ID: 1131158908

View in Genome Browser
Species Human (GRCh38)
Location 15:90091709-90091731
Sequence AGCCAGGCCCGCCCTTCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131158898_1131158908 12 Left 1131158898 15:90091674-90091696 CCCCTGGGGAGGCTGGAGGGGGG 0: 1
1: 0
2: 5
3: 89
4: 841
Right 1131158908 15:90091709-90091731 AGCCAGGCCCGCCCTTCACCAGG 0: 1
1: 0
2: 0
3: 28
4: 302
1131158901_1131158908 10 Left 1131158901 15:90091676-90091698 CCTGGGGAGGCTGGAGGGGGGCC 0: 1
1: 0
2: 6
3: 84
4: 712
Right 1131158908 15:90091709-90091731 AGCCAGGCCCGCCCTTCACCAGG 0: 1
1: 0
2: 0
3: 28
4: 302
1131158900_1131158908 11 Left 1131158900 15:90091675-90091697 CCCTGGGGAGGCTGGAGGGGGGC 0: 1
1: 1
2: 12
3: 63
4: 692
Right 1131158908 15:90091709-90091731 AGCCAGGCCCGCCCTTCACCAGG 0: 1
1: 0
2: 0
3: 28
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131158908 Original CRISPR AGCCAGGCCCGCCCTTCACC AGG Intronic
900097382 1:945475-945497 CTCCAGGCCCACCCTTCCCCTGG + Intronic
900644798 1:3703999-3704021 AGCCGGCCCCTCCCATCACCGGG - Intronic
901209859 1:7518641-7518663 GGCCAGCCCGGCCCTTCTCCTGG - Intronic
901497200 1:9629007-9629029 ACCCAGGCCCGCCCCTCACTTGG - Intergenic
901643386 1:10704419-10704441 GGCCGGGCCTGCCCTACACCGGG + Intronic
901884731 1:12215011-12215033 AGCCAAGCCTGCCCTTGGCCTGG + Intergenic
903669647 1:25027981-25028003 AGGCAGGGCCGGCCCTCACCAGG - Intergenic
903942527 1:26941657-26941679 AGGGAAGCCCACCCTTCACCTGG - Exonic
906033301 1:42736502-42736524 GGCCAGGCCAGCCCTGCTCCTGG + Intronic
911878288 1:103198175-103198197 AGACAGGCCCGCACACCACCAGG + Intergenic
914511177 1:148333807-148333829 AGTCAGTCCCGCCCTCCCCCTGG + Intergenic
915318387 1:155042667-155042689 AGGCAGGCCAGGCCTGCACCTGG + Intronic
915709964 1:157886144-157886166 AGCCAGACCCACCCTTAATCTGG + Intronic
916535395 1:165698687-165698709 GGCCAGGCCCTCCCCTCGCCAGG + Exonic
917928810 1:179809909-179809931 AGCATGGCCCGCCATGCACCTGG + Intronic
918043307 1:180926291-180926313 GGTCAGGCCCTCGCTTCACCAGG + Intronic
918349080 1:183635458-183635480 AGCCCAGCCCGCCCTTCTCCTGG - Intronic
919761702 1:201102202-201102224 AGCCTGCCCCACACTTCACCAGG - Intronic
920242385 1:204562563-204562585 AGCCACGCCCGCCCGACTCCAGG + Intergenic
1063130492 10:3173164-3173186 GCGCAGCCCCGCCCTTCACCAGG - Intergenic
1067469865 10:46528377-46528399 AGCCATGCCCCCCCCCCACCAGG - Intergenic
1068447501 10:57141094-57141116 AGGCAGGCCCACCCTTAATCTGG + Intergenic
1069242761 10:66163087-66163109 AGCCCATCTCGCCCTTCACCTGG - Intronic
1069752236 10:70752038-70752060 AGCCAGGCCCCCCATTGCCCTGG - Intronic
1069819650 10:71219539-71219561 AGGCAGGCCCACCCTTAATCTGG - Intronic
1069853483 10:71425528-71425550 AGCCAGCCCCGCCCATCTGCAGG + Intronic
1069915531 10:71784533-71784555 AGCCAGGCCAGGCCTGCCCCTGG + Intronic
1073208295 10:101780125-101780147 AGCCAGGCCGCCCCTCCGCCGGG + Intronic
1074849400 10:117427056-117427078 AGCCAATCCCAGCCTTCACCTGG - Intergenic
1075714373 10:124547655-124547677 GGCCAGCCCCGACCTCCACCAGG - Intronic
