ID: 1131154331

View in Genome Browser
Species Human (GRCh38)
Location 15:90065460-90065482
Sequence AGTCCTTGGAAGCCTGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 335}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131154326_1131154331 -4 Left 1131154326 15:90065441-90065463 CCACTGCCTGGCGTGCTGCAGTC 0: 1
1: 0
2: 2
3: 17
4: 218
Right 1131154331 15:90065460-90065482 AGTCCTTGGAAGCCTGGAGAGGG 0: 1
1: 0
2: 2
3: 17
4: 335
1131154328_1131154331 -10 Left 1131154328 15:90065447-90065469 CCTGGCGTGCTGCAGTCCTTGGA 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1131154331 15:90065460-90065482 AGTCCTTGGAAGCCTGGAGAGGG 0: 1
1: 0
2: 2
3: 17
4: 335
1131154324_1131154331 10 Left 1131154324 15:90065427-90065449 CCAGGAGGAGGTCGCCACTGCCT 0: 1
1: 0
2: 2
3: 21
4: 179
Right 1131154331 15:90065460-90065482 AGTCCTTGGAAGCCTGGAGAGGG 0: 1
1: 0
2: 2
3: 17
4: 335
1131154319_1131154331 30 Left 1131154319 15:90065407-90065429 CCAGGGCAAGGGGTATAGGCCCA 0: 1
1: 0
2: 0
3: 5
4: 118
Right 1131154331 15:90065460-90065482 AGTCCTTGGAAGCCTGGAGAGGG 0: 1
1: 0
2: 2
3: 17
4: 335
1131154323_1131154331 11 Left 1131154323 15:90065426-90065448 CCCAGGAGGAGGTCGCCACTGCC 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1131154331 15:90065460-90065482 AGTCCTTGGAAGCCTGGAGAGGG 0: 1
1: 0
2: 2
3: 17
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131154331 Original CRISPR AGTCCTTGGAAGCCTGGAGA GGG Intronic
900029881 1:363682-363704 ACTGCTTGGGAGCCTGGAAATGG - Intergenic
900050532 1:592746-592768 ACTGCTTGGGAGCCTGGAAATGG - Intergenic
900796735 1:4712583-4712605 AGTCCTTGGATCCCCGGAGAAGG + Exonic
901397033 1:8989048-8989070 AGCCCTTGGACCCCTGGAGCTGG + Intergenic
902227221 1:15003990-15004012 TGTCCTTTAAAGCCTGGAGAAGG - Intronic
902256625 1:15193263-15193285 AGGCAGTGGCAGCCTGGAGAGGG - Intronic
902449897 1:16490534-16490556 AGGACTCAGAAGCCTGGAGAGGG - Intergenic
902504561 1:16930657-16930679 AGGACTCAGAAGCCTGGAGAGGG + Intronic
903164732 1:21512172-21512194 CGTCCTTGGCAGGCTGGAGCTGG + Intronic
903363809 1:22793664-22793686 AGTCCTGAGAGGCCTGGAGGAGG + Intronic
903749297 1:25610695-25610717 AGTCCTTAGTATGCTGGAGAAGG - Intergenic
903766981 1:25741361-25741383 AGTCTTTAGAGGTCTGGAGATGG + Intronic
904318458 1:29681254-29681276 TGACCTTGGCAGCCTGGAGTGGG + Intergenic
904333836 1:29784521-29784543 ACTCCTGTGAAGGCTGGAGAAGG + Intergenic
904356000 1:29940249-29940271 TGACCTTGGCAGCCTGGAGCAGG - Intergenic
904439028 1:30517728-30517750 TGACCTTGGCAGCCTGGAGTGGG - Intergenic
906474131 1:46156370-46156392 AATCGTTTGAACCCTGGAGACGG + Intronic
906825598 1:48976252-48976274 AGAACTTGGAAGTCTGGATAAGG - Intronic
907485339 1:54774239-54774261 AATCCCTGGAAGCCAGGAGGTGG - Intergenic
908244601 1:62217795-62217817 AGTCGTTTGAACCCAGGAGACGG - Intergenic
910475708 1:87603858-87603880 AGTTGTTGGAAGCCAGGAGTGGG + Intergenic
912967661 1:114250334-114250356 AGTCCTTGGAAAGCAGGAGGAGG + Intergenic
913172523 1:116245611-116245633 AGTCCCTTTAAGCCAGGAGAAGG + Intergenic
913476111 1:119239758-119239780 AGTCCTTAGAAACCAGGAGCTGG + Intergenic
914852655 1:151326718-151326740 AATTCTTGGAAGCCAGGAGCTGG + Intronic
915484984 1:156213996-156214018 AATCCTTTGAACCCGGGAGACGG - Intronic
915731652 1:158058419-158058441 GGGCCTTGGAAGCCTGGGGCAGG - Intronic
