ID: 1131160341

View in Genome Browser
Species Human (GRCh38)
Location 15:90101435-90101457
Sequence TGCGTTGGCAACGGAGGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131160331_1131160341 6 Left 1131160331 15:90101406-90101428 CCGATGCCCACACGCCAAGCAAG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1131160341 15:90101435-90101457 TGCGTTGGCAACGGAGGCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 72
1131160334_1131160341 -1 Left 1131160334 15:90101413-90101435 CCACACGCCAAGCAAGGCAGCCT 0: 1
1: 0
2: 1
3: 11
4: 165
Right 1131160341 15:90101435-90101457 TGCGTTGGCAACGGAGGCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 72
1131160330_1131160341 24 Left 1131160330 15:90101388-90101410 CCAGGGTGAGGGGGCAGGCCGAT 0: 1
1: 0
2: 0
3: 6
4: 162
Right 1131160341 15:90101435-90101457 TGCGTTGGCAACGGAGGCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 72
1131160333_1131160341 0 Left 1131160333 15:90101412-90101434 CCCACACGCCAAGCAAGGCAGCC 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1131160341 15:90101435-90101457 TGCGTTGGCAACGGAGGCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 72
1131160335_1131160341 -8 Left 1131160335 15:90101420-90101442 CCAAGCAAGGCAGCCTGCGTTGG 0: 1
1: 0
2: 0
3: 9
4: 155
Right 1131160341 15:90101435-90101457 TGCGTTGGCAACGGAGGCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131160341 Original CRISPR TGCGTTGGCAACGGAGGCTC GGG Intronic
905145286 1:35883257-35883279 GGCGGCGGCAACGGAGGCTGCGG + Exonic
906774055 1:48512700-48512722 TGAGTGGGCAAAGCAGGCTCTGG - Intergenic
907521138 1:55024132-55024154 TGCATTGGGAACAGAGGCTAGGG - Intergenic
910070334 1:83206358-83206380 TGCATTGGCAAAGAAGGTTCTGG - Intergenic
910859785 1:91732188-91732210 TGCTGTGGAAACTGAGGCTCTGG + Intronic
916445056 1:164864398-164864420 TCCGTGGGCAACAGAGGCTGGGG - Intronic
919662125 1:200257478-200257500 TGCACTGGCTCCGGAGGCTCAGG - Intergenic
1063362998 10:5472310-5472332 TGCGTTGGGAACAGAGGCTAGGG - Intergenic
1065492076 10:26292213-26292235 TGCCTGGGGAATGGAGGCTCTGG + Intronic
1067804172 10:49381806-49381828 TGGGTAGGCCACGGAGGTTCGGG - Intronic
1073172520 10:101522922-101522944 TGGGTTGGGCACGGTGGCTCAGG + Intronic
1074481607 10:113826883-113826905 TGTGTTGGCATCTGATGCTCAGG - Intergenic
1083591006 11:63894875-63894897 TGTGTTGCCAATGGAGGTTCAGG + Intronic
1086087612 11:82970980-82971002 GGCGCTGGTAAGGGAGGCTCAGG - Intergenic
1086887914 11:92225355-92225377 AGCGGTAGCAACGGCGGCTCGGG - Intergenic
1099712157 12:86241903-86241925 TGGATTGGCAAAGCAGGCTCAGG - Intronic
1103120396 12:118375485-118375507 TGCGTTTCCTACGGAGACTCGGG + Intergenic
1104381706 12:128313124-128313146 TGGGTTGGGAAGGCAGGCTCGGG + Intronic
1107555498 13:41513878-41513900 GGCGTTGGAACCGGAAGCTCTGG + Intergenic
1111720763 13:91941316-91941338 TGCTTTGGCTATGTAGGCTCTGG + Intronic
1112629665 13:101147182-101147204 TGCATTGGCCAGGGAGGCACTGG - Intronic
1112734210 13:102399886-102399908 TGGGGTGGCAATTGAGGCTCTGG - Intronic
1122599079 14:102912404-102912426 TGCGCTGGCAAGGGACCCTCAGG - Intergenic
1131160341 15:90101435-90101457 TGCGTTGGCAACGGAGGCTCGGG + Intronic
1132866530 16:2095616-2095638 TGCGTTGGGAAAGGAGCCACGGG + Intronic
1135967432 16:27047744-27047766 TGCATGGGGAAAGGAGGCTCTGG - Intergenic
1137454696 16:48609654-48609676 TGGGTTGGGAACGCAGTCTCGGG - Intronic
1141553385 16:84820940-84820962 AGCCTTAGCAAGGGAGGCTCTGG - Intronic
1142296839 16:89229672-89229694 TGCGTGAGCAGCGTAGGCTCTGG + Exonic
1142342361 16:89531996-89532018 GGCGGTGGCCACGGAGGCTCAGG + Exonic
1157534238 18:48446883-48446905 TGTGTTGGCAAAGGAGGAGCTGG - Intergenic
1160666953 19:335426-335448 TGCGGTGGCCACTGAGGGTCCGG - Intronic
1161118550 19:2512710-2512732 TGCCCTGGCAGCGGGGGCTCGGG + Exonic
1164202609 19:23030997-23031019 TGCATTGGGAACGGAGACTAGGG + Intergenic
1165017464 19:32891232-32891254 TGCTTTGGCAATGGAGGCATTGG - Intronic
1165835241 19:38751137-38751159 TGCATTGGGAACAGAGGCTAGGG - Intronic
1167163503 19:47782426-47782448 TGGGTTGGGAAGGGGGGCTCAGG - Intronic
925385325 2:3458072-3458094 TGCGTCGGGGACAGAGGCTCGGG + Intronic
929552805 2:42905144-42905166 TGCTGAGGCAACTGAGGCTCAGG + Intergenic
944118527 2:196214670-196214692 TGGGGTGGCCAAGGAGGCTCAGG + Intronic
947765574 2:232635006-232635028 TGCAGGGGCAGCGGAGGCTCAGG - Intronic
1172118591 20:32585100-32585122 GGCGTTGGCGGCGGCGGCTCCGG + Intronic
1174024558 20:47562556-47562578 TGTGTTGGCAAATGAGGGTCAGG + Intronic
1175883000 20:62271288-62271310 CGAGTTGGCAAAGGAGTCTCAGG - Intronic
1175953546 20:62596483-62596505 TGTGGGGGCAACGGAGACTCCGG - Intergenic
1178208700 21:30501957-30501979 GGCGGTGGCTACGGAGGCTACGG - Exonic
1179030591 21:37716504-37716526 TGAGTAGGCACAGGAGGCTCAGG + Intronic
1181164730 22:20977183-20977205 TGTGGTGGAAACTGAGGCTCTGG - Intronic
950100443 3:10353354-10353376 TGAGCTGCCAACTGAGGCTCTGG + Intronic
953773476 3:45796526-45796548 TGCGTCGGCGGCGGAGGCGCGGG - Exonic
954433874 3:50485744-50485766 TGCCCTGGTAACTGAGGCTCAGG + Intronic
957958179 3:87216563-87216585 TGTGTTGTCAAGGGAGGCTGGGG - Intergenic
964983522 3:162713906-162713928 TGCATTGGGAACAGAGGCTAGGG - Intergenic
977848810 4:101799429-101799451 TGTCTTGGCAATGCAGGCTCTGG + Intronic
979295194 4:119024298-119024320 TGATTTTGCAACGGAAGCTCTGG + Intronic
980456699 4:133053695-133053717 TGTCTTGGCAATGCAGGCTCAGG - Intergenic
980943866 4:139300874-139300896 TGCACTGCCAAAGGAGGCTCTGG - Exonic
1006177447 6:32130972-32130994 AGCTTTGGCAACTGAGACTCTGG + Intergenic
1010277912 6:73990718-73990740 CGCGCTGGTAAGGGAGGCTCCGG + Intergenic
1010841435 6:80652024-80652046 TGCATTGGGAACGGAGACTAGGG + Intergenic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1019997893 7:4736693-4736715 TGGGCTGGGCACGGAGGCTCAGG - Intronic
1024828289 7:53418131-53418153 TGGGTTGGGAAGGTAGGCTCTGG + Intergenic
1024883592 7:54116469-54116491 TGCAAGGGCAACGGAGACTCTGG + Intergenic
1026470946 7:70694000-70694022 GGCGGTGGCACCGGCGGCTCGGG + Intronic
1027288050 7:76671218-76671240 TGCATTGGCAAAGAAGGTTCTGG - Intergenic
1037187068 8:16077259-16077281 TGCGCTGGCAAAGGTGGCTTTGG - Intergenic
1043295985 8:78664800-78664822 TGGGTTGGCCAAGGAGGCCCAGG + Intergenic
1048463511 8:134642346-134642368 CGCATTGGAAACGGAGGCTCAGG - Intronic
1049026132 8:139990249-139990271 TGCACTGGAGACGGAGGCTCAGG + Intronic
1051770154 9:20569037-20569059 TACGTTGGAACCTGAGGCTCTGG - Intronic
1060737998 9:126078820-126078842 TGCATTGGGAACAGAGGCTAGGG + Intergenic
1060780750 9:126410667-126410689 AGGATGGGCAACGGAGGCTCCGG - Intronic
1062325952 9:136012561-136012583 TGGGGTGGCAGCCGAGGCTCTGG - Intronic
1187888078 X:23907703-23907725 GTCGCTGGCAGCGGAGGCTCCGG + Exonic
1199704991 X:150416655-150416677 TGAGTTGGCAACAATGGCTCTGG - Intronic