1075802790 10:125162690-125162712 AGCCCGGCGCGCCCCTCAGCTGG - Intergenic
1075940542 10:126387646-126387668 CTCCGGGCCAGCCCTTCACCAGG - Intronic
1076078589 10:127557438-127557460 AGGCAGACCCACCCTTAACCTGG + Intergenic
1076614978 10:131749184-131749206 AGCCCTGCCCGCCCTTGACTTGG - Intergenic
1076694610 10:132241089-132241111 AGCCAGGCCCTCACTTAACTAGG - Intronic
1076858317 10:133128052-133128074 ACCCAGACCCGCCCTGCACCTGG + Intronic
1077063324 11:627040-627062 CGCCAGGCCCGCCCGCCCCCCGG - Intronic
1077100796 11:821496-821518 AGCCAGGCCCCACATTCACTGGG + Intronic
1077145535 11:1042658-1042680 ACCCAGTCCTGCTCTTCACCTGG - Intergenic
1077424342 11:2467308-2467330 AGCCAGTCCTGCCCTCCTCCTGG - Intronic
1077436023 11:2539616-2539638 AGCCGCGGCCGCCCTTCACCAGG - Intronic
1079256329 11:18834510-18834532 AGTAAGGGCCCCCCTTCACCAGG + Intergenic
1080459139 11:32438313-32438335 CGCGAGGCCCGCCCTTCGCGAGG + Intergenic
1080727427 11:34912573-34912595 AGGCAGGCCCACCCTTAATCTGG + Intronic
1081810107 11:45909732-45909754 AGCCAGGCTCACTGTTCACCAGG + Exonic
1082649855 11:55776460-55776482 AGGCAGGCCCACCCTTAATCTGG + Intergenic
1083159804 11:60848050-60848072 AGCCTGGCTGGCCCCTCACCTGG - Exonic
1083166249 11:60889968-60889990 AGCCAGCCCCGACCTTCCACTGG + Intergenic
1084005784 11:66322859-66322881 AGCCCGGCCCGCCCTGCCGCCGG - Intergenic
1084151862 11:67291378-67291400 AGCCAGCCCAGCCCTTCATCAGG - Intronic
1084315498 11:68343128-68343150 TGCCAGGCCTGCACCTCACCAGG - Intronic
1084430690 11:69109288-69109310 AGCCAGGCCTGCCCTGGCCCAGG - Intergenic
1084531518 11:69730577-69730599 AGCCAGGCCAGCCCCTCCCTGGG - Intergenic
1084601203 11:70146933-70146955 AGGCAGACCCACCCTTCATCTGG - Intronic
1086053769 11:82624622-82624644 AGGCAGGCCCACCCTTAATCTGG + Intergenic
1086181552 11:83957382-83957404 AGCCAGGTCTGCTCTTCACGTGG + Intronic
1089200446 11:116721570-116721592 AGGCAGACCCACCCTTCATCTGG - Intergenic
1090352128 11:126114472-126114494 AGCCAGTCCCTCCCTACACTTGG - Intergenic
1090884084 11:130861200-130861222 AGCCAGGTCCACCCTTGGCCAGG - Intergenic
1091342305 11:134825346-134825368 AGGCAGGCCCACCCTTCATCTGG - Intergenic
1091690102 12:2590030-2590052 AACCAGGCACTCCCTTCAGCTGG + Intronic
1093389548 12:18602150-18602172 AGCCTGACTCGCCCTCCACCTGG + Intronic
1093720529 12:22437214-22437236 AGCCTGTCTCGCCCTGCACCTGG + Intergenic
1095098834 12:38161621-38161643 AGCCATGCCCGCCCGACTCCAGG + Intergenic
1097055030 12:56244021-56244043 AGCCAGGAGCCCCCTTCCCCAGG + Intronic
1099393006 12:82103047-82103069 AGCCAGGCTCGTCCACCACCTGG + Intergenic
1101635316 12:106535646-106535668 AGCCCGGCTCGCCCACCACCTGG - Intronic
1103724604 12:122991418-122991440 AGCCGGGCCCACCCCTCACCTGG - Intronic
1104795287 12:131512816-131512838 AGGCAGACCCGCCCTTAATCTGG + Intergenic
1105591146 13:21794118-21794140 AGGCAGACCCACCCTTAACCCGG - Intergenic
1106438330 13:29743217-29743239 AGGCAGGTCCGCCACTCACCAGG - Intergenic
1107148647 13:37087034-37087056 AGGCAGACCCACCCTTAACCTGG - Intergenic
1108259658 13:48644121-48644143 ACAAAGGCCCTCCCTTCACCTGG + Intergenic
1108862293 13:54876636-54876658 AGGCAGACCCGCCCTTAATCTGG + Intergenic
1108927749 13:55774274-55774296 AGGCAGGTCCACCCTTCATCTGG + Intergenic
1110750571 13:79110299-79110321 AGGGAGGCCCACCCTTAACCTGG + Intergenic
1111346740 13:86966908-86966930 AGGCAGACCCACCCTTCATCTGG + Intergenic
1113390485 13:109892014-109892036 AGGCAGGCCCACCCTTAATCTGG - Intergenic
1113523874 13:110958817-110958839 ACCCAATCCCACCCTTCACCCGG - Intergenic
1113876743 13:113599500-113599522 AGCCAGGGCAGCCCATCAACAGG - Intronic
1113908985 13:113832926-113832948 CTGCAAGCCCGCCCTTCACCTGG - Intronic
1113936100 13:113996023-113996045 AGCCGGGCCCCCCCATCAGCCGG - Intronic
1113936109 13:113996040-113996062 AGCCGGGCCCCCCCATCAGCCGG - Intronic
1114066166 14:19061693-19061715 ACCCAGGCCCGCCCATTCCCAGG - Intergenic
1114096102 14:19338331-19338353 ACCCAGGCCCGCCCATTCCCAGG + Intergenic
1116520338 14:45839216-45839238 AGCCAGGCCTGTCCATCACCAGG + Intergenic
1118843178 14:69527709-69527731 AGCCAGTCCCTCCCTTCCCAAGG - Intronic
1118981971 14:70724465-70724487 AGCCCTGCCTGCCCCTCACCTGG - Intronic
1119736877 14:76988260-76988282 AGCCAGGCCAGCCCCTAAACTGG + Intergenic
1121334594 14:93069601-93069623 AGACAGGCCTGCCCTGCCCCTGG + Intronic
1122264537 14:100540458-100540480 AGCCAGGCCCACCCCGCCCCGGG - Intronic
1122272663 14:100575332-100575354 AGCGATGCCAGCCCTTCACAGGG - Intronic
1122504429 14:102222578-102222600 AGCCCTGCCCGCCCTTCTCTTGG + Intronic
1122976294 14:105172225-105172247 AGCCTGGGCCGCCCAGCACCAGG - Intergenic
1123469912 15:20541951-20541973 AGCCAGCCCCGCCCCTCTCCTGG - Intergenic
1123648143 15:22458730-22458752 AGCCAGCCCCGCCCCTCTCCTGG + Intergenic
1123730206 15:23136973-23136995 AGCCAGCCCCGCCCCTCTCCTGG - Intergenic
1123748344 15:23334383-23334405 AGCCAGCCCCGCCCCTCTCCTGG - Intergenic
1123763113 15:23447430-23447452 AGCCAGCCCCGCCCCTCTCCTGG - Intergenic
1124280722 15:28358270-28358292 AGCCAGCCCCGCCCCTCTCCTGG - Intergenic
1124301982 15:28553359-28553381 AGCCAGCCCCGCCCCTCTCCTGG + Intergenic
1126577453 15:50210749-50210771 AGCCTGACTCGCCCTCCACCTGG + Intronic
1127766919 15:62195396-62195418 AGCCAGCCCAGCCCTGCCCCGGG + Intergenic
1128674051 15:69595836-69595858 AGGCAGCCCTGGCCTTCACCAGG - Intergenic
1130123156 15:81069637-81069659 AGCAAGGCACCTCCTTCACCAGG - Intronic
1131158908 15:90091709-90091731 AGCCAGGCCCGCCCTTCACCAGG + Intronic
1132717915 16:1301311-1301333 AGCCAGGTCTGCACTCCACCGGG + Intergenic
1133222186 16:4323519-4323541 TGCCAGGCCGGCCCTGCAGCTGG + Intronic
1133982892 16:10646781-10646803 AAGGAGGCCAGCCCTTCACCTGG + Intronic
1133997877 16:10761983-10762005 AGCCAGACCCACCCTCCAGCTGG + Intronic
1134444361 16:14319717-14319739 AGCCAGGCCTGCCCCTCTCAGGG - Intergenic
1134597069 16:15504202-15504224 AGCCAGGCCAGCCCTTGAAGAGG - Intronic
1136114881 16:28088179-28088201 AGCCAGGGCAGCTCTGCACCAGG - Intergenic
1138379388 16:56589744-56589766 AGGCATGCCCGCCCTTCACGAGG - Intronic
1139415183 16:66801980-66802002 AGCCAGGCCTCCACCTCACCAGG + Intergenic