916031981 1:160884947-160884969 AGTCTTTGTAAGACTGGACAGGG - Intronic
916274198 1:162976426-162976448 AGTCCTGAGAAGCCGGGAGCTGG + Intergenic
916510331 1:165467589-165467611 AGTAGATGAAAGCCTGGAGAGGG + Intergenic
916666045 1:166968472-166968494 AGTCTTTAGAAGTCTGCAGAGGG - Intronic
916696708 1:167244857-167244879 GGGCCTTGGAAGCCTGTATATGG + Intronic
917434153 1:175001826-175001848 AATCCTTTGAACCCGGGAGACGG - Intronic
919795529 1:201319369-201319391 AGGGCTTGGAACCCTGGAGCAGG + Intronic
920317083 1:205084275-205084297 TGTCCTTGGGAGCCTGGGGTTGG - Exonic
920680530 1:208069233-208069255 AGTTCCTGGAAGCTTTGAGAGGG - Intronic
920942769 1:210499554-210499576 AATCCTTGGAACCCAGGAGTTGG + Intronic
1063046222 10:2394946-2394968 TGTCCTTCGATGCCTTGAGATGG + Intergenic
1063165176 10:3455274-3455296 GGTCTTTGGAGACCTGGAGATGG + Intergenic
1063380971 10:5585524-5585546 GGTCTTGGGAAGACTGGAGAGGG + Intergenic
1063405181 10:5787390-5787412 ACTACTTGGAAGGCTGGAGCAGG + Intronic
1065871875 10:29962778-29962800 AGTCCTTGGAATCCTGGTGTGGG - Intergenic
1067897234 10:50196735-50196757 AGACCTTGGAATCCTTTAGAGGG - Intronic
1067951738 10:50745290-50745312 AGACCTTGGAATCCTTTAGAGGG + Intronic
1069632514 10:69905638-69905660 GCTCCTGGGAAGGCTGGAGATGG + Intronic
1070354883 10:75630317-75630339 AGTCCTTCAAAGAGTGGAGAGGG - Intronic
1072062030 10:91822650-91822672 AATCCTTTGAACCCTGGAGGTGG - Intronic
1072062075 10:91822964-91822986 AATCGTTTGAACCCTGGAGATGG + Intronic
1073065978 10:100759441-100759463 AGTCCCTGGCAGGCTGGAGAGGG + Intronic
1074193202 10:111155842-111155864 AGTCCTGGGAAACCTTGAGAAGG + Intergenic
1075093231 10:119454902-119454924 AGTCCTGGGAGCCCTGGGGATGG - Intronic
1076052578 10:127347375-127347397 GGGCCTTGGCAGCCCGGAGACGG + Intronic
1076433602 10:130424555-130424577 AGTCCCTGGAAGCTGGGGGAGGG + Intergenic
1076697298 10:132253137-132253159 GCTCCTGGTAAGCCTGGAGATGG - Intronic
1077021190 11:417792-417814 AGCCCATGGAAAACTGGAGAAGG + Intergenic
1078003000 11:7513050-7513072 AGTCCTTGGAGGCCTGGGCAGGG + Intergenic
1079872809 11:25821691-25821713 AGACATTGGAAGAGTGGAGAGGG + Intergenic
1080427430 11:32168961-32168983 AGGCCTTGGTAGGTTGGAGAGGG - Intergenic
1080778230 11:35406210-35406232 CATCCTTGTCAGCCTGGAGAAGG - Intronic
1082562866 11:54640611-54640633 AAACCTTGCAAGCCAGGAGAGGG - Intergenic
1083048845 11:59759008-59759030 AGTCTTTGGAAGATGGGAGATGG + Intronic
1083468491 11:62865464-62865486 AGTCCCTTGAACCCTGGAGGTGG + Intronic
1084057882 11:66648724-66648746 AATCCTTGGAACCCGGGAGGTGG + Intronic
1084940107 11:72607888-72607910 GGACGTTTGAAGCCTGGAGAAGG - Intronic
1085520742 11:77137726-77137748 AGGCCTTGGAGGCCTGGTGTGGG - Intronic
1085822050 11:79804032-79804054 AGACCTTGGAAAGCGGGAGACGG - Intergenic
1087919726 11:103852770-103852792 AGTCCTTGGAAGTCTAGACTGGG + Intergenic
1088119414 11:106350668-106350690 TGTCCTTGGAAAATTGGAGAAGG - Intergenic
1088769490 11:113019253-113019275 ACTCCTTGGAAGACTGTTGAAGG - Intronic
1089431414 11:118427785-118427807 GGGACTTGGAAGCATGGAGATGG - Intronic
1089454426 11:118617740-118617762 AGACCTTGAATCCCTGGAGAAGG - Intronic
1089462799 11:118662608-118662630 AGTGCTGGGCAGCCTGGAGGTGG + Intronic
1090072470 11:123555818-123555840 AGTCACTGGAACCCAGGAGATGG - Intronic
1091502529 12:1032957-1032979 AGTCACTTGAACCCTGGAGATGG - Intronic
