ID: 1131152305

View in Genome Browser
Species Human (GRCh38)
Location 15:90054624-90054646
Sequence CTTGAACTTCATCAGGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131152305 Original CRISPR CTTGAACTTCATCAGGGCCT GGG (reversed) Intronic
900309805 1:2028266-2028288 CTTGAAGTTCATCAGCTCCGTGG - Exonic
900927090 1:5712536-5712558 CTTGATCTACAGCATGGCCTTGG - Intergenic
901238919 1:7681710-7681732 CTTGAAGTTCAGCACGGCCCTGG - Intronic
903915670 1:26762446-26762468 CTTGCCCTACTTCAGGGCCTGGG - Intronic
906110499 1:43319024-43319046 CCTGAACTTGGTCAGGGCCCAGG + Intronic
907491880 1:54813824-54813846 CTTGAAATTCATCAGTTCCCTGG - Exonic
909185221 1:72479112-72479134 CTTATACTTCAACATGGCCTGGG + Intergenic
909329799 1:74397428-74397450 GCTGACCTTCATCAGGGCCCTGG + Intronic
910362379 1:86426451-86426473 CTTTAACTTCTTCAGGACATTGG - Intronic
912929197 1:113941282-113941304 CTTGAGCTTCATCAAGGCTGTGG - Exonic
914347432 1:146811845-146811867 GATGAACTTCAGCAGGGCCAAGG + Intergenic
914728171 1:150346411-150346433 CTTAAATTTCTTCTGGGCCTTGG - Exonic
916646982 1:166796522-166796544 CTCCAACTTCATCAAGGCCATGG + Intergenic
918446764 1:184624530-184624552 CTTGACCTTCATGGGGGTCTGGG + Exonic
919473111 1:198003264-198003286 CTTGAACTTCTTCAAGGATTTGG - Intergenic
919579260 1:199350941-199350963 CTTGAACTTCATGAATACCTAGG + Intergenic
921613983 1:217245003-217245025 CTTGAACTCCAAGAAGGCCTCGG + Intergenic
923128942 1:231057937-231057959 CTAGATTTTCATCTGGGCCTGGG - Intergenic
924602148 1:245500675-245500697 CTTGAACTTCACCAGGGCGAGGG + Intronic
1063331077 10:5159988-5160010 TTTGCACTTCTCCAGGGCCTGGG + Intergenic
1063342687 10:5282881-5282903 TTTGCACTTCTCCAGGGCCTGGG + Intergenic
1064719620 10:18215805-18215827 CTTAAACATCAACATGGCCTTGG - Intronic
1065624020 10:27612467-27612489 CTCAGGCTTCATCAGGGCCTGGG + Intergenic
1067079424 10:43204861-43204883 CCTGGACTACCTCAGGGCCTTGG + Intronic
1068217347 10:53999745-53999767 TTTGAACCTGTTCAGGGCCTGGG + Intronic
1071918904 10:90327446-90327468 ATTGAAGTTAATCAGGGCCTGGG + Intergenic
1072945870 10:99809503-99809525 CTAAGACTTCATCAGAGCCTGGG + Intronic
1073437382 10:103527719-103527741 CTCCATCTTCAACAGGGCCTGGG - Intronic
1074120232 10:110488562-110488584 CTTGAACTTCATCTGTGGCAGGG - Intergenic
1077151536 11:1075133-1075155 CTTGAAAGTCAGCAGGGCCGGGG - Intergenic
1084572364 11:69967391-69967413 CCTGAGCTTCATCAGGTCCTAGG + Intergenic
1085454463 11:76657796-76657818 CCTTAACTTCCTCTGGGCCTTGG + Exonic
1086952194 11:92902194-92902216 CCTGAAATTGATCAGAGCCTTGG - Intergenic
1088814086 11:113409899-113409921 CTGGAACTCTATCTGGGCCTGGG - Exonic
1089357034 11:117860691-117860713 CTTGACCTTGATCATAGCCTTGG - Intronic