1140232065 16:73125514-73125536 AGGCAGACCCACCCTTAACCTGG + Intergenic
1140809900 16:78567144-78567166 TGCCAATCACGCCCTTCACCAGG - Intronic
1141040897 16:80671420-80671442 ACCCAGGCCCCTCCTGCACCTGG + Intronic
1141780419 16:86156378-86156400 AGCCTGGCCAGACCTTCACCAGG - Intergenic
1142373807 16:89696813-89696835 AGCCAGGTCAGCCGTGCACCCGG + Exonic
1143165474 17:4895293-4895315 AGCCAGGCCCTCACCTAACCAGG - Intronic
1143633075 17:8149826-8149848 AGCAAGGCTCGCCCTCCTCCAGG + Exonic
1144201135 17:12943686-12943708 ACCCCGGCCCTCCCTTCTCCAGG - Intronic
1146265572 17:31450597-31450619 AGCCTTGCCCGCCCTCCTCCTGG + Intronic
1146837316 17:36122387-36122409 AGGCAGACCCACCCTTAACCTGG - Intergenic
1147332520 17:39707162-39707184 AGCCAGGCCCTGCCTCCAGCTGG + Intronic
1147463236 17:40589314-40589336 AGCCCATCTCGCCCTTCACCTGG - Intergenic
1148282688 17:46361383-46361405 AGCCAGGCACGCCCGGCTCCCGG + Intronic
1148304906 17:46579308-46579330 AGCCAGGCACGCCCGGCTCCCGG + Intronic
1149330589 17:55577249-55577271 ACCCAGGCCCGCCCTGCATGCGG + Intergenic
1152101066 17:78301989-78302011 GGCCTGGCCTGCCCTGCACCGGG + Intergenic
1152209630 17:78996177-78996199 GGCCAGGCCCTCCCCACACCCGG - Intronic
1152610052 17:81310988-81311010 AGCACTGCCCGCCCTTCCCCTGG + Intergenic
1152660849 17:81541246-81541268 AGCCAGGAGCGCCCATCGCCAGG - Intronic
1152738070 17:82007192-82007214 TCCCACACCCGCCCTTCACCTGG - Intronic
1152890200 17:82876344-82876366 AGACAGGCCGGCCCTTCTCGCGG + Intronic
1203171135 17_GL000205v2_random:148635-148657 AGCCTGGCCCTGCCTTCACTGGG - Intergenic
1153965980 18:10182322-10182344 AGCCTGTCCTGCCCTCCACCTGG - Intergenic
1154100300 18:11466714-11466736 TGCCAGGCTAGACCTTCACCAGG + Intergenic
1159002790 18:62988363-62988385 AGCCAGGCCCGTCCTCCTTCTGG + Intergenic
1160169138 18:76538517-76538539 GGCCAGGCCTGCCCTTCCTCAGG + Intergenic
1160214894 18:76920050-76920072 AGCCATGCCCTCACCTCACCAGG - Exonic
1160826421 19:1082449-1082471 CCCCAGTCCCGCCCTTCCCCGGG - Intronic
1160916967 19:1501409-1501431 TGCCAGGCTCGCTCTGCACCTGG + Intergenic
1161280895 19:3445309-3445331 AGCCAGGCCCGGGCTTTTCCAGG - Intronic
1161461474 19:4400244-4400266 AGCCAGGCCCGACCTGGCCCGGG - Intronic
1162380764 19:10330394-10330416 AGCCAGGCCCTCCCATCTTCAGG + Intronic
1163390487 19:17027199-17027221 CCCCGGGCCCGCCCCTCACCAGG + Intergenic
1164927287 19:32140272-32140294 AGCCAGACCCGCTCTTCACTGGG - Intergenic
1164989844 19:32675629-32675651 AGCCTGGCCCGCTTTTTACCTGG + Exonic
1165349473 19:35268366-35268388 ATCCAGACCCGCGTTTCACCAGG + Intergenic
1165437899 19:35806703-35806725 ACCCAGGGCCCGCCTTCACCCGG + Exonic
1165793491 19:38505943-38505965 ACCCAGGCCCCGCCTTCACCTGG - Exonic
1166503223 19:43355887-43355909 AGCCAGGCCCACCCTCCTCTGGG - Intronic
1168239641 19:55082599-55082621 TCCCAGCCCCGCCCCTCACCCGG - Exonic
1168297289 19:55383703-55383725 TGCCCCGCCCGCCCCTCACCTGG + Exonic
925180526 2:1814288-1814310 AGCAGGGCCCGGCCTGCACCAGG + Intronic
925244392 2:2367427-2367449 AGCCAGGCCCGCCCCACAGATGG - Intergenic
