ID: 1131160561

View in Genome Browser
Species Human (GRCh38)
Location 15:90102285-90102307
Sequence GCGGCTGCTCTTGCGAGGTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131160550_1131160561 15 Left 1131160550 15:90102247-90102269 CCTGCCTGGACCCTCCGCGCGGC 0: 1
1: 0
2: 0
3: 16
4: 180
Right 1131160561 15:90102285-90102307 GCGGCTGCTCTTGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 7
4: 92
1131160553_1131160561 4 Left 1131160553 15:90102258-90102280 CCTCCGCGCGGCACTCACAGTGG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1131160561 15:90102285-90102307 GCGGCTGCTCTTGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 7
4: 92
1131160555_1131160561 1 Left 1131160555 15:90102261-90102283 CCGCGCGGCACTCACAGTGGCGC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1131160561 15:90102285-90102307 GCGGCTGCTCTTGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 7
4: 92
1131160551_1131160561 11 Left 1131160551 15:90102251-90102273 CCTGGACCCTCCGCGCGGCACTC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1131160561 15:90102285-90102307 GCGGCTGCTCTTGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 7
4: 92
1131160552_1131160561 5 Left 1131160552 15:90102257-90102279 CCCTCCGCGCGGCACTCACAGTG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1131160561 15:90102285-90102307 GCGGCTGCTCTTGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131160561 Original CRISPR GCGGCTGCTCTTGCGAGGTG GGG Exonic
900190942 1:1351967-1351989 GAGGCTGGTCTGGGGAGGTGTGG - Intergenic
904045707 1:27607092-27607114 GGGGCTGCTCAGGAGAGGTGTGG + Intergenic
904690933 1:32292676-32292698 GCGGTTGCTACTGCGACGTGGGG + Intronic
907626250 1:56033101-56033123 AAGGCTTCTCTTGGGAGGTGAGG - Intergenic
910162632 1:84290600-84290622 GCTTCTGCTCTGGCGATGTGAGG + Intergenic
912184147 1:107254416-107254438 GCGGCTGCTACTGGGAAGTGAGG - Intronic
920311663 1:205052305-205052327 GGGCCTTCTCTