ID: 1131160429

View in Genome Browser
Species Human (GRCh38)
Location 15:90101868-90101890
Sequence CCGCGCGCTCCCCTGGCGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131160429_1131160442 16 Left 1131160429 15:90101868-90101890 CCTCTCGCCAGGGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1131160442 15:90101907-90101929 ACGGGTGCTCGTCTCGTTCCAGG 0: 1
1: 0
2: 0
3: 0
4: 25
1131160429_1131160444 18 Left 1131160429 15:90101868-90101890 CCTCTCGCCAGGGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1131160444 15:90101909-90101931 GGGTGCTCGTCTCGTTCCAGGGG 0: 1
1: 0
2: 0
3: 3
4: 46
1131160429_1131160445 24 Left 1131160429 15:90101868-90101890 CCTCTCGCCAGGGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1131160445 15:90101915-90101937 TCGTCTCGTTCCAGGGGCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 34
1131160429_1131160443 17 Left 1131160429 15:90101868-90101890 CCTCTCGCCAGGGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1131160443 15:90101908-90101930 CGGGTGCTCGTCTCGTTCCAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1131160429_1131160435 -2 Left 1131160429 15:90101868-90101890 CCTCTCGCCAGGGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1131160435 15:90101889-90101911 GGGGTGCTCCAGCCCCCCACGGG 0: 1
1: 1
2: 0
3: 23
4: 177
1131160429_1131160447 28 Left 1131160429 15:90101868-90101890 CCTCTCGCCAGGGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1131160447 15:90101919-90101941 CTCGTTCCAGGGGCGCAGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 116
1131160429_1131160446 25 Left 1131160429 15:90101868-90101890 CCTCTCGCCAGGGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1131160446 15:90101916-90101938 CGTCTCGTTCCAGGGGCGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1131160429_1131160448 29 Left 1131160429 15:90101868-90101890 CCTCTCGCCAGGGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1131160448 15:90101920-90101942 TCGTTCCAGGGGCGCAGGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 187
1131160429_1131160434 -3 Left 1131160429 15:90101868-90101890 CCTCTCGCCAGGGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1131160434 15:90101888-90101910 CGGGGTGCTCCAGCCCCCCACGG 0: 1
1: 0
2: 0
3: 19
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131160429 Original CRISPR CCGCGCGCTCCCCTGGCGAG AGG (reversed) Intronic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
902586168 1:17439726-17439748 CCGCGCGCTCGCTTGCCGCGCGG - Intergenic
904517254 1:31065896-31065918 GCGCGCGCTCGCCTAGCGGGCGG - Intronic
910177185 1:84443221-84443243 CCGTTCGCTCCCCTGGAAAGGGG + Intergenic
911647466 1:100352231-100352253 CCGCCCGCTCCCCTGGGCCGAGG + Intronic
920646540 1:207807952-207807974 CCGCGCCATCCCCAGGCCAGAGG - Intergenic
921325567 1:213983908-213983930 CCGCGCGCGCGCCTTCCGAGGGG - Intronic
1070086912 10:73246920-73246942 CAGCGCGCTCCCCCGGGGCGGGG + Intronic
1074864684 10:117537789-117537811 CGCCGCGCCCGCCTGGCGAGAGG + Intergenic
1076816933 10:132919699-132919721 CCGTGCACTCCCCCGGGGAGTGG - Intronic
1076824736 10:132961149-132961171 CCGCGCGCTCTCAGTGCGAGGGG - Intergenic