926109453 2:10172695-10172717 ACCCAGCCCCTCCCTTCGCCAGG - Intronic
926224929 2:10960908-10960930 AGCCACGCCGGCCCCTCCCCGGG - Intergenic
927504962 2:23606947-23606969 AGCCAGGCCCAACCCTTACCAGG - Intronic
928201677 2:29251301-29251323 GGCCAGGCCCTCCCTCCTCCAGG + Intronic
929270418 2:39965364-39965386 AGGCAGACCCACCCTTAACCTGG - Intergenic
929899149 2:45986467-45986489 AGCCAGGCTTGCCCTCCATCTGG - Intronic
930061644 2:47294524-47294546 AGGCAGGCCCACCCATAACCGGG + Intergenic
933915960 2:86993779-86993801 AGGCAGACCCACCCTTAACCTGG - Intronic
934007033 2:87776123-87776145 AGGCAGACCCACCCTTAACCTGG + Intronic
935183599 2:100712179-100712201 AGGCAGGCCCACCCTTAATCAGG + Intergenic
935770676 2:106417030-106417052 AGGCAGACCCACCCTTAACCTGG + Intronic
935909410 2:107878906-107878928 AGGCAGACCCACCCTTAACCTGG - Intronic
937337457 2:121070678-121070700 ACCCAGGCCTGGCCTTCAGCTGG + Intergenic
938152890 2:128902021-128902043 AGCCAGGCCCTCCCTCCTGCAGG + Intergenic
938483569 2:131681829-131681851 ACCCAGGCCCGCCCATTCCCAGG - Intergenic
939943254 2:148377323-148377345 AGGCAGACCCACCCTTAACCTGG - Intronic
941071035 2:160954905-160954927 AGGCAGAACCACCCTTCACCAGG + Intergenic
942546755 2:177073414-177073436 AGCTTGGCCCTCCCTTCACTTGG + Intergenic
945379408 2:209121748-209121770 AGGCAGACCCGCCCTTAATCTGG - Intergenic
948463867 2:238143051-238143073 ACCCAGGCACGCCCCTCACAGGG - Intronic
1169216979 20:3799805-3799827 AGCCAGGCCAGCTCCTCACAGGG + Intronic
1169830310 20:9817868-9817890 GGCCATGCCTGGCCTTCACCAGG - Intronic
1171208098 20:23296658-23296680 GACCAGTTCCGCCCTTCACCTGG - Intergenic
1171427208 20:25056852-25056874 ACCCAGGCCCACCCTGCATCCGG + Intronic
1172662420 20:36576269-36576291 AGCAAGGCCCACCCTCCACTTGG - Intronic
1172744311 20:37194760-37194782 AACCAGGCCCGCTTTTCCCCAGG - Intronic
1172884041 20:38219611-38219633 AGCCAGACACCCCTTTCACCTGG + Exonic
1174483825 20:50849098-50849120 TGCCAGGCCGGCCCTCCTCCTGG + Intronic
1174959957 20:55144655-55144677 AGCAAGGCACCCCCTTCACAAGG - Intergenic
1175851687 20:62097288-62097310 AGGCAGGCCCTCCATTCCCCCGG - Intergenic
1176327119 21:5510465-5510487 AGCCTGGCCCTGCCTTCACTGGG - Intergenic
1176400638 21:6310486-6310508 AGCCTGGCCCTGCCTTCACTGGG + Intergenic
1176436519 21:6678618-6678640 AGCCTGGCCCTGCCTTCACTGGG - Intergenic
1176460781 21:7005688-7005710 AGCCTGGCCCTGCCTTCACTGGG - Intergenic
1176484342 21:7387466-7387488 AGCCTGGCCCTGCCTTCACTGGG - Intergenic
1177139113 21:17339791-17339813 AGGCAGGCCCACCCTTAATCTGG - Intergenic
1179536662 21:42057243-42057265 GCCCACGCCCGCCCTTCCCCAGG + Intergenic
1180043958 21:45294235-45294257 GGACAGGCCCTCCCTTCCCCAGG - Intergenic
1180969402 22:19807268-19807290 GGCCAGGGCCCCCCTACACCTGG + Intronic
1181278714 22:21703509-21703531 GGCCCGGCCCGCCCCTGACCAGG + Intronic
1181364182 22:22362047-22362069 AGGCAGACCCGCCCTTAACCTGG - Intergenic
1181373411 22:22436699-22436721 AGCCATGCCCACCCTTAATCTGG - Intergenic
1181648819 22:24247777-24247799 GGCCAGGCCCTCCCTTCCCTGGG - Intergenic