1093175566 12:15909980-15910002 AGGCCCTGAAAGCCTGGAGCTGG - Intergenic
1095420131 12:42016866-42016888 AATCCTTTGAACCCTAGAGATGG - Intergenic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1100449994 12:94696495-94696517 AGTCTTAGGAGGCCTGGAGGAGG + Intergenic
1101184514 12:102260598-102260620 AGTCAGTGGAAGCCCAGAGATGG - Intergenic
1101437680 12:104678021-104678043 AGTGCCTGGAAGGTTGGAGAAGG - Intronic
1103188178 12:118979853-118979875 AGGCCTGGGAAGGTTGGAGATGG - Intergenic
1103500618 12:121399262-121399284 AATCCTTTGAACCCGGGAGACGG + Intronic
1103766226 12:123282063-123282085 AGTTCTTTGAGGCCTAGAGAAGG - Intergenic
1103977342 12:124711942-124711964 AATCGCTTGAAGCCTGGAGACGG - Intergenic
1104317669 12:127719245-127719267 AATCCTTGGAATCCTGGTGTGGG - Intergenic
1104725436 12:131072710-131072732 GGGCCTGGGAGGCCTGGAGAGGG + Intronic
1106471892 13:30063352-30063374 AATCATTGGAACCCTGGAGGTGG + Intergenic
1106901406 13:34357925-34357947 AGTTCAGGGAAGCCTGCAGAGGG + Intergenic
1108819987 13:54336462-54336484 AGTACTTTGAGGCCTTGAGATGG - Intergenic
1110437944 13:75496012-75496034 AGTCCTTGGGAGGCTAGAGCAGG - Intergenic
1110443436 13:75550059-75550081 AATCCCTGGAAGCGTGGAGGTGG - Intronic
1111013382 13:82342735-82342757 AATCCTTGGAAGGCTGAAGTGGG - Intergenic
1112569665 13:100582323-100582345 AGTCCTTGGCAGGGAGGAGATGG - Intronic
1114594482 14:23899221-23899243 AGACCATGGAAACCGGGAGATGG + Intergenic
1115083348 14:29484142-29484164 AGTCACTGGAAGCCAGGAGGTGG - Intergenic
1115755079 14:36521075-36521097 GGTCCTTGGGCGCCTGGCGAGGG + Intronic
1117574335 14:57082912-57082934 AGTCGTTGGAAGCCAGGATCGGG - Intergenic
1117941331 14:60969104-60969126 AATCCTTTGGAGACTGGAGAAGG + Exonic
1118864798 14:69694516-69694538 TGGCCTTGGAACCTTGGAGATGG + Intronic
1120760572 14:88281045-88281067 AGACCTTGGAAGCCATGATAAGG - Intronic
1120788672 14:88559576-88559598 AATCCTTTGAACCCAGGAGATGG + Intergenic
1120979803 14:90279780-90279802 ATTCCTTGGAGGGCTTGAGAGGG - Intronic
1121403469 14:93703218-93703240 AGTCCTGGGAAGCCAGAACAAGG - Intronic
1121717299 14:96085394-96085416 GGGCCTGGGAAGCCTGGACATGG + Intronic
1122038646 14:98966171-98966193 AGTCCTTGGAAGCACCCAGAAGG + Intergenic
1122125335 14:99575710-99575732 GGCCAGTGGAAGCCTGGAGAGGG - Intronic
1122365475 14:101192582-101192604 AGGCCCTGGGGGCCTGGAGAAGG + Intergenic
1123192780 14:106586866-106586888 AGACCTGGGAATCCTGGAGCTGG + Intergenic
1123573610 15:21642581-21642603 TGTCCCTGGAAGGATGGAGAAGG + Intergenic
1123610231 15:22085170-22085192 TGTCCCTGGAAGGATGGAGAAGG + Intergenic
1124158625 15:27249947-27249969 AGTTCAGGGCAGCCTGGAGAAGG + Intronic
1125512830 15:40302099-40302121 AGCCCCTGGAAGCCTGGGGAGGG + Intronic
1127992928 15:64133969-64133991 AGGCCTTGGTAGCCTAGAGCAGG + Intronic
1128248023 15:66146312-66146334 AGTCCCTTGCAGCCGGGAGAGGG - Intronic
1128376600 15:67080913-67080935 ATTTATTGGAAGTCTGGAGAGGG + Intronic
1128764655 15:70243811-70243833 AGGCCCAGGAATCCTGGAGAGGG - Intergenic
1129037460 15:72659333-72659355 TGTCCTTGGGAGCTTGAAGAGGG + Intronic
1129212427 15:74077892-74077914 TGTCCTTGGGAGCTTGAAGAGGG - Intronic
1129289310 15:74551519-74551541 AGTCCCTGGAAACCTGGAAGGGG - Intronic
1129804461 15:78443731-78443753 AATCGTTTGAACCCTGGAGATGG - Intronic
1131154331 15:90065460-90065482 AGTCCTTGGAAGCCTGGAGAGGG + Intronic
1132110087 15:99096490-99096512 AGCCCTGGGAAGCCTGGGAAAGG + Intergenic
1132405472 15:101539664-101539686 AGTCCATGGAAGTGTTGAGAAGG + Intergenic
1202982476 15_KI270727v1_random:376935-376957 TGTCCCTGGAAGGATGGAGAAGG + Intergenic
1133269364 16:4602892-4602914 AGGCCTTGGAAGCTGGGAGGGGG + Intergenic
1133769935 16:8861860-8861882 TGTCCTGGGAGGCCTGGACAGGG - Intronic
1134481941 16:14627324-14627346 AGTCCATGGAATGCTGGAAAAGG + Exonic
1136996830 16:35196315-35196337 AGTCCTCTGAAGCCTCTAGAAGG + Intergenic
1137023496 16:35452455-35452477 AGTCCTCTGAAGCCTCCAGAAGG + Intergenic
1139902528 16:70339463-70339485 AGTTCTTAAAAGCCAGGAGAGGG - Intronic
1139919705 16:70451738-70451760 AGTCATTTGAAGCCAGGAGGCGG - Intergenic
1139968243 16:70757461-70757483 AGTGCTGGGGAGGCTGGAGAAGG + Intronic
1140230730 16:73115209-73115231 AGACCTTGGATCCCTGGAGTCGG - Intergenic
1140647550 16:77049573-77049595 TGTCCATGGAAGCCTGGGTAGGG + Intergenic
1140738953 16:77924420-77924442 AGTGGGTGGAAGCTTGGAGAAGG - Intronic
1141675719 16:85516189-85516211 ACTCCTGGGAGGCCTGGGGAAGG + Intergenic
1142744736 17:1950194-1950216 AGACCTTGGGGGCCTGAAGAGGG + Intronic
1144856921 17:18274375-18274397 AGCCCTGGGCAGCCTGGACAGGG + Exonic
1146064731 17:29625219-29625241 AGGCCTTGGCAGCCAGAAGAAGG - Intergenic
1146178374 17:30681180-30681202 AATCACTGGAAGCCGGGAGATGG - Intergenic
1146193404 17:30790701-30790723 AATCACTGGAAGCCTGGAGGCGG - Intronic
1147958000 17:44148283-44148305 AGTCCTGGCAAGCATGGAGTTGG + Exonic
1149321162 17:55482430-55482452 AGCCTGTGGAAGCCTGGAGAAGG - Intergenic
1150632091 17:66886956-66886978 TGTCCTTGGACACCAGGAGAGGG - Intergenic
1151451794 17:74202738-74202760 AGGCTTGGGAAGCCTGGGGAGGG - Intergenic
1151774418 17:76189730-76189752 AGATCCTGGAAGCCCGGAGAAGG + Intronic
1152237957 17:79148254-79148276 GGACCTTGGGAGGCTGGAGAAGG - Intronic
1152288242 17:79424609-79424631 AGCCCTTGGAAGCCTGGTGGGGG - Intronic
1152949876 17:83222878-83222900 ACTGCTTGGGAGCCTGGAAATGG + Intergenic
1153152149 18:2107689-2107711 AATCCTTTGAAGCCGGGAGGTGG - Intergenic
1153169943 18:2304080-2304102 AGTCCTTGTAAAGTTGGAGAGGG + Intergenic
1154043472 18:10882147-10882169 AGCTCTCGGATGCCTGGAGAAGG - Intronic
1154144886 18:11859343-11859365 AGACCTTGGAATCCATGAGAAGG - Intronic
1154480774 18:14821702-14821724 GAACCTTGGAAGCCTGAAGAGGG - Intronic
1157578272 18:48758357-48758379 TGTCTTTGGAAGACTGGAGCAGG - Exonic
1158217163 18:55112238-55112260 AGAACTTGGAACCATGGAGAAGG - Intergenic
1160758422 19:770539-770561 GCTCCTTGAAAGCCTGGACAGGG + Intergenic
1160907893 19:1460353-1460375 AGTCCCTGGAAGACTGGATGAGG - Intronic
1162279639 19:9685260-9685282 AATCCTTTGAAGCCAGGAGGCGG - Intergenic
1162490276 19:10987430-10987452 AGGCCTTGGGAGCCTGGGGCTGG + Intronic
1162712381 19:12605064-12605086 AATCATTTGAACCCTGGAGATGG + Intronic
1163055395 19:14714058-14714080 AGCCCTTGGAACGGTGGAGATGG + Intronic
1163948852 19:20565637-20565659 AGCCCCTGGAAGCCTAGAAATGG - Exonic
1164136580 19:22422194-22422216 ACCCCTTGGAAGCCTAGAAATGG - Exonic
1164182557 19:22832361-22832383 ACTCCCTGGAAGCCTAGAAATGG + Intergenic
1164709632 19:30346156-30346178 ACACCTTGGGAGCCAGGAGAAGG + Intronic
1164860945 19:31561777-31561799 ACTCCTTGGAAGGCTGGGCATGG - Intergenic
