ID: 1131154432

View in Genome Browser
Species Human (GRCh38)
Location 15:90066019-90066041
Sequence CTTTCAAATCAGATCGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131154429_1131154432 8 Left 1131154429 15:90065988-90066010 CCTCAAACATGTTAGCTGTCAAG 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1131154432 15:90066019-90066041 CTTTCAAATCAGATCGGACATGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131154432 Original CRISPR CTTTCAAATCAGATCGGACA TGG Intronic
904831387 1:33308125-33308147 CTTTCAACTTAGATGGGGCAGGG + Intronic
908778885 1:67670104-67670126 CTTTCAAATCAGATGGATGAAGG + Intergenic
917337873 1:173943847-173943869 CTTTCAAATCAGAAAATACAAGG - Intronic
918146499 1:181760759-181760781 CTTTGAAGTCAGATAGAACAGGG - Intronic
1063172170 10:3518585-3518607 CTTTAAAAAAAGATGGGACAGGG - Intergenic
1063908425 10:10804451-10804473 CTTTCAAATCTCATACGACAAGG + Intergenic
1065498173 10:26351183-26351205 CATTCCAATCAGCTTGGACAAGG + Intergenic
1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG + Intergenic
1080517342 11:33036701-33036723 GTTACAAATCAGATAGCACACGG - Intergenic
1081388184 11:42497850-42497872 CTTTGAAATTAAATCGCACATGG + Intergenic
1081952284 11:47054591-47054613 CCTTCAAATAAGATGGGGCATGG - Intronic
1086405002 11:86492075-86492097 CTTTCAAATCAGATAGACCTGGG + Intronic
1086971741 11:93088557-93088579 CTTTCAAATCAGGTAGGCCCGGG - Intergenic
1092986360 12:13849733-13849755 CTTTGAAATCAGATGGGAACAGG - Intronic
1096222109 12:49837095-49837117 CTATCAAATGAGATAGGACTAGG + Exonic
1100162710 12:91879219-91879241 CTTTGAAATCAGATGGAACTGGG + Intergenic
1112622719 13:101067935-101067957 CTTTCAAATAATATGGAACATGG - Exonic
1115791573 14:36884874-36884896 CTTGCAAACCACATCTGACAAGG - Intronic
1119960092 14:78846146-78846168 CTTTCAAATCACATCCAAAATGG + Intronic
1131154432 15:90066019-90066041 CTTTCAAATCAGATCGGACATGG + Intronic
1142659931 17:1421308-1421330 CATTCAAATCAGTTGTGACAAGG + Exonic
1146475875 17:33162406-33162428 CTTTCAAGTGATATCAGACAGGG + Intronic
1148749255 17:49935300-49935322 CCTTCAAGTCAGAAAGGACAGGG + Intergenic
1154072945 18:11170522-11170544 ATTTCAAATCATATCAGATAAGG + Intergenic
1155898655 18:31360973-31360995 CTTTGAAGTCTGATGGGACATGG - Intergenic
1157708601 18:49831354-49831376 CTTGCAAATCATATCTGATAAGG + Intronic
1158419037 18:57276359-57276381 CTTTCAATTCAGTTCTTACAAGG - Intergenic
1164651734 19:29895609-29895631 CTTAAAAATCAGAGGGGACACGG + Intergenic
1166107869 19:40606265-40606287 CTTTCAAAGCCGGTTGGACAAGG - Exonic
930337678 2:50070443-50070465 CTTTCCAATCAAATCTGTCAGGG + Intronic
930741835 2:54839644-54839666 TTTTCAAATGAAATCGGAGATGG + Intronic
941235216 2:162963296-162963318 TTTCCAAATCATATCTGACAGGG - Intergenic
944676725 2:202039206-202039228 CTTTGGAATCAGATTAGACAGGG + Intergenic
944940545 2:204620481-204620503 CTTTAACATCAGAGGGGACAGGG + Intronic
1169426561 20:5501722-5501744 CTCTCAAATCAGCACAGACAAGG - Intergenic
1170413411 20:16114854-16114876 CTTTCAAGTCACATCGCAGAAGG - Intergenic
1178288075 21:31342795-31342817 CTTTTAAACCAAATCAGACATGG - Intronic
1179116257 21:38495432-38495454 CTTAAAAATCAGACAGGACATGG - Intronic