1182355453 22:29720583-29720605 CCCCTGGCCCGCGCTTCACCTGG - Intronic
1182408153 22:30156104-30156126 AGCCATGCTCGCCCTCCACATGG + Intronic
1182505566 22:30779855-30779877 AGCAAGGACCAGCCTTCACCGGG - Intronic
1183303263 22:37068984-37069006 CCCCAGCCCCGCCCTTCTCCAGG + Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184101485 22:42343689-42343711 CGCGAGGCCCGCCCCCCACCCGG - Intergenic
1184276768 22:43413096-43413118 AGCCAGGCCAGCCCAGCACTGGG - Intronic
1184783849 22:46662382-46662404 AGCCAGTCCCTCCCTTCAGAAGG - Intronic
1185122185 22:48977945-48977967 AGCCCGGCCCGTTCTTCCCCTGG - Intergenic
1185128687 22:49025603-49025625 ACACAGGCCAGCCCTTCCCCTGG + Intergenic
949993148 3:9596069-9596091 AGCCTGGCCCCTCCTTTACCTGG + Intergenic
952097234 3:29968221-29968243 AGCCTGTCTCGCCCTCCACCTGG - Intronic
953050438 3:39336971-39336993 AGGCAGACCCACCCTTAACCTGG + Intergenic
954807732 3:53230140-53230162 GGCCAGGCCTGTCCTCCACCTGG + Intronic
954871647 3:53771888-53771910 AGCCTGGCCCTCCCTGCAGCTGG - Intronic
957465342 3:80582229-80582251 AGGCAGACCCACCCTTAACCTGG - Intergenic
957633976 3:82758441-82758463 AGACAGGCCCACCCTTAATCTGG + Intergenic
959631552 3:108512868-108512890 TGCCAGGCCCGCCCCACTCCTGG - Intronic
960732580 3:120742966-120742988 AGCCAAGCCCGCCCTACCCGAGG - Intronic
962827440 3:139110270-139110292 AGCCAGGCCCTTCCTGCGCCGGG - Intronic
963355341 3:144204380-144204402 AGGCAGACCCACCCTTCATCTGG - Intergenic
964601298 3:158503763-158503785 AGCCTGGCTCGCCCAACACCTGG - Intronic
965360752 3:167735322-167735344 CACCAAGCCCTCCCTTCACCTGG - Intronic
966298744 3:178454944-178454966 AGCCAGGCCAGCACTCCACTGGG + Intronic
967862207 3:194160660-194160682 AGCCAGGCCCTCACTTCTGCTGG + Intergenic
968591125 4:1460151-1460173 AGCCAGCCCCGCCCTGCTCTGGG + Intergenic
968753147 4:2400810-2400832 AGGCAGGCCCACCCTTAATCTGG - Intronic
969292259 4:6247557-6247579 AGGCAGACCCACCCTTCATCTGG - Intergenic
969305980 4:6326528-6326550 TGGCAGGCCTGCCCTTCCCCAGG - Intronic
969389154 4:6877747-6877769 AGGCAGACCCACCCTTCATCTGG - Intronic
969922060 4:10549824-10549846 AGCCAGGCATGCTCTCCACCTGG + Intronic
970458060 4:16245246-16245268 AGGCAGACCCACCCTTAACCTGG - Intergenic
971188064 4:24400267-24400289 AGGCAGACCCACCCTTAACCTGG + Intergenic
971912026 4:32806517-32806539 AGGCAGACCCACCCTTAACCTGG + Intergenic
973867203 4:55125684-55125706 GGCCAGCCCCGCCCCTCACCCGG + Intergenic
974380300 4:61130882-61130904 AGGCAGACCCACCCTTAACCTGG - Intergenic
974508872 4:62810989-62811011 AGACAGGCCCACCCTTAATCTGG + Intergenic
975677781 4:76844260-76844282 AGGCAGACCCACCCTTAACCTGG + Intergenic
976068340 4:81215065-81215087 AGCCAGCCCCGCCGTGCACACGG + Exonic
976379640 4:84384566-84384588 AGCCAAGCCTGCCCTGGACCTGG - Intergenic
977898672 4:102394364-102394386 AGGCAGACCCACCCTTAACCTGG + Intronic
979467740 4:121059883-121059905 AGACAGACCCACCCATCACCTGG - Intronic
979523829 4:121697078-121697100 AGCCGGGCCCGCCCCTGCCCCGG + Exonic
979995429 4:127425981-127426003 AGCCTGACTCGCCCTCCACCTGG + Intergenic