1164874511 19:31674099-31674121 AGACAATGGAAGCCTGGAAAGGG - Intergenic
1165049240 19:33131209-33131231 AATCCTTTGAACCCTGGAGGTGG + Intergenic
1165285513 19:34838667-34838689 AGTCATTTGCAGCCTGGAGGAGG + Intergenic
1165661296 19:37582675-37582697 AGGGTTTGGAAGGCTGGAGAAGG - Intronic
1166451750 19:42907953-42907975 AGTCCTTGAAAGCCAGTAGCTGG + Intronic
1166611170 19:44198889-44198911 AATCCTTTGAACCCTGGAGGTGG - Intergenic
1166666849 19:44685279-44685301 AGCCCTTTGAAGACGGGAGAAGG + Intergenic
1168044662 19:53785967-53785989 AATCCTTTGAACCCTGGAGGTGG - Intergenic
925310955 2:2881203-2881225 AGGCCTTGGATGCCAGGTGAAGG - Intergenic
925336739 2:3104262-3104284 AGTCCTTGCACACCTGGAAATGG - Intergenic
926294210 2:11556325-11556347 AGTCCTGTGAAACCTGGGGATGG + Intronic
926427400 2:12751620-12751642 GGTTCCTGGAAACCTGGAGAAGG - Intergenic
927506838 2:23620393-23620415 ACTCCTTGGAGGTCAGGAGAAGG + Intronic
927599987 2:24432231-24432253 TCTCTTAGGAAGCCTGGAGATGG + Intergenic
927676822 2:25112307-25112329 AGTCCTTGGAGTCCAGCAGATGG + Intronic
929040662 2:37741638-37741660 AGTTCTGGGATGCCTGGAGCTGG + Intergenic
929579739 2:43074274-43074296 AGTCCTAGCCAGCCTGAAGATGG - Intergenic
929685687 2:44032246-44032268 AATCCTTTGAAGCCGGGAGGTGG - Intergenic
930545456 2:52761778-52761800 AGTCATTTGAACCCTGGAGGGGG + Intergenic
934084229 2:88496605-88496627 GGTCCCTGTAAGCCAGGAGAAGG + Intergenic
934219748 2:90071804-90071826 AGTTCTTTGAAGCATGGGGAGGG - Intergenic
935242218 2:101188807-101188829 AATCCATGGAAGCTGGGAGAGGG + Intronic
936629452 2:114186130-114186152 AGAACTTGACAGCCTGGAGAAGG - Intergenic
936974825 2:118208356-118208378 AAAACTTGGAAGCTTGGAGAGGG - Intergenic
939735679 2:145841600-145841622 AGTTCTAGGAATCCTGAAGAAGG - Intergenic
940241745 2:151570517-151570539 AGGCCTTGGCAGCCTGGATGGGG + Exonic
940304145 2:152207674-152207696 AGTCACTTGAAGCCAGGAGATGG - Intergenic
941071457 2:160959448-160959470 AGTCCATGGGAGCATAGAGATGG + Intergenic
943696372 2:190938585-190938607 AGTGCTAGGAAACCTGGAAAAGG - Intronic
944091480 2:195916769-195916791 AGTCATTTGAAGCCTGGAGACGG + Intronic
944189811 2:196990958-196990980 AGTCCTGGGGAGCCTAGAGGAGG + Intronic
944444296 2:199774161-199774183 GGCTCTTGGAAGACTGGAGAAGG - Intronic
945110066 2:206354169-206354191 AATCCCTTGAACCCTGGAGATGG - Intergenic
946411463 2:219517272-219517294 AGTCCCCGGAATCCTGGGGATGG + Intronic
946646611 2:221844063-221844085 AGACCTTGGAAACCTTGAGCTGG - Intergenic
946658999 2:221979294-221979316 AATCCTAGGAAACATGGAGAGGG - Intergenic
946998268 2:225421155-225421177 AGCGTTTGGAAGCCTGGGGAGGG - Intronic
1168946810 20:1767714-1767736 ATTCTTTGGGACCCTGGAGATGG - Intergenic
1168950497 20:1797182-1797204 AATCATTTGAAGCCTGGAGGTGG + Intergenic
1169898669 20:10531573-10531595 AGTCCTTGGTCTCATGGAGATGG + Intronic
1170001992 20:11625197-11625219 AGTCTTTGGAAGGCTTGACAGGG + Intergenic
1171007258 20:21478701-21478723 AATCCTTTGAACCCGGGAGATGG + Intergenic
1173319456 20:41974448-41974470 GATCCTAGGAAGCATGGAGAGGG + Intergenic
1175693703 20:61085168-61085190 AGCCATGGGAAGCCAGGAGATGG - Intergenic
1175972345 20:62693090-62693112 AGTCCTGGGAAGCCTGGGGCGGG - Intergenic
1176799776 21:13414548-13414570 GAACCTTGGAAGCCTGAAGAGGG + Intergenic
1177653664 21:23988447-23988469 AGTCCTTGGAAGGCTGAGGCAGG - Intergenic