1089144268 11:116313014-116313036 CCTTGAGCTCCCCAGGCGAGGGG + Intergenic
1089202268 11:116731671-116731693 CCCTCCGCTCCCCTGGCCAGGGG - Intergenic
1091563705 12:1632732-1632754 CCGGGCTCTCCCCTGGCCAGAGG + Exonic
1097085936 12:56468515-56468537 CCGCCCGCTCCCCTAGCACGTGG - Intronic
1099448058 12:82775442-82775464 CCGCCCGCCCCCCTGGAGACAGG - Intronic
1099492013 12:83299900-83299922 CCGTTCACTCCCCTGGAGAGGGG + Intergenic
1104676641 12:130715823-130715845 GGGCGCACTCCCCAGGCGAGCGG + Intronic
1108227489 13:48304039-48304061 CTGCTCGCTCACCTGACGAGAGG - Exonic
1117499369 14:56337005-56337027 CTGCACGCTCCCCTGCAGAGTGG + Intergenic
1118247825 14:64128827-64128849 CCCAGGGCTCCCCTGGCAAGAGG - Intronic
1119725249 14:76918359-76918381 CCCCTCCCTCCCCTGGCGGGAGG + Intergenic
1119759578 14:77141247-77141269 TCCCGCGCCCCCCTGGCGACCGG - Intronic
1128756333 15:70186270-70186292 CTGTGAGCTCCCCTGGGGAGTGG + Intergenic
1129189283 15:73927913-73927935 CCGCGCGTACCCCTGGCCACTGG + Intronic
1129240041 15:74245631-74245653 CCGCGCGTTCCCATGGCAACCGG - Intronic
1129273944 15:74433442-74433464 CCGCCCCCTCCCCTGGCGCCCGG + Intronic
1131160429 15:90101868-90101890 CCGCGCGCTCCCCTGGCGAGAGG - Intronic
1132398661 15:101491340-101491362 CCCTGCGTTCCCCTGGCAAGTGG + Intronic
1132644056 16:990745-990767 CCGGACGGTCCCCTGGCCAGAGG - Intergenic
1133997271 16:10758017-10758039 CAGCTCGCTCACCTGGGGAGTGG - Exonic
1137244311 16:46689837-46689859 CCGCGCCCTTCCCAGGCGACGGG + Intronic
1141526960 16:84617951-84617973 CCGAGCGCGCCCCTGGCCGGCGG + Exonic
1143585130 17:7847157-7847179 CCGCGCACCCCCCTGGCCACCGG + Exonic
1147159870 17:38563568-38563590 CCCCGCGCTCTCCTGGAGGGCGG - Intronic
1152426585 17:80221420-80221442 CCGTTCGCCCCCCTGGGGAGGGG + Intronic
1152900353 17:82937591-82937613 TCGCGCTCTGCCCTGGCGGGAGG + Intronic
1153997313 18:10454175-10454197 CCGCCCACTCCCCTGGGGAAAGG - Intergenic
1155928961 18:31685623-31685645 CCGCGGGGTCCCCGGGCGGGCGG - Intronic
1160896841 19:1407145-1407167 CCGCCCGCACCCCAGGCGGGCGG - Intergenic
1161449743 19:4338553-4338575 CCCCGCCCCCCCTTGGCGAGTGG + Intronic
1164630778 19:29760247-29760269 CCGCGCCCTCTGCTGGCCAGTGG - Intergenic
1167072740 19:47230431-47230453 CCCCGCGCTCGCCTGGCGGGCGG - Intronic
926580886 2:14632503-14632525 CCGCGCGCCGCCCCGGGGAGCGG - Intergenic
927964980 2:27262850-27262872 CCGGGGGCTCACCAGGCGAGTGG + Exonic
928420951 2:31137709-31137731 GCGCGCGCTCGCCTGCGGAGCGG - Intronic
931614570 2:64143773-64143795 CCGCGCGCTCCGGCTGCGAGAGG - Intronic
937043067 2:118835933-118835955 CTGCGCGCGTCCCTGGAGAGCGG + Intergenic
1176080978 20:63272910-63272932 CCGCGCGCTTACCTGGAGGGAGG - Exonic
1176342210 21:5709497-5709519 CTGCGGACTCCCTTGGCGAGGGG + Intergenic
1176474464 21:7141649-7141671 CTGCGGACTCCCTTGGCGAGGGG + Intergenic
1176502617 21:7614959-7614981 CTGCGGACTCCCTTGGCGAGGGG - Intergenic
1176536531 21:8107566-8107588 CTGCGGACTCCCTTGGCGAGGGG + Intergenic
1181023933 22:20117140-20117162 CGGCGCGGGCCCCTGGCGGGCGG - Exonic
1184593767 22:45502587-45502609 CCGAGCCCTCCCCTCGAGAGGGG + Intronic
1203241476 22_KI270733v1_random:23977-23999 CTGCGGACTCCCTTGGCGAGGGG + Intergenic