981834410 4:149038861-149038883 AGACAGGCCCACCCTTAATCTGG + Intergenic
982527136 4:156492014-156492036 AGCCAGACCCACCCTTAATCTGG + Intergenic
982627103 4:157781153-157781175 AGACAGACCCACCCTTAACCTGG - Intergenic
982835020 4:160112721-160112743 AGCCAGACCCACCCTTAATCTGG + Intergenic
982835851 4:160119134-160119156 AGCCAGACCCACCCTTAATCTGG + Intergenic
984807989 4:183768851-183768873 AGCCGCGCCCGGCCTGCACCAGG + Intergenic
985121707 4:186649681-186649703 AGCCAGGCCCTCACGGCACCTGG + Intronic
985209060 4:187572544-187572566 AGCCAGGGCTGCCCTTCAGTGGG - Intergenic
985615623 5:918877-918899 AGGCAGACCCACCCTTAACCTGG - Intronic
985653174 5:1116314-1116336 GGCCAGGCCCACCATCCACCAGG - Intergenic
985798154 5:1980260-1980282 AGGCAGACCCACCCTTAACCTGG + Intergenic
986351148 5:6880516-6880538 AGGCAGACCCACCCTTAACCTGG - Intergenic
986668721 5:10125320-10125342 AGCGAGGCCCGGCCAGCACCTGG + Intergenic
990273881 5:54175017-54175039 AGTCAGGCCAGCCCTCCTCCAGG - Intronic
991351142 5:65721964-65721986 AGGCAGGCCCGCCCGACCCCTGG + Exonic
991450012 5:66741735-66741757 AGCCAGGCCACCTCCTCACCAGG - Intronic
992761933 5:79958109-79958131 AGCCAGGCCCTCCTCTCTCCCGG - Intergenic
994018333 5:94994741-94994763 AGGCAGACCCGCCCTCCATCTGG + Intronic
997382068 5:133445271-133445293 AGCCAGGCCAGTCCCTCACCTGG - Intronic
998167111 5:139850513-139850535 AGCCAGGCCTGCCCAGCACAGGG + Intronic
998200267 5:140113486-140113508 AGACAGGCCCACCCGCCACCCGG - Intronic
998599281 5:143568690-143568712 AGGCAGGCCCACCCTTAATCTGG - Intergenic
999328936 5:150659958-150659980 TGCTAGGCCCACCCTTCCCCAGG + Intergenic
1001251624 5:170151461-170151483 GGCCAGTCCCGCCCTCCCCCAGG - Intergenic
1001417414 5:171555700-171555722 AGCCTAGCCCGACCTCCACCAGG + Intergenic
1001589496 5:172855691-172855713 AGCCAGGCCCGTCCAGCACGTGG + Intronic
1002311702 5:178318975-178318997 AGCCAGCACCTGCCTTCACCTGG - Intronic
1004107958 6:12683948-12683970 AGGCAGGCCCACCCTTAAGCAGG + Intergenic
1005730535 6:28692941-28692963 GGGCAGGCCACCCCTTCACCTGG + Intergenic
1006376954 6:33676966-33676988 AGCCAGGCCCAGCCCTCACAGGG - Intronic
1007790906 6:44307554-44307576 AGCCAGGCCCTGCCCTCACGGGG + Exonic
1008588894 6:52973880-52973902 AGCCAGACCCACCCTTAATCTGG + Intergenic
1009787024 6:68353511-68353533 AGACAGACCCACCCTTAACCTGG - Intergenic
1011294160 6:85808707-85808729 AGGCAGGCCCACCCTTAATCTGG + Intergenic
1012921250 6:105223060-105223082 AGGCAGACCCGCCCTTAATCTGG - Intergenic
1014555390 6:122839107-122839129 AGGCAGGCCCACCCTTAATCTGG + Intergenic
1015467388 6:133562006-133562028 AGGCAGACCCACCCTTCATCTGG - Intergenic
1018894725 6:168005802-168005824 AGGCAGACCCGCCCTTAATCTGG - Intronic
1019325841 7:437856-437878 AAACAGGCTCGCCCCTCACCCGG + Intergenic
1020279561 7:6643361-6643383 AGGCTGGCCCTCCCCTCACCTGG + Intronic
1021024091 7:15643259-15643281 CCCCAGCCCCACCCTTCACCAGG - Intronic
1021152421 7:17167705-17167727 AGGCAGGCCCACCCTTAATCTGG - Intergenic
1023864984 7:44234291-44234313 GGCCAGACCCCACCTTCACCCGG + Intronic
1026324308 7:69295608-69295630 AGGCAGACCCACCCTTCACCTGG - Intergenic
1032532645 7:132634899-132634921 AGGCAGGCCCACCCTTAATCTGG + Intronic
1033482522 7:141756100-141756122 GGGCAGGCCACCCCTTCACCTGG - Intronic
1035717361 8:1764132-1764154 AGCCACCCCGGCCCCTCACCCGG - Intronic
1035745051 8:1955867-1955889 GGACAGGCCCGCTCATCACCTGG - Intronic
1036688015 8:10924584-10924606 ACCCCGGCCTGCCCTCCACCTGG - Intronic
1037833351 8:22201721-22201743 AGCCAGGCCTCCACTTCCCCTGG + Intronic
1038607157 8:29018880-29018902 AGCCAGGCACTCCTTTCTCCAGG - Exonic
1039843221 8:41308392-41308414 GGCCAGCCCCGCCGTGCACCTGG + Intronic
1041648870 8:60281555-60281577 ATCCCCGCCCGCCCTTCCCCCGG + Intergenic
1043716255 8:83490454-83490476 AGGCAGACCCACCCTTAACCTGG - Intergenic
1045394900 8:101750799-101750821 AGGCAGGCCTGCTCATCACCTGG - Intronic
1048126495 8:131641305-131641327 AGGCAGGCCCGCCCTTAATCTGG + Intergenic
1048753945 8:137713725-137713747 AGGCAGACCCACCCTTCATCTGG + Intergenic
1049093077 8:140531449-140531471 TGCCAGCACCGCCCTTCACCCGG - Exonic
1049245191 8:141558701-141558723 AGCCAGGCCACCCCTTAGCCCGG + Intergenic
1049286490 8:141778186-141778208 TGCCAGGCCTGCTCTCCACCTGG - Intergenic
1049698310 8:143994377-143994399 CGCCTGCCCCGCCCTCCACCAGG + Intronic
1049813853 8:144588905-144588927 CGCCGGGCCCGCCCTCCTCCAGG + Intronic
1050068637 9:1787395-1787417 AGCAAGGCTCGCCCTTCTGCAGG + Intergenic
1052469950 9:28881197-28881219 GGGCAGGCCACCCCTTCACCGGG + Intergenic
1053801359 9:41766355-41766377 GGCCAGGTCCCCCCTTCACGGGG - Intergenic
1054143842 9:61548468-61548490 GGCCAGGTCCGCCCTTCACGGGG + Intergenic
1054189789 9:61978509-61978531 GGCCAGGTCCCCCCTTCACGGGG - Intergenic
1054648725 9:67610083-67610105 GGCCAGGTCCCCCCTTCACGGGG + Intergenic
1056555381 9:87683702-87683724 ACCCAGAGCCACCCTTCACCAGG - Intronic
1059196196 9:112373439-112373461 AGGCAGGCCCACCCTTAATCTGG - Intergenic
1061271582 9:129546767-129546789 TGCCAGGCCAGCCCTACACTAGG - Intergenic
1061994155 9:134175518-134175540 GGCCAGCCCCGCACTCCACCCGG - Intergenic
1062451202 9:136616511-136616533 AGCCAGGCCAGCCCCTCACACGG - Intergenic
1062540070 9:137037692-137037714 AGGCAGACCCACCCTTCATCTGG + Exonic
1062689205 9:137832764-137832786 GGCCAGGCCCAGCTTTCACCAGG - Intronic
1203773560 EBV:61109-61131 AATCTGGCCCGCCCTTCGCCGGG - Intergenic
1203434997 Un_GL000195v1:130041-130063 AGCCTGGCCCTGCCTTCACTGGG + Intergenic
1186079972 X:5920468-5920490 AGCCAGGACCAACTTTCACCTGG - Intronic
1186461395 X:9751176-9751198 AGCCAGGCCTGACGTCCACCTGG - Intronic
1190139750 X:47832392-47832414 AGGCAGGCCCACCCTTAATCTGG - Intergenic
1190753311 X:53380603-53380625 AGCCAGGCCCGCCCTACCTCAGG + Exonic
1191151861 X:57228022-57228044 AGCCTGACTGGCCCTTCACCTGG - Intergenic
1194491530 X:94555894-94555916 AGGCAGGCCCACCCTTAATCTGG + Intergenic
1197067622 X:122252632-122252654 AGGCAGACCCGCCCTCCATCTGG - Intergenic
1197837567 X:130711855-130711877 AGCCAGGCCAGCCCTCCAGATGG + Intronic
1200148895 X:153941931-153941953 AGCCCACCCCGCCCCTCACCTGG + Exonic