1091371747 11:135066166-135066188 CGTGAGCTTCACCAGGGCCCTGG + Intergenic
1091839331 12:3608367-3608389 CTGGGACTTCATCAAGGCTTTGG - Intronic
1092570348 12:9714704-9714726 CTGGAAATTCATCAGGAACTGGG + Intergenic
1092605040 12:10109495-10109517 CTGTAAATTCATCAGGTCCTAGG - Intronic
1096525006 12:52205244-52205266 CCTGAAACTCATCTGGGCCTAGG - Intergenic
1097083618 12:56451271-56451293 CTGGAGCTTCTACAGGGCCTGGG + Exonic
1097978998 12:65717786-65717808 CTTGAACTGAATCAGTTCCTGGG - Intergenic
1101299675 12:103466208-103466230 CTTTAACTCCATCTGGTCCTGGG + Intronic
1104990816 12:132622884-132622906 CACTAACTGCATCAGGGCCTGGG + Intergenic
1105587691 13:21760079-21760101 TTTGAACACCATCCGGGCCTTGG + Intergenic
1105608358 13:21945857-21945879 CTTGATCCTCATGAGGTCCTGGG - Intergenic
1111558152 13:89908824-89908846 CTTGTATTTTATCAGGCCCTGGG + Intergenic
1111956529 13:94765152-94765174 CTTGAACTTCATCAATGCCCAGG - Intergenic
1112548577 13:100396905-100396927 TTTGAACCACAGCAGGGCCTTGG - Intronic
1113906579 13:113822136-113822158 CTTGATCTCCATTAGGGCCAAGG + Exonic
1113986929 13:114324822-114324844 CTTCAGCATCATCAGGACCTTGG + Exonic
1114499074 14:23154667-23154689 CTGGAACCTTATCAGAGCCTTGG - Intronic
1119544982 14:75465037-75465059 CTTGAACTTCATCAATGGATAGG - Intronic
1119928858 14:78524780-78524802 CTTGAACTCCACCTGGACCTAGG + Intronic
1122205939 14:100147970-100147992 CTTGAACTTCACCACAGCCCAGG - Intronic
1126622132 15:50650735-50650757 CTTAAACTTTGTCAGGGCATGGG - Intronic
1127697355 15:61463362-61463384 TTTGAACAACATCAGGGCCTTGG - Intergenic
1131152305 15:90054624-90054646 CTTGAACTTCATCAGGGCCTGGG - Intronic
1131536294 15:93240599-93240621 CCTAAAATTCCTCAGGGCCTTGG - Intergenic
1134915214 16:18063627-18063649 CTTAAACTCCAGAAGGGCCTAGG + Intergenic
1136588463 16:31202619-31202641 CTTGAACTTCTTGAGCTCCTCGG + Exonic
1137946009 16:52733894-52733916 CTTGAATTTCTTCTGGGCTTTGG - Intergenic
1139986555 16:70903400-70903422 GATGAACTTCAGCAGGGCCAAGG - Intronic
1140644871 16:77018542-77018564 CTTGAACTCCAACTGGGACTGGG + Intergenic
1142917604 17:3154583-3154605 CTGGATATTCACCAGGGCCTTGG + Intergenic
1143632145 17:8145617-8145639 CTTGAAAATCATGAGGGGCTGGG - Intronic
1143932322 17:10442181-10442203 CTTCATCTTCATCATGGCCTAGG + Intergenic
1145275053 17:21424239-21424261 CCTGAACTCCCTCAGGGTCTGGG - Intergenic
1145312906 17:21710139-21710161 CCTGAACTCCCTCAGGGTCTGGG - Intergenic
1148601278 17:48895893-48895915 TTTGACCTTCAGGAGGGCCTTGG + Intergenic
1148795480 17:50194810-50194832 CTTGAACACCAACAGGGCCCTGG + Exonic
1151211410 17:72547191-72547213 CTGGAACTATATCATGGCCTAGG + Intergenic