1178322153 21:31613844-31613866 AGTCCCTGGAACCCGGGAGGCGG + Intergenic
1178376549 21:32072320-32072342 AGGCCTGGGGAGGCTGGAGAGGG - Intergenic
1179673195 21:42964165-42964187 ATTCCTCTGTAGCCTGGAGAGGG + Intergenic
1180674717 22:17579406-17579428 AGTCCTTGGACACCAAGAGAGGG + Intronic
1181269672 22:21651878-21651900 AGCGCTTGGAAGCCCGGTGAGGG - Intergenic
1182408403 22:30158794-30158816 GCTCCTTGGAAGCCTGGGGTGGG - Intronic
1182442085 22:30370583-30370605 CGTCCAGGGAAGCCTGCAGAAGG + Exonic
1182521519 22:30887416-30887438 AGTCCCTGCAGGCCTGGGGAGGG - Exonic
1182695889 22:32199128-32199150 AGCCCACGGAAACCTGGAGAGGG - Intronic
1182860293 22:33553940-33553962 GGTCCATGGAATCCTGGTGATGG + Intronic
1184091391 22:42294823-42294845 AGTGCCTGGCAGCCTGCAGAGGG + Intronic
1203292937 22_KI270736v1_random:13238-13260 AGTTCTGGGATGCCTGGAGCTGG + Intergenic
950388843 3:12680603-12680625 AATCCTTTGAAGCCAGGAGGCGG - Intergenic
954686559 3:52373244-52373266 AGCCTCTGGAAGCCTGGAAAAGG + Intronic
955400913 3:58590970-58590992 AGGCCTTGTAGGCCTGGTGAAGG - Intronic
955965245 3:64382471-64382493 AGTGCATGGAAGGCCGGAGATGG - Intronic
956159501 3:66334399-66334421 AGTCACTGGAACCCAGGAGATGG - Intronic
957610079 3:82454406-82454428 AGCCCTTGGAAGCTAGGAAAAGG + Intergenic
961340570 3:126214244-126214266 AGGCATTGGAAGCCTGGGAAGGG - Intergenic
963051478 3:141147366-141147388 TGTCCTGGGGAGCCAGGAGAAGG - Exonic
965786365 3:172339474-172339496 AGTCGTTGGAACCCAGGAGTCGG + Intronic
965970140 3:174544655-174544677 AATCGCTGGAACCCTGGAGACGG - Intronic
966582421 3:181582753-181582775 AATCCCTGGAACCCTGGAGGTGG + Intergenic
967684756 3:192407361-192407383 AGTCCTTGGAAACAATGAGAGGG + Intronic
967906711 3:194507621-194507643 AGTGCTTTGTAGCCTGCAGAAGG - Intergenic
968283714 3:197495958-197495980 AGTTGTTGGAACCCTGGAGGCGG - Intergenic
968618396 4:1592649-1592671 AGAGCCTGGAAGCCTGGGGATGG + Intergenic
968896400 4:3406345-3406367 AGTCCTGGAAAGGCTGTAGAAGG - Intronic
969491587 4:7502254-7502276 AGTCCTTGGAAGCCAGCACGAGG + Intronic
969619364 4:8271197-8271219 GCTCCTGGGAAGCCTGCAGAGGG + Intronic
969918285 4:10511454-10511476 AGTCATTAGAAACTTGGAGATGG - Intronic
970400075 4:15708792-15708814 AATCCCTCGAACCCTGGAGAAGG + Intronic
970401771 4:15724099-15724121 AGTCCTTGGAAGCAAAGAGAAGG - Intronic
971072925 4:23114938-23114960 GCTCCTTGGAACCCTGGAGTAGG + Intergenic
973039354 4:45451324-45451346 AGTCGCTTGAATCCTGGAGACGG - Intergenic
974022333 4:56702999-56703021 TTGCCTTGGAAGCCTGCAGAAGG - Intergenic
974902741 4:68021438-68021460 AGTCCCAGGAAGGGTGGAGAAGG + Intergenic
975303206 4:72816363-72816385 TGCCCTGGGAAGGCTGGAGAGGG + Intergenic
975767928 4:77688532-77688554 ATTGTTGGGAAGCCTGGAGAAGG - Intergenic
976772421 4:88667990-88668012 AATACTTGGAATCCTGGAGTAGG - Exonic
978369994 4:108020356-108020378 AGTACTTGGAAGGCTGAAGTGGG + Intronic
978404377 4:108363964-108363986 AATCCCTGGAACCCTGGAGGTGG - Intergenic
978494863 4:109347868-109347890 AATCCTTTGAACCCTGGAGGTGG + Intergenic
980987011 4:139705244-139705266 ACTGCTTGGAAGCCAGCAGAGGG - Intronic
981566625 4:146108376-146108398 AGTCCTTGGAAGCCTGGCCCAGG + Intergenic
982134286 4:152258796-152258818 AGTCCTTGGAACCCTCAAGGGGG - Intergenic
986266039 5:6191158-6191180 ACTCTGAGGAAGCCTGGAGAGGG - Intergenic