950140441 3:10611484-10611506 CTGCACTCTCCCCTGGCCAGAGG + Intronic
951237736 3:20254677-20254699 CCGTTCACTCCCCTGGAGAGGGG - Intergenic
968656222 4:1779565-1779587 CTGCCACCTCCCCTGGCGAGTGG + Intergenic
968809373 4:2793113-2793135 CCGAGCGCTCTCCTGGCCCGCGG - Intronic
973931067 4:55793688-55793710 CCGCGCCCGCCCGGGGCGAGGGG - Intergenic
976897323 4:90127921-90127943 CGGCGCGGTCACCTGCCGAGCGG - Intronic
982564673 4:156971910-156971932 CGGAGCGCGCGCCTGGCGAGCGG + Intergenic
984972494 4:185203721-185203743 CCGCGGGCGCCCCTGTCGTGGGG + Intronic
988628042 5:32898853-32898875 CCGCTCACTCCCCTGGAAAGAGG - Intergenic
989043193 5:37249550-37249572 CCGCGCGCTCCCCTCCTCAGCGG + Intergenic
993673932 5:90795150-90795172 CCGTTCACTCCCCTGGAGAGGGG + Intronic
994197566 5:96936400-96936422 CCGGCCGCACCCCGGGCGAGCGG - Intronic
994367098 5:98928720-98928742 ACGCGCGATCCCCTGCGGAGTGG + Exonic
994622488 5:102179500-102179522 CCGCTCACTCCCCTGGAAAGGGG - Intergenic
997727472 5:136133284-136133306 CCCCGCGCTGTCCTGGGGAGCGG + Intronic
1011734451 6:90297072-90297094 GCGCGCGCTCCGCTGGCTCGCGG + Intergenic
1012207495 6:96478884-96478906 CCGCCCGCTCCCCTGGAAAGGGG - Intergenic
1012644426 6:101661463-101661485 CCGTTCACTCCCCTGGCAAGGGG - Intronic
1016713883 6:147203092-147203114 CCGCGCTCCTCCCCGGCGAGGGG + Intergenic
1019745967 7:2700552-2700574 CCGCCTTCTCCCCTGCCGAGCGG + Exonic
1028709377 7:93890461-93890483 CCGCGCGCTCCGCTGGCAGGGGG - Intronic
1031966550 7:128031651-128031673 CCGCGCGCTCCTCCGGCCGGCGG - Intronic
1031986490 7:128167449-128167471 GCCGGCGCTGCCCTGGCGAGGGG + Intergenic
1035074296 7:156168462-156168484 CCGCGGGCTCCCCGGGCTGGAGG - Intergenic
1046962238 8:120124277-120124299 CCGCGCGCTCACCTGCTGGGTGG - Intronic
1048009388 8:130443720-130443742 CCGCGCCCTCCGCCGCCGAGCGG - Intergenic
1057054534 9:91950300-91950322 CCGCGCGTTCCCCCGGCAGGGGG - Intergenic
1057631099 9:96719811-96719833 CCGCGCTCTCCCCTGGGGCGCGG - Intergenic
1059405844 9:114098103-114098125 GCGCTCGCTCACCTGGGGAGGGG + Exonic
1059423969 9:114209425-114209447 CTGCGCCCTTCCCTGGCGTGAGG + Intronic
1060700733 9:125747319-125747341 CCGCGCGCTCCCCGCCCGCGCGG - Intergenic
1061108792 9:128552528-128552550 ACGCGCGCTCCCGCGGCGGGCGG - Intergenic
1061370062 9:130193055-130193077 CCGGGCCCACCCCTGGGGAGGGG - Intronic
1061542177 9:131283271-131283293 CCGCGGGCTCCCCTGCCAGGAGG - Intergenic
1062164694 9:135101706-135101728 CTGCAGGCTCCCCTGGAGAGAGG - Intronic
1062592718 9:137281309-137281331 CGGCGGGCGCCCCTGGCAAGTGG + Exonic
1203457797 Un_GL000220v1:7051-7073 CTGCGGACTCCCTTGGCGAGGGG + Intergenic
1195469014 X:105212116-105212138 CCGCTCACTCCCCTGGAAAGGGG + Intronic
1197319080 X:125006019-125006041 CCGCCCACTCCCCTGGAAAGGGG + Intergenic
1198177621 X:134172190-134172212 CCGCGCTCTCCACCTGCGAGGGG - Intergenic
1200740301 Y:6846819-6846841 CCGCTCACTCCCCTGGAAAGGGG - Intergenic
1201789818 Y:17827174-17827196 CCGTTCACTCCCCTGGAGAGAGG + Intergenic
1201811736 Y:18078815-18078837 CCGTTCACTCCCCTGGAGAGAGG - Intergenic
1202351469 Y:23996925-23996947 CCGTTCACTCCCCTGGAGAGAGG + Intergenic
1202519310 Y:25673194-25673216 CCGTTCACTCCCCTGGAGAGAGG - Intergenic