1152664814 17:81561552-81561574 GTTGAATCTCTTCAGGGCCTTGG - Intronic
1153510466 18:5846515-5846537 CTTGTTCTTCTTCAGGGCCAGGG + Intergenic
1153964364 18:10166631-10166653 CTTGACCTTCCGCAGGCCCTGGG - Intergenic
1153971877 18:10234489-10234511 CCAGAACGTCATGAGGGCCTGGG + Intergenic
1154392732 18:13954935-13954957 CAAGCACTTCATCAGGGCATTGG - Intergenic
1157726566 18:49968901-49968923 ATGGAACTTCATCTGAGCCTTGG + Intronic
1159851997 18:73535415-73535437 CATCAACTTCAGCAGAGCCTGGG + Intergenic
1165981639 19:39729177-39729199 CTTGATCCTCAACAGGACCTGGG + Intergenic
1167323363 19:48809948-48809970 CTCTATCTTCATCAGAGCCTAGG + Intronic
925187798 2:1861106-1861128 CTTTCAGTTCCTCAGGGCCTCGG - Intronic
925431930 2:3802137-3802159 CTTGAACAGCATCAAGGGCTTGG - Intronic
925917895 2:8619695-8619717 CTTGACCTTCAGCTGTGCCTGGG - Intergenic
926572583 2:14545556-14545578 CTTGAATTTCAGAAGGGCCTAGG - Intergenic
927433462 2:23047064-23047086 GTAGAACTTAATCAGAGCCTCGG + Intergenic
927926033 2:27014415-27014437 CTGGAACTTCAGCAGGGCTCAGG + Intronic
928099511 2:28427858-28427880 CTGGAACGTCATCAGGGACTAGG - Intergenic
931011062 2:57914444-57914466 TTTAAACTACATCAGGGCTTAGG + Intronic
931963050 2:67503108-67503130 CTTTTCCTCCATCAGGGCCTGGG - Intergenic
932733705 2:74239359-74239381 TTTGAACTTCTTCAGGGTCAGGG + Exonic
933106406 2:78332076-78332098 ATTGAATTTCTTCAGGGTCTTGG - Intergenic
935059041 2:99592435-99592457 CTTGAACTTCATGAGGCCACTGG + Intronic
939275944 2:139996328-139996350 CTCGAACTTCATCAGGACTTGGG - Intergenic
942073757 2:172338275-172338297 ATTGACCTCCATGAGGGCCTGGG - Intergenic
947539993 2:230969792-230969814 CTTGAAGTCCATCAGGGACCAGG + Intergenic
1169845686 20:9988753-9988775 CTTAAAATTCATAAGGGTCTTGG + Intronic
1170420098 20:16184294-16184316 CTTGAGCCTCAGCAGGCCCTGGG + Intergenic
1170877761 20:20267015-20267037 CCTCAACTTCATCAGGGCCCTGG - Intronic
1170929203 20:20753671-20753693 TTTGGACTTCATCAGGGTCAGGG - Intergenic
1172101153 20:32484337-32484359 CTTGAACTTGATCAAGCACTGGG - Intronic
1175972465 20:62693603-62693625 CTGGGACTTCATCTCGGCCTTGG - Intergenic
1178575777 21:33788647-33788669 CTTGAACTTCATCACGGCAGAGG + Intronic
1179408345 21:41143359-41143381 CTTGAATATAATCAGGGACTCGG + Intergenic
1179416270 21:41200949-41200971 CTTGAACCCAGTCAGGGCCTAGG - Intronic
1180644629 22:17328464-17328486 CCTGAACTTAATTAGGGCCCAGG + Intergenic
1180970351 22:19811835-19811857 CTCCAACTTCACCAGGGACTTGG + Intronic
1181566679 22:23742972-23742994 CTTGGACATCAGCAGGGCCTGGG - Exonic
1181645939 22:24231944-24231966 CCTGCACTCCCTCAGGGCCTGGG + Intronic
1182397518 22:30046908-30046930 CTCCAACTTCATCAAGGCCATGG - Intergenic
