCCTGCAGGGGCTAGAAGG - Intergenic
900295333 1:1946429-1946451 CTTCCTGTGCAGGTAACAGAAGG - Exonic
900821762 1:4895223-4895245 CTTTTTCTGCAGGAGGTAGCAGG + Intergenic
900893207 1:5464642-5464664 CTTTCCCTGCAGGCGGTGGAAGG - Intergenic
903302682 1:22390503-22390525 CACCCCCTGCAGGTGGTAGCTGG - Intergenic
904256213 1:29256645-29256667 CTGCCTCTGCAGGTGTTAGTGGG + Intronic
904342491 1:29845825-29845847 CATCCTCTGCAGGTGGGACCAGG + Intergenic
905231381 1:36516664-36516686 CTGCCTCTGCTGGTGGTATCTGG + Intergenic
907727624 1:57034481-57034503 CTCCCCCTGCAGCTGGTAGAGGG + Intronic
910566333 1:88647256-88647278 TTTCCTCTGCAGGAGGTTGTGGG + Intergenic
912672970 1:111648575-111648597 CTCCATCTGCAGGAAGTAGAGGG + Intronic
915594334 1:156887753-156887775 CTCCCTCAGCAGGAGGTTGAAGG - Intergenic
916584648 1:166139940-166139962 GTTCCTCTGGTGGTGGTAGTAGG - Intronic
917798349 1:178548264-178548286 GTTCCTCTGCAGGATGTAAAAGG + Intronic
919019036 1:192079857-192079879 CTGCCTTTGAAGGTGGAAGAAGG - Intergenic
919232275 1:194789434-194789456 CATCTTCTGCACGTGGTGGAAGG + Intergenic
920398293 1:205661861-205661883 CTGCTTCTCCCGGTGGTAGAGGG + Exonic
921213986 1:212921975-212921997 CTGCCTCCTCACGTGGTAGAAGG + Intergenic
921283348 1:213588039-213588061 CTTTGTCTTCACGTGGTAGAAGG + Intergenic
921727012 1:218534999-218535021 CTTTCTCTCAAGGTGATAGATGG + Intergenic
922767745 1:228164771-228164793 CTTCAGCTGCAGGTGGCAGGAGG - Intergenic
924482776 1:244451891-244451913 CTTCCTCTGCATGTGGCTGGCGG - Exonic
1063474754 10:6318462-6318484 CTTCTTCCCCAGGGGGTAGAGGG + Intergenic
1063882164 10:10542345-10542367 TTTCCTCATCATGTGGTAGAGGG - Intergenic
1065747637 10:28856838-28856860 CTTCCTCTGCAGCAGGGAGCTGG - Intronic
1067298484 10:44989658-44989680 CTGCCTGTGCAGGTGGAAGATGG + Exonic
1067479056 10:46583772-46583794 CTGCCTGTCCACGTGGTAGACGG - Exonic
1067615682 10:47758029-47758051 CTGCCTGTCCACGTGGTAGACGG + Intergenic
1067704762 10:48598546-48598568 CCTTCTCTGCAGGTGGCAGACGG + Intronic
1068384961 10:56314414-56314436 CCTTCTCTACAGGTGTTAGAGGG + Intergenic
1070658189 10:78285622-78285644 ATTCCTCTGCAGGTGTATGATGG - Intergenic
1071374280 10:84986772-84986794 CTTGCTCTTCAGCTTGTAGATGG - Intergenic
1071674412 10:87641240-87641262 CTGCCACTGCCTGTGGTAGAAGG - Intergenic
1073208525 10:101781098-101781120 CAGTCTCTGCAGGTGGGAGAGGG - Intergenic
1074526777 10:114269619-114269641 CTTCCCCTGAAGGTGGTAGATGG + Intronic
1075002552 10:118809144-118809166 CTTCCTGTGCAGGTGGCCAATGG + Intergenic
1075685809 10:124364507-124364529 CTGCTGCTGCAGGAGGTAGATGG - Intergenic
1075930394 10:126290109-126290131 CTTACTCTGAAGGTGCCAGAAGG + Intronic
1075957239 10:126534621-126534643 CTTCCTTTGGAAGTGGAAGAAGG - Intronic
1076345854 10:129778542-129778564 TGTCCTCTGCAGGTGTGAGACGG - Intergenic
1076500937 10:130935449-130935471 CTTCTTCTGCCTGTGGTGGAAGG + Intergenic
1076693083 10:132233642-132233664 CATCCACTGCAGATGGCAGAGGG + Intronic
1077154371 11:1084854-1084876 CTTCGTCGGCCGGTGGTAGCAGG + Intergenic
1078902150 11:15651290-15651312 CTTCCTCTCCCGGAGGCAGACGG + Intergenic
1079399933 11:20098653-20098675 CTTGCTCTGCAGGTGGCAAGTGG + Intronic
1080031111 11:27662113-27662135 CTGCCTCAGCAGGAGGTAGCTGG + Intronic
1080168146 11:29265381-29265403 TTTCTTCTTCAGGTAGTAGAAGG + Intergenic
1080634083 11:34108068-34108090 CTTCCTGTGGAGCTCGTAGAGGG + Intronic
1080692071 11:34566576-34566598 GTACATCTGCAGGTGGAAGAAGG - Intergenic
1081685057 11:45036566-45036588 CTTCATCTGCAGGATGGAGATGG - Intergenic
1086549240 11:88035509-88035531 CTTGCTCTTCAGCTGGCAGATGG - Intergenic
1086663229 11:89447866-89447888 CCACCTCTGCAGGTGTTAGATGG - Intronic
1087273991 11:96141874-96141896 CTGTCTCTGCAGGTGCTAGCGGG + Intronic
1087377969 11:97367967-97367989 CTTCATCTGCAGGGGGTAGATGG - Intergenic
1089172621 11:116525993-116526015 CTTCCTCTGCAAGCTGGAGAAGG + Intergenic
1089395997 11:118136576-118136598 CTTCCTTTGGAGGTGGGAGTGGG - Exonic
1090627683 11:128620312-128620334 GTGCCTGTGCAGGTGGGAGAAGG - Intergenic
1090828958 11:130407687-130407709 CTTACTCTGCAGGAAGTACATGG + Intronic
1091371783 11:135066425-135066447 CTTCATTTGAAGGTGGGAGAAGG + Intergenic
1092057364 12:5519116-5519138 CAACCACTGCTGGTGGTAGAGGG + Intronic
1092090830 12:5802452-5802474 CCTCCCCTGCAGGTGACAGAAGG - Intronic
1095799890 12:46260870-46260892 CTGCCTCTATAGGTGGGAGAGGG - Intronic
1096579218 12:52573658-52573680 CTTACTGTGCAGCTGGCAGAGGG - Exonic
1097750419 12:63346283-63346305 CTTCCTATGCATGAGGTATAAGG + Intergenic
1099968617 12:89477507-89477529 CTTCCTCTTCAAGAGGAAGAGGG - Intronic
1100437165 12:94582221-94582243 CTTCTTCTGCAGCTGGGCGATGG + Exonic
1100975090 12:100113924-100113946 CTTGATCTGCAGGTATTAGATGG + Intronic
1101713750 12:107292568-107292590 CTCTCTCTTCAGGTGGCAGATGG - Intergenic
1102227788 12:111241118-111241140 CTTCCTCTTGGGGTGGTAGGTGG + Intronic
1102429880 12:112875072-112875094 TTTCCTCTGCAGGTTTGAGACGG + Exonic
1102872738 12:116426685-116426707 CCAACTCTGCAGGCGGTAGATGG + Intergenic
1104128086 12:125866302-125866324 CTTCCTCAGAAGCTGGGAGAGGG + Intergenic
1106497351 13:30292427-30292449 CTTCCTTTGCAGGTGTTACATGG - Intronic
1109826553 13:67728843-67728865 CTTCCTCTGCAGGTGGGACATGG - Intergenic
1110987298 13:81986554-81986576 ATTCCTCTACAGGTGGTGGAGGG + Intergenic
1112687372 13:101845863-101845885 TTTCCTTTGCAGGGGGTAGGTGG + Intronic
1112746696 13:102534992-102535014 CATCCTCTGCAGGTGGATGAAGG + Intergenic