1182944328 22:34307809-34307831 CTTTGAAATCAGATAGGGCCAGG + Intergenic
949586669 3:5446925-5446947 CTTTTAAATCAAATAGGATAAGG + Intergenic
952621071 3:35343174-35343196 TTTTCAAATCAGTTGGGATATGG - Intergenic
956507015 3:69952252-69952274 CTTTCAAATCTCATTGGAGAAGG - Intronic
962475613 3:135752721-135752743 CTTTGAAATCACCTAGGACACGG + Intergenic
963029456 3:140953548-140953570 TTTTCAAATCAGATTTGTCAAGG + Intronic
963402856 3:144823365-144823387 TTTTCAAACCAGATAGAACATGG - Intergenic
966710590 3:182968543-182968565 TTTTCAAATAAGATATGACATGG - Intronic
966970707 3:185042853-185042875 CTTTCAAAGCAGGTTGGGCAAGG + Intronic
973529730 4:51823992-51824014 TTTACAAATCACATCCGACAAGG - Intergenic
979746653 4:124222817-124222839 TTTTCAAATGAGCTCAGACAAGG - Intergenic
980970998 4:139567176-139567198 CTTTCAAGTCAGATCACATAAGG + Intronic
981937187 4:150250574-150250596 CTTTCGAATCAGACCTGCCAAGG + Intronic
983445469 4:167845072-167845094 CTTTCAAATAAGATCAAACAGGG + Intergenic
984447844 4:179859473-179859495 TTTTCAAATCACAAAGGACATGG + Intergenic
990227511 5:53671827-53671849 CTTTCAAATCAGATCAAACGGGG - Intronic
992544621 5:77800009-77800031 CTTTCAAAACAGAAAGCACAAGG + Intronic
993648552 5:90489814-90489836 ATGTCAAATCAGACTGGACACGG + Intronic
995344678 5:111098308-111098330 CTTTCAGATGAGATGGGAAAGGG - Intronic
996347234 5:122500344-122500366 GTTTCAAATCAGATCCTAGACGG - Intergenic
998641573 5:144017589-144017611 CTTTCAAATAAAATCTGACATGG - Intergenic
998998266 5:147890874-147890896 GTTTCAAATGAGATGGGAAATGG + Intronic
999508896 5:152227271-152227293 CTTTCAAAGCAGATCTCACATGG + Intergenic
1013456082 6:110330706-110330728 CTTTGAAAACAGAGCTGACATGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025793342 7:64715171-64715193 CTTGCAAATCACATGTGACAAGG - Intergenic
1026557067 7:71417783-71417805 CTTTCAAAACTGAAAGGACATGG + Intronic
1027924765 7:84447057-84447079 CTTTGAAATCAGAGCAGGCACGG - Intronic
1028002992 7:85524813-85524835 CTTTCAAAACAGATAGTAAAAGG - Intergenic
1030107714 7:106000503-106000525 CTTTCAAAGAAGATCCCACATGG + Intronic
1034891179 7:154840442-154840464 CTTTCACATCTGATCAGACCTGG - Intronic
1038583284 8:28768795-28768817 CTTACAAATCAGACGTGACATGG + Intronic
1039472743 8:37823955-37823977 TTTGCAAATCAGATCTGATAAGG - Intronic
1039472791 8:37824408-37824430 TTTGCAAATCAGATCTGATAAGG - Intronic
1043193941 8:77266260-77266282 CTTTAAAATCTGGTGGGACAAGG - Intergenic
1044381913 8:91544002-91544024 CTTTCAAAAGAGATCTGATAAGG + Intergenic
1050027637 9:1352214-1352236 CTTTTAAATCAAATGGGAAAGGG + Intergenic
1050135962 9:2464865-2464887 CTTTAAAAGCAGATCAGGCATGG - Intergenic
1055768996 9:79695904-79695926 TTTTCAGATCAGATTGGAGAAGG + Intronic
1060665312 9:125429019-125429041 TTTGCAAATCAGATGTGACAGGG + Intergenic
1186901642 X:14063671-14063693 CTTTCAAGTCAGATCTGAATTGG - Intergenic
1189948218 X:46202447-46202469 CTTTCATTTCAGGTAGGACAGGG + Intergenic
1194276780 X:91894740-91894762 ATTTCATATCAGAAGGGACATGG - Intronic
1194794083 X:98188360-98188382 CTTTTAAATAAGTTCAGACATGG + Intergenic
1194970864 X:100342106-100342128 TTTTAAAATCAGATCTGTCACGG - Intronic
1200594133 Y:5116851-5116873 ATTTCATATCAGAAGGGACATGG - Intronic