1184123841 22:42472784-42472806 CTTTTGATTCATCAGGGCCTGGG - Intergenic
949838830 3:8298422-8298444 CTTGAAAATCATCACTGCCTTGG + Intergenic
952206108 3:31182395-31182417 CTCCAACTTCATCAAGGCCATGG - Intergenic
953353542 3:42234293-42234315 CGTGAACTTCAACAGGGCAGGGG - Intergenic
960428386 3:117537242-117537264 CTTGAAAATCGTAAGGGCCTAGG - Intergenic
961566168 3:127764572-127764594 CTTGAACCTCATTACAGCCTTGG - Intronic
962506628 3:136052842-136052864 CTTTAACTTCAGAAGGGCTTGGG - Intronic
967861733 3:194157208-194157230 TTTGAACTTCAGCAGGGAGTGGG - Intergenic
968231879 3:197009200-197009222 CTTGAACTCCCTCAGGGACAGGG + Intronic
969675764 4:8613576-8613598 CTTGAACTTCAGAAGGGCGTGGG + Intronic
970537215 4:17041926-17041948 CTTGTACTACCTCTGGGCCTGGG + Intergenic
972451576 4:39205223-39205245 CTTGAATTTCAGCAGGACTTTGG + Exonic
973998161 4:56481014-56481036 ATTGAACTATATCAGGGCCTTGG + Intronic
974761031 4:66273851-66273873 GTAGAACTTCATCTGGCCCTTGG + Intergenic
976245479 4:83002317-83002339 CTTGAACTCCACCTGGGCTTAGG - Intronic
978346244 4:107773179-107773201 CCTGAACTTGAGCAGGGCCAAGG - Intergenic
979646323 4:123074624-123074646 GTTGAATTTCACCAGGGACTTGG - Intronic
979976070 4:127197332-127197354 ATTGACCTTCATGAGGGTCTGGG - Intergenic
992888640 5:81183843-81183865 CTTTAACTTCATCACATCCTTGG - Intronic
992889190 5:81188323-81188345 CTTGAACTTCTTCAGGAAGTGGG - Intronic
998170591 5:139870126-139870148 CTAGAAATTCATCAGGGTCCTGG - Intronic
1000812723 5:165882976-165882998 CTTGGAATTCCTCAGGACCTGGG + Intergenic
1002825217 6:766400-766422 CTTGAAATTGATAAGCGCCTTGG + Intergenic
1003320242 6:5044616-5044638 GTTGAAATTAATCAGGGCCGAGG - Intergenic
1007005176 6:38355321-38355343 ATTGAACTTCAACAGTGCATAGG - Intronic
1009532301 6:64833988-64834010 CTTAAATTTCATCAAGGCCCTGG - Intronic
1010251603 6:73713167-73713189 CTAGGACTTCATAAGTGCCTAGG + Intronic
1014645086 6:123963134-123963156 CACTAACCTCATCAGGGCCTAGG + Intronic
1016556089 6:145340446-145340468 CCTTAACATCAGCAGGGCCTGGG + Intergenic
1016753670 6:147660320-147660342 CTTGAAGTTCACCATGCCCTGGG + Intronic
1019410400 7:904240-904262 CTCGATCTTCATCACGGCCTTGG + Exonic
1021299681 7:18957351-18957373 CTTAAACTTCATAATGGCTTGGG + Intronic
1022811000 7:33868905-33868927 CTTGGACTTCATCTCTGCCTTGG + Intergenic
1024876533 7:54030634-54030656 CTGGAAAATCATCAAGGCCTAGG - Intergenic
1028848679 7:95512058-95512080 CTTCCCCTTCATCAGGGGCTGGG - Intronic
1029725059 7:102397325-102397347 CTTGAACTCCTTCCTGGCCTCGG - Intronic
1030711738 7:112757825-112757847 TTTGAACTTCACTAGGGCCATGG - Intergenic
1030980123 7:116176380-116176402 ATTGGGCTTCATAAGGGCCTTGG - Intergenic