1112809102 13:103197024-103197046 CCTGCTTTGCAGGTGGGAGATGG + Intergenic
1113803178 13:113096837-113096859 CTACCCCTGCAGGTCGGAGAAGG - Exonic
1115246936 14:31305210-31305232 CTTGCTCTGCTTCTGGTAGATGG + Intronic
1116861593 14:50000167-50000189 CGTCCTCTGACGGTGGAAGAGGG - Intronic
1117978500 14:61320895-61320917 CTTCCTCTGCGGGTGGTTTCTGG - Intronic
1118546570 14:66896040-66896062 CTGCATCTTCACGTGGTAGAAGG + Intronic
1118741189 14:68740614-68740636 GTTCCTCTAGAGATGGTAGAAGG + Intergenic
1118862475 14:69675239-69675261 CTTGGTGTGCAGGTGGAAGAGGG + Intronic
1119072950 14:71606303-71606325 CTTCCTCTGCTGGAGGAAGGGGG + Intronic
1119907241 14:78317054-78317076 CTTCCTCTCCAGTTTGCAGACGG - Intronic
1120183669 14:81370384-81370406 CTTTCTTTGCAGGTGGAATATGG - Intronic
1121602736 14:95218152-95218174 CTCCCTCTGCGGCTGGGAGAAGG + Intronic
1122134533 14:99625251-99625273 CCTCCTCTGCAGATGGGAGGAGG - Intergenic
1123694777 15:22870954-22870976 CTACCTATGCAGGTGGTAAGGGG + Intronic
1124035741 15:26052355-26052377 CTTCCTTTGCAGGCAGTGGAAGG + Intergenic
1124940535 15:34213516-34213538 CTTCCTTTGCAGGCTGTGGAAGG + Intergenic
1125619614 15:41048266-41048288 CTTACTTTGCAGGTGGTTAAGGG - Exonic
1126309623 15:47300902-47300924 AGTCCTCTGCAGGTGGTTTAGGG - Intronic
1127509085 15:59622548-59622570 CCTCCTCTGAAGGAGGTAGAAGG + Exonic
1129016793 15:72475148-72475170 CTGCCTCTGCTGGGGATAGAGGG + Intronic
1129889372 15:79060999-79061021 TTTTCTCTGCTGGTTGTAGAAGG + Intronic
1130722960 15:86407966-86407988 ACTCCTCTGCAGGAGGGAGAAGG + Intronic
1131151807 15:90051993-90052015 CTTCCTCTGCAGGTGGTAGAAGG - Intronic
1131220759 15:90582130-90582152 CTTCCTCTGGAGGAGATAAATGG + Intronic
1131401119 15:92126313-92126335 CTCCCTCTGCAGTAGGTTGAGGG + Intronic
1132355423 15:101168039-101168061 CTTCCTCTTCAGGAGGAGGAGGG + Intergenic
1133014640 16:2933771-2933793 CTTCCTCTACCGGCGGGAGAAGG + Exonic
1133015363 16:2937176-2937198 CTTCCTCTACCGGCGGGAGAAGG + Exonic
1133015644 16:2938248-2938270 CTTCCTCTACAGGAAGGAGAAGG + Exonic
1133345073 16:5064481-5064503 CTTCAGCTGCAGCTGGTGGATGG - Intronic
1134030492 16:10988661-10988683 CTGCCTCTGGAGGTGGAACATGG - Intronic
1136861726 16:33708030-33708052 TCTACACTGCAGGTGGTAGAGGG + Intergenic
1137637134 16:49996345-49996367 CTGCCTGAGCAGGTGGAAGAGGG - Intergenic
1140415033 16:74768452-74768474 AAGCCCCTGCAGGTGGTAGAGGG + Intronic
1141840454 16:86571023-86571045 CTTCTTCTGCAGCTTGGAGAGGG - Intergenic
1141908962 16:87045585-87045607 GTTCCTGTGGAGGTCGTAGAGGG - Intergenic
1142546987 17:711436-711458 CCTCCTCTTGATGTGGTAGAAGG - Intronic
1144633607 17:16889012-16889034 CTTCCTCTGCAGCTGGAAGGGGG + Intergenic
1146759101 17:35460626-35460648 CTTCCTCCGCAGGTGGCTGGAGG - Intergenic
1148533436 17:48417267-48417289 TTTCCTCTACAGGAGGTAGAAGG - Intronic
1148863044 17:50614465-50614487 CTTCCTCAGCACCTGGAAGAGGG + Intronic
1150126351 17:62637797-62637819 CTTGCTCTGGAGGTGTTTGAGGG - Intronic
1151723327 17:75870587-75870609 CTTCCTCTGTAAATGGTAGTGGG + Intergenic
1151903504 17:77033295-77033317 CTTCCACTGAAGGTGGTAACAGG - Intergenic
1152297208 17:79474991-79475013 CTTGCTCTGCCTGTGGGAGAGGG - Intronic
1152337546 17:79707069-79707091 CTTCTTCTGGAGGTGCCAGATGG - Intergenic
1152549352 17:81021595-81021617 GGGCATCTGCAGGTGGTAGAGGG - Intergenic
1152559632 17:81071532-81071554 CTTTCTCTGCTGGTGGAAGAGGG - Intronic
1152798979 17:82322365-82322387 CTTCTTCTGCAGGGGGAGGAAGG + Exonic
1153468621 18:5417386-5417408 TTTCCTCTGCAGGTGGCGGAGGG + Intronic
1153668657 18:7389689-7389711 CTTCCTCTGAAGATGGTAGTTGG - Intergenic
1153748628 18:8206999-8207021 CTTCCTCTACAGGTTTCAGAGGG + Intronic
1153777486 18:8466683-8466705 CTTCCACAGAAGGTGGGAGATGG - Intergenic
1154092611 18:11379153-11379175 CTTCCTGTGCAAATGGCAGAAGG + Intergenic
1155269445 18:24125521-24125543 CATCCTCTGCAGGTTGGGGAAGG - Exonic
1156772162 18:40741779-40741801 CTTTGGCTGCAGGTGGTACAAGG - Intergenic
1157049329 18:44142681-44142703 ATTCCTCTGCAGCTGGTATACGG - Intergenic
1157744248 18:50120841-50120863 CTTCCTGGTCAGCTGGTAGATGG + Intronic
1158866572 18:61643508-61643530 CTTCCTCTACAGGTGTCAGAGGG + Intergenic
1160365320 18:78319629-78319651 CTCCTTCTGCAGGTGGAGGATGG + Intergenic
1161201075 19:3015169-3015191 CTGCCCCTGTAGGTGGGAGAAGG + Intronic
1161393596 19:4033487-4033509 GTTCATCTGCAGGTAGAAGACGG - Exonic
1161578418 19:5067463-5067485 CGTGCTCTGAAGATGGTAGAAGG + Intronic
1162957374 19:14106961-14106983 CCCCCTCTGCCGGTGGCAGAGGG - Intronic
1163751379 19:19080275-19080297 CTTCCTCAGCAGGTGACTGAGGG + Intronic
1165025724 19:32959853-32959875 CTTCCTCTGAGAGTGGAAGAGGG - Intronic
1166651294 19:44577112-44577134 CTCCCTCTGCAGGTTCTAGGAGG - Intergenic
1167528981 19:50003057-50003079 CTTCATCTGCAGAGGGGAGATGG - Intronic
1168552258 19:57306280-57306302 CATCCTCTGAAGGTGGAGGATGG - Intergenic
925016480 2:529541-529563 CTCCTACTGCTGGTGGTAGAGGG - Intergenic
925187225 2:1856995-1857017 CTTGCTCTGCAGGTGATGGTGGG - Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925895873 2:8471563-8471585 GTCCCTTTGCAGGTGGTATAGGG - Intergenic
926303259 2:11618801-11618823 CGTCCACTGCCGGTAGTAGAGGG - Exonic
927694398 2:25230417-25230439 CTTCCCCTGCAGGTGCCAGGTGG - Exonic
932290497 2:70573513-70573535 CTTCCTCGGCAGGTGATAAATGG + Intergenic
932803278 2:74761750-74761772 CTTCCTCTCCTGGAGGGAGAGGG - Intergenic
935317149 2:101846523-101846545 CAGCCTCTGCATGTGGTAGGTGG + Intronic
936072521 2:109380785-109380807 CTGCCTATGCAGGTGGTGGGGGG - Intronic
938781173 2:134586331-134586353 TTTCCTCTGCAGCCTGTAGAAGG - Intronic
939095846 2:137832262-137832284 CTCCCTCTCCAGGTGGTTGTAGG - Intergenic
939896386 2:147796541-147796563 CTTACTCTGCAGGTGGGGGTGGG - Intergenic
940769142 2:157821732-157821754 ATTCCTGTGCAGGTGGTTGGAGG + Intronic
941165101 2:162075455-162075477 CTTCCTCAGCAGTTGGAAGAGGG - Intergenic
945069405 2:205975889-205975911 CTGCCGCTGCTGGTGGTACAGGG + Intergenic
945753649 2:213819427-213819449 CTTCCTTTTCAGAAGGTAGATGG + Intronic
946542858 2:220704792-220704814 CTTTCTCTGAAGTTGTTAGAGGG + Intergenic
946661007 2:221999409-221999431 CTGCCTCTGCAGATGGAATATGG + Intergenic
947647475 2:231754244-231754266 TTTACTCTGCAGTTGGTACATGG - Intronic
1168750923 20:280454-280476 CTTGCTCTGCAGGTGGCACATGG + Intronic
1169360920 20:4948233-4948255 CTTTCTCTGCAGGTGAAAGAAGG - Intronic
1171947147 20:31388797-31388819 CCTCTCCTGCAGCTGGTAGATGG + Intronic
1172073005 20:32272383-32272405 CTTCCACTGCAGGTAGGAGATGG + Intergenic
1172624154 20:36337761-36337783 CTGCCTCTTCTGGTGGGAGAAGG + Intronic
1172866847 20:38106661-38106683 CTTCCCCTGGAGGTGGTAACAGG - Intronic
1172931869 20:38592113-38592135 CTTCCTCTGCAGGGTTTGGAGGG - Intergenic
1173461977 20:43250172-43250194 CTTCCTCTGCTGGTGGTGCTAGG - Intergenic
1173618325 20:44417384-44417406 CATTCTCTGCAGGGGGTACAAGG - Intronic
1173628862 20:44494678-44494700 CCTCCTCTGCAGGTGAGGGAGGG + Intergenic
1174342777 20:49908172-49908194 CTTCCTCTACCCGTGGAAGAAGG - Exonic
1174666205 20:52260346-52260368 CTTCCTCTTCAGCTTGCAGATGG + Intergenic
1175146858 20:56903552-56903574 CTTGCTCTCATGGTGGTAGAAGG - Intergenic
1175208711 20:57332684-57332706 CTTCCCCTAAAGGTGGCAGAAGG - Intronic
1176420202 21:6507997-6508019 CTTCTTCTGCAGCTTGCAGACGG + Intergenic
1178498822 21:33109513-33109535 CTTCGTCTGCAGATGGTATTTGG - Intergenic
1179695694 21:43116317-43116339 CTTCTTCTGCAGCTTGCAGACGG + Intergenic
1180176639 21:46093741-46093763 CTTCCTCTGCAAGTGGTGGCAGG + Intergenic
1180396324 22:12346435-12346457 TTTCCTCTGTAGGTGGCAAAGGG + Intergenic
1180403388 22:12517656-12517678 TTTCCTCTGTAGGTGGCAAAGGG - Intergenic
1180692613 22:17729872-17729894 CTTCCACTGCTGGAGGCAGAGGG - Intronic
1180824241 22:18851943-18851965 CTGACTCTGCAGGTGGGACAGGG - Intronic
1181124669 22:20695097-20695119 CTGACTCTGCAGGTGGGACAGGG - Intergenic
1181188495 22:21122605-21122627 CTGACTCTGCAGGTGGGACAGGG + Intergenic
1181210705 22:21287888-21287910 CTGACTCTGCAGGTGGGACAGGG - Intergenic
1181398805 22:22639000-22639022 CTGACTCTGCAGGTGGGACAGGG + Intergenic
1181501536 22:23318356-23318378 CTGACTCTGCAGGTGGGACAGGG + Intergenic
1181650617 22:24257059-24257081 CTGACTCTGCAGGTGGGACAGGG - Intergenic
1181706764 22:24653679-24653701 CTGACTCTGCAGGTGGGACAGGG + Intergenic
1182966024 22:34521749-34521771 CTTACTCTTCAGGTTGCAGATGG + Intergenic
1183318580 22:37149959-37149981 CTTCCTGTGCAGAGGATAGAGGG + Exonic
1184192000 22:42901158-42901180 CTTCCTCTCCAGGGTGCAGAGGG - Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184383014 22:44157970-44157992 CTTTCTCTGCAGTTTGCAGATGG + Exonic
1203216242 22_KI270731v1_random:7542-7564 CTGACTCTGCAGGTGGGACAGGG + Intergenic
1203274378 22_KI270734v1_random:77847-77869 CTGACTCTGCAGGTGGGACAGGG - Intergenic
950169866 3:10830942-10830964 CTTCCTCCGGAGGTGGAAGCTGG + Intronic
951570665 3:24059416-24059438 CTTCCTCTCCTCGTAGTAGAAGG + Intergenic
951637872 3:24799284-24799306 CCACCTCTGGAGGTTGTAGAGGG - Intergenic
952760540 3:36909490-36909512 CTTCCTCTCAAGATGGCAGAGGG + Intronic
953390032 3:42528514-42528536 CTGGCTATGCAGGTGGCAGATGG - Intronic
955193167 3:56781191-56781213 ATTCCTCTGCAGGTTTCAGAGGG + Intronic
955536594 3:59930200-59930222 CTCACTCTCCAGGTGGGAGAAGG - Intronic
955584645 3:60463126-60463148 CTTCATTTGTAGGTGGCAGAAGG + Intronic
958103964 3:89049294-89049316 CTTCCCCTGCTGGTGGGACAAGG + Intergenic
960370861 3:116837282-116837304 CTACATCTGAATGTGGTAGATGG + Intronic
964203618 3:154146200-154146222 CTACATCTTCACGTGGTAGAAGG + Intronic
964876282 3:161372055-161372077 CGTCCTTTGGCGGTGGTAGAGGG + Exonic
965052666 3:163671064-163671086 GTTCCTGTGGAGGTGGCAGAGGG + Intergenic
965528696 3:169748907-169748929 CATCCTCTGTAGGTGGTTTAAGG + Intergenic
965812262 3:172603466-172603488 CTTCCTCTTCAGCTGGAAGAAGG - Intergenic
966516639 3:180828255-180828277 CTTCCTCTACAGGAAGGAGAAGG - Intronic
967155556 3:186688570-186688592 CTCACTCTTCAGATGGTAGAAGG + Intergenic
967302777 3:188032011-188032033 CTTCCAGGGCAGGTGGAAGATGG - Intergenic
967380185 3:188849058-188849080 CTCCCACTGAAGGAGGTAGAAGG + Intronic
969675359 4:8611455-8611477 CTTCCACTGCAGTTGGCAGAGGG - Intronic
970384528 4:15542896-15542918 CGTCCTCTACAGGTTGTAGAAGG - Intronic
973777681 4:54258061-54258083 ATTCCTGTGCAGGGGGTAGGAGG - Intronic
974017327 4:56659431-56659453 GTTACTCTGAAGGTGGTAGAAGG + Intronic
976694760 4:87907700-87907722 CTTCCTCTGCAGGTTTCTGAGGG - Intergenic
979746376 4:124218596-124218618 TTTACTCTGCAGAAGGTAGAGGG + Intergenic
980495871 4:133587137-133587159 GTTGCTCTGCAAGTGGCAGAGGG + Intergenic
983276610 4:165625201-165625223 ATTCCTCTGCAGGTTTAAGATGG + Intergenic
988661087 5:33269349-33269371 TCTCCTTTGCATGTGGTAGAAGG - Intergenic
989985256 5:50689753-50689775 CTTCCTCCTCAGTTGGTAGAAGG + Intronic
989989002 5:50739236-50739258 CTTCCTCTCCACCTGGGAGAAGG + Intronic
990712786 5:58604197-58604219 ATTCCACTGGAGGTGGCAGAGGG + Intronic