986419493 5:7564481-7564503 AGGCCTGGGAGGCATGGAGAGGG + Intronic
986528252 5:8704085-8704107 GGTGGTTGGAAGCCTGAAGAAGG + Intergenic
989249912 5:39300323-39300345 AATCCTTTGAAGCCAGGAGGTGG + Intronic
993330420 5:86593450-86593472 TTTTCTTGGAATCCTGGAGAGGG + Intergenic
993623039 5:90190376-90190398 AATCCTCAGAACCCTGGAGATGG + Intergenic
994604812 5:101953986-101954008 AGTTCTTGAAACCCTGGAGAAGG + Intergenic
996752428 5:126902384-126902406 AGTCCTTGGAAAGATGAAGAGGG + Intronic
998191831 5:140031848-140031870 AGTCCTTGGGAACTTGGAGCTGG + Intronic
998442955 5:142177460-142177482 ACTCCTTGGAAGGCTGAGGAGGG - Intergenic
1001681584 5:173561740-173561762 AGTCTTTTGAAGGGTGGAGAAGG + Intergenic
1002436249 5:179233787-179233809 GGTCCTTGGGGACCTGGAGATGG - Intronic
1002534917 5:179870709-179870731 AGTCCTTGGCAGCCTGCAGGGGG + Intronic
1002744108 5:181456690-181456712 ACTGCTTGGGAGCCTGGAAATGG + Intergenic
1005509443 6:26499149-26499171 AATCCTTTGAACCCTGGAGGCGG + Intergenic
1007248401 6:40478937-40478959 AGTCCCTAGAAGCCCAGAGAAGG - Intronic
1007323367 6:41042751-41042773 AGTCCATGGAAGCCAGGAGATGG + Exonic
1007656931 6:43456047-43456069 TGATCTTGGAAGGCTGGAGACGG - Exonic
1008050241 6:46893578-46893600 GGTCCCTGGTAGTCTGGAGAAGG - Intronic
1008607697 6:53156437-53156459 AGCCCATGGAAGGCAGGAGATGG - Intergenic
1008795142 6:55293856-55293878 AGTCCCTTGAACCCAGGAGACGG + Intergenic
1012564637 6:100633095-100633117 AGTAATTGGAAGCGTGGAAAGGG - Intronic
1012952894 6:105537950-105537972 AGTCCCTTGAACCCGGGAGACGG + Intergenic
1014736263 6:125099035-125099057 AGACCTAGGAAGCCCAGAGAGGG - Intergenic
1015558170 6:134483931-134483953 AGTCGTTTGAACCCTGGAGGTGG + Intergenic
1015575095 6:134662772-134662794 AGAGGTTGGAAACCTGGAGATGG + Intergenic
1016324051 6:142879732-142879754 AGACTGTGGAAGCCTGGGGAGGG - Intronic
1016719483 6:147278584-147278606 AATACTTGGAACCCTGTAGAAGG + Intronic
1017228897 6:152051330-152051352 AGTGCTGGGCAGCCTGGGGATGG - Intronic
1017674057 6:156795694-156795716 AGGCCTGGGCAGCCTGGGGAGGG - Intronic
1018190836 6:161307954-161307976 AGTCCAAGGAGGACTGGAGAGGG - Intergenic
1018598764 6:165515608-165515630 AATCGTTTGAACCCTGGAGACGG - Intronic
1019248967 6:170729919-170729941 ACTGCTTGGGAGCCTGGAAATGG + Intergenic
1020191023 7:5998166-5998188 AGTCGCTGGAACCCGGGAGATGG - Intronic
1020430518 7:8112598-8112620 ACACCTTGGAGGACTGGAGATGG - Intergenic
1025674192 7:63631199-63631221 AGTCGCTGGAACCCGGGAGACGG + Intergenic
1025815040 7:64903398-64903420 ACTCCCTGGAAGCCTAGAAATGG + Exonic
1026071037 7:67119897-67119919 AGTACTTGGAAGGCTGAGGAAGG - Intronic
1029970612 7:104785263-104785285 AGTCCTTGGGAGTGTGAAGAGGG - Intronic
1032294294 7:130621855-130621877 AGTCACTGGAACCCAGGAGATGG + Intronic
1033123000 7:138682879-138682901 AGTCGCTGGAACCCAGGAGATGG + Intronic
1033411281 7:141119862-141119884 AGTGTTTGGAGGCCTGGAGCAGG + Intronic
1033428333 7:141265582-141265604 AGTACGTGGCACCCTGGAGAAGG + Intronic
1034979547 7:155467291-155467313 CCTACTTGGAGGCCTGGAGAGGG - Intergenic
1035036301 7:155897475-155897497 ACTTCTGGGAGGCCTGGAGAAGG - Intergenic
1035085247 7:156252522-156252544 AGTCCTTGGAAACGTGGCAAAGG + Intergenic
1035499079 8:77416-77438 ACTGCTTGGGAGCCTGGAAATGG - Intronic
1036167037 8:6445169-6445191 AGTCCTCGGAAAACTGGAAATGG + Exonic
1036915402 8:12799441-12799463 AGACCTTGGAACCCTGCAAATGG - Intergenic
1037773261 8:21815595-21815617 AATCCGTGGAAGCCTGTAGCTGG - Intergenic
1038435634 8:27533952-27533974 AACCCATGGAAGCCTGGACAGGG - Intronic
1039562371 8:38522997-38523019 AGTACTTGGGAGCCTGGGGTTGG - Intronic
1041511908 8:58661900-58661922 AGTCCTGGGATGCCGGGAGGTGG - Intergenic
1041814283 8:61950359-61950381 AGACCCTAGAAGTCTGGAGAAGG - Intergenic
1042785921 8:72546741-72546763 AGTACTTGGAAGGCTGAAGGGGG - Intronic
1044698092 8:94942912-94942934 GGGCCTTGTAAGCCTGGAAAAGG + Intronic
1045409796 8:101905382-101905404 AGTGATTGGGAGGCTGGAGAAGG - Intronic
1046511056 8:115203316-115203338 ACTCATTGGGAGCCTGCAGATGG + Intergenic
1047018330 8:120747375-120747397 AGTCGCTTGAACCCTGGAGATGG - Intronic
1047383438 8:124385812-124385834 AGTCATTTGAAACCAGGAGATGG + Intergenic
1049093041 8:140531066-140531088 AGTGTTTTGGAGCCTGGAGATGG - Intergenic
1049435064 8:142582701-142582723 GGTCCTGGGCAGGCTGGAGAAGG + Intergenic
1049758964 8:144323314-144323336 AGGCCTTGGAAGCCTGTCAAGGG - Intronic
1053082722 9:35191044-35191066 AATCATTGGAACCCGGGAGATGG - Intronic
1054955621 9:70906510-70906532 AGTCCTTGGAAGTTTGGGAAAGG + Intronic
1055461243 9:76522490-76522512 AATCCTTTGAACCCTGGAGGTGG - Intergenic
1056205594 9:84316557-84316579 GGTCCCTGGAAGCCTTGAGCAGG + Intronic
1056295424 9:85188476-85188498 AGTCCTCGGTAGCCTGGCAAAGG + Intergenic
1058068960 9:100582455-100582477 ACTACTTGGAAGGCTGAAGAAGG - Intronic
1058256510 9:102772420-102772442 AGTCATTGCAAGGGTGGAGATGG - Intergenic
1060774582 9:126363521-126363543 AGTTCAGGGAAGACTGGAGAAGG - Intronic
1061683375 9:132255647-132255669 AGTCACTGGAACCCTGGAGGCGG + Intergenic
1203609922 Un_KI270748v1:87183-87205 ACTGCTTGGGAGCCTGGAAATGG + Intergenic
1185531701 X:824573-824595 AATCCTTTGAAGCCAGGAGGTGG + Intergenic
1185732493 X:2472680-2472702 AATCCTTGGAACCCGGGAGACGG + Intronic
1186755982 X:12672027-12672049 AGGCCTAGGAAGCCTGCAGTGGG + Intronic
1186923180 X:14304035-14304057 AAACATTGGAAGCCTGGAGGAGG - Intergenic
1188347950 X:29091009-29091031 ATTCCTTGGAAGCCAATAGATGG - Intronic
1189103953 X:38218782-38218804 AGGCTTTGGAAGGCTGGGGAGGG - Intronic
1190326959 X:49212419-49212441 AGTCCTTGGCACTTTGGAGATGG - Intronic
1190573196 X:51806058-51806080 AGTCGTTGGAACCCAGGAGGTGG - Intronic
1193262992 X:79431897-79431919 AATCATTGGAACCCAGGAGACGG + Intergenic
1194940034 X:99998312-99998334 GGTTCTCAGAAGCCTGGAGAAGG - Intergenic
1195137310 X:101922072-101922094 AGATCTTGAAAGCCTGGAAATGG - Intronic
1195301756 X:103536630-103536652 AGGCCTGGGAAGCCTGTACAGGG + Intergenic
1196190130 X:112785455-112785477 AGTTCCTGGGAGGCTGGAGAGGG + Intronic
1196645820 X:118116730-118116752 ATTCCTGGGAAGCCTGGAACGGG - Intronic
1196729801 X:118929324-118929346 AATCCTTTGAACCCCGGAGACGG + Intergenic
1199789542 X:151139713-151139735 TGTACTTGAAAGCCTGGAGGTGG + Intergenic
1200009616 X:153111335-153111357 AGTCATTGGAAGGCGGGGGATGG - Intergenic
1200029984 X:153288587-153288609 AGTCATTGGAAGGCGGGGGATGG + Intergenic
1200032676 X:153309164-153309186 AGTACTTGGAAGCTAGGAGAGGG - Intergenic
1200957594 Y:8967802-8967824 AATCCATTGAACCCTGGAGATGG - Intergenic
1201677057 Y:16597848-16597870 AATCCCTTGAAGCCTGGAGTTGG - Intergenic
1201838435 Y:18346416-18346438 AGCCCTTGGAAGCCGGCAGAAGG - Intergenic