1032697608 7:134350872-134350894 CTTGAAATTCATCATTGCCCTGG - Intergenic
1034521807 7:151626126-151626148 CTGGAAAGTCATCAGGGCCCAGG - Intronic
1036022554 8:4862187-4862209 CTTGAACCTCAACGAGGCCTGGG + Intronic
1036729939 8:11253773-11253795 CATGAGTTTCATCAGTGCCTGGG + Intergenic
1037028144 8:14065314-14065336 CTGTAAATTCATCTGGGCCTGGG + Intergenic
1040357696 8:46635699-46635721 CTTGCACATGAACAGGGCCTTGG + Intergenic
1042299955 8:67267540-67267562 GTTGAACTCCATAAGAGCCTGGG - Intronic
1044584472 8:93856754-93856776 GTTGAACTTGATCAGAACCTTGG - Intergenic
1046591171 8:116209055-116209077 CTTGAACTGAATCAGTTCCTGGG - Intergenic
1046660981 8:116948352-116948374 CTTGAACTGCAAGAGGGACTGGG - Intergenic
1047341010 8:123980648-123980670 CTTGAGCTCCTTCAGGGCCTTGG - Exonic
1048969875 8:139639509-139639531 CTTGTCCTTCATCAGTTCCTTGG - Intronic
1049180441 8:141219439-141219461 CTTGAAGCTCCTCAGTGCCTTGG + Intronic
1050256168 9:3794358-3794380 CCTCAACTTCATCAGGAGCTAGG + Intergenic
1050829723 9:9995889-9995911 CTTGAACATTATCAGTGACTGGG + Intronic
1055132961 9:72796250-72796272 CTGTGAATTCATCAGGGCCTGGG - Intronic
1056077600 9:83057679-83057701 CTTGAACCTCATCTAGGACTTGG + Intronic
1056103831 9:83327354-83327376 CTTGCCCTTCAGCAGGGCTTGGG + Intronic
1057233006 9:93336246-93336268 CGTGTACTTCCTGAGGGCCTCGG + Intronic
1057252506 9:93515375-93515397 CGTGTACTTCCTGAGGGCCTCGG - Intronic
1057713354 9:97467162-97467184 GTTGAACTTCCTAAGGGCCGGGG - Intronic
1057960427 9:99450820-99450842 CATAAAGTTCACCAGGGCCTAGG + Intergenic
1060184215 9:121554046-121554068 CTTGAACCTAATCAGGGCTCAGG + Intergenic
1061484135 9:130911840-130911862 CGTGAACTTCTTCCGGGGCTGGG - Exonic
1061754009 9:132800109-132800131 CTTGAATTAAGTCAGGGCCTGGG - Intronic
1062710162 9:137971194-137971216 CATGGAGATCATCAGGGCCTTGG + Intronic
1203783277 EBV:113014-113036 CTTGAATTCCGTCAAGGCCTCGG - Intergenic
1185520732 X:736568-736590 CTTGGACATCACCAGGACCTGGG - Intergenic
1187308220 X:18116251-18116273 CTTGAACTACATTAGCACCTGGG + Intergenic
1187685900 X:21815169-21815191 CTTGAACTTAAAAATGGCCTTGG - Intergenic
1188545843 X:31305756-31305778 CTTGACCTTTATCAAAGCCTAGG - Intronic
1188571265 X:31588183-31588205 CTTGAACATCTTGAGGTCCTTGG + Intronic
1191015524 X:55805949-55805971 CTTGCTCTGCATCAGGGCTTTGG + Intergenic
1193031998 X:76908296-76908318 AGTGAACTTAATCAGGGCATTGG - Intergenic
1193925157 X:87475720-87475742 CTTGTAGATCCTCAGGGCCTTGG - Intergenic
1195727541 X:107933990-107934012 CTTGTACCTCATCAGAACCTGGG + Intergenic
1196819713 X:119693021-119693043 CTTGACCCTCACCAGGCCCTCGG + Intronic
1199985188 X:152945252-152945274 CTTATTCTTCTTCAGGGCCTTGG + Exonic