991247888 5:64526922-64526944 TTTGCTTTACAGGTGGTAGAGGG - Intronic
994233732 5:97338098-97338120 CTACCTTTGCAGTTGGTGGATGG + Intergenic
996119151 5:119651527-119651549 CTTTCTCTGAAGGTTGTGGATGG + Intergenic
996329550 5:122312906-122312928 TTTCATCTGCAGGTGGTAAGTGG + Intronic
997233789 5:132261071-132261093 CTGCCTCACCAGGTGGTTGAGGG + Intronic
997658688 5:135574026-135574048 CTTCCTTCGCAGGTGCTGGAAGG - Intronic
999715465 5:154356646-154356668 CTCCCCCTGAAGGTGGGAGAAGG + Intronic
1001751074 5:174131862-174131884 CTTTCTCTGCAGGTTTCAGAAGG + Intronic
1003194567 6:3903319-3903341 CTTCCTGAGCAGGTAGTACAAGG + Intergenic
1003628355 6:7764288-7764310 CTTTTTCTGGAGGTGGTGGAAGG + Intronic
1004294328 6:14396497-14396519 CTTCCTCTGCAGGCTGTAATAGG + Intergenic
1005072544 6:21874923-21874945 GTTCCAGTGGAGGTGGTAGAGGG - Intergenic
1005722527 6:28616952-28616974 CTTCCACAGCAGTTTGTAGAAGG + Intergenic
1006164402 6:32056163-32056185 CTTCCTCTGCAGCTGAGAAAAGG + Intronic
1006367071 6:33621972-33621994 CTTCCTTTGCAGGTGGTCCCGGG + Intronic
1007193343 6:40038624-40038646 CTGCCTCTGGAGGGGCTAGAGGG - Intergenic
1009810516 6:68657520-68657542 CCTCCTCTGCAGGTGATAGGTGG + Intronic
1015873298 6:137798642-137798664 TTTCCTCTGAAGGGGGGAGATGG + Intergenic
1017371670 6:153717095-153717117 CTTTCTCTGAAGGTGACAGATGG + Intergenic
1018046666 6:159971287-159971309 CTTCATCTCCAGGTGGAACACGG + Intronic
1018425612 6:163677638-163677660 CTTACTCTGCAGCTTGCAGACGG + Intergenic
1019382218 7:729711-729733 CTTCCAGTGCTGGTGGGAGATGG - Exonic
1019724873 7:2595950-2595972 CTTGCACTTCTGGTGGTAGAAGG + Intronic
1019892865 7:3960537-3960559 CTTCCAGTCCTGGTGGTAGAGGG + Intronic
1020480500 7:8654550-8654572 CATCCCCAGCAGTTGGTAGAAGG + Intronic
1020984121 7:15111110-15111132 CTTCCTCTGCAGATTTAAGAGGG - Intergenic
1021315688 7:19144982-19145004 CTTCCTCCGCAGCTGGTCAAAGG + Exonic
1024472470 7:49777192-49777214 CGCCCTCTGCAGGTGGGAAAAGG - Intronic
1026271273 7:68839190-68839212 ATTCCTCTGCATGATGTAGATGG - Intergenic
1026334942 7:69385970-69385992 ATTCTTCTGTAGGTGGTAGATGG - Intergenic
1030689843 7:112520912-112520934 CTGCTCCTGCAGGTGGTAGCAGG + Intergenic
1032739008 7:134720297-134720319 TTTCCTCTGCAGGAAATAGAAGG - Intergenic
1032961590 7:137041633-137041655 CTGCTTCTTCATGTGGTAGAAGG + Intergenic
1032966278 7:137102246-137102268 CTGCCTGTGAAGGTGGAAGAAGG + Intergenic
1032986446 7:137343144-137343166 CTTGCTCTCCAGCTGGTAGCTGG + Intronic
1034530413 7:151692992-151693014 CTTCCCCTGCTGTTGGGAGAAGG + Intronic
1034943801 7:155249207-155249229 CTCCTTCTTCAGCTGGTAGATGG + Intergenic
1035301213 7:157898504-157898526 CATCCTCTGCGGGTGGGAAACGG - Intronic
1036289848 8:7477746-7477768 CTTCCCCTCCAGGTGGGATATGG - Intergenic
1036331631 8:7833781-7833803 CTTCCCCTCCAGGTGGGATATGG + Intergenic
1036526375 8:9538621-9538643 CTTCCTTTGCAAGTTGTGGATGG + Intergenic
1036625743 8:10469817-10469839 CTTCCTTTCCATGTTGTAGAAGG - Intergenic
1038750627 8:30292161-30292183 CTGCCTCTGCTCATGGTAGAAGG + Intergenic
1039676353 8:39672285-39672307 CTTCCTCTGCAGGTCAGAGTGGG + Intronic
1042817691 8:72895381-72895403 CTGCCTTTGAAGGTGGAAGAAGG + Intronic
1044634821 8:94311819-94311841 CTTCCCCTGGAGGTGGGACAAGG - Intergenic
1046856356 8:119036578-119036600 CTTCCTTTACAGCTGGTTGAGGG + Intronic
1048069413 8:131005819-131005841 CTTCCTCTGCAGCTAGTCCATGG + Intronic
1048344308 8:133565469-133565491 CTTCTTCTGGGGGTGGTAAATGG + Intronic
1049261131 8:141639797-141639819 CTGCCTAAGCAGGTGGTAGACGG - Intergenic
1049367042 8:142244856-142244878 CTTCCGCTGCAGGTGCAGGAAGG - Intronic
1051522449 9:18004372-18004394 CTCCTTCTGCAGGTGGTAAGGGG + Intergenic
1052101024 9:24446437-24446459 CTTCTGCTGCAGGTGATAGCAGG + Intergenic
1052465376 9:28822720-28822742 CTTCCTCCTCAGGTTGCAGACGG + Intergenic
1053461270 9:38273224-38273246 TTACCTTGGCAGGTGGTAGAAGG + Intergenic
1056838675 9:89979839-89979861 CTTCCACTGCAGGTAGTGGTAGG - Intergenic
1056845774 9:90037047-90037069 CTTCTTCTGCAGGTTCCAGATGG - Intergenic
1057710753 9:97441316-97441338 CTTCCTCAGCAGGTAGAAAACGG + Intronic
1057816987 9:98303214-98303236 CTCCCTCTGCATCTGGTAGCTGG - Intronic
1059294770 9:113260416-113260438 CTTCCTCTTCAGCTGGAAGAAGG + Exonic
1059424869 9:114214717-114214739 TTTCCTCTGGAGGTTGAAGATGG - Intronic
1060157099 9:121327449-121327471 CAACCTGTGCAGGTGGCAGAAGG + Exonic
1061078339 9:128355243-128355265 TGTCCTCTGGAGGTGGGAGAAGG - Intronic
1062412759 9:136433269-136433291 CCTCCTCTGCAGGCGGGAGTGGG - Exonic
1062577461 9:137215317-137215339 CTGCCTCTGCGGGAGGTAGGTGG + Intronic
1203489581 Un_GL000224v1:90691-90713 CTTCCTATGCAGGTCGGTGAGGG - Intergenic
1203502203 Un_KI270741v1:32579-32601 CTTCCTATGCAGGTCGGTGAGGG - Intergenic
1191998611 X:67123971-67123993 CTTCCTCTGGAGGGTGAAGAGGG + Intergenic
1192185822 X:68946235-68946257 CCTCCTCTGCATGGGGTGGAGGG - Intergenic
1193698834 X:84739919-84739941 CTTCCTCTCCAGGAAGTAGCAGG + Intergenic
1193819729 X:86147734-86147756 CTTGCTCTGTGGGTGGCAGATGG - Intergenic
1194896298 X:99445169-99445191 ATTCATCTGCAGTTGTTAGATGG + Intergenic
1197017948 X:121650116-121650138 CTGCCTCTGGAGTTTGTAGAAGG + Intergenic
1197422663 X:126257963-126257985 GTTCCTGTGCCGGTGGTAGCAGG + Intergenic
1197559375 X:127999188-127999210 CTTCATCTGCAGCTGGAATAGGG - Intergenic
1201968281 Y:19762573-19762595 CTTCATATGCGGGTGGTAGCAGG + Intergenic
1202036749 Y:20644189-20644211 TTTTCTCTCCAGGTGGAAGACGG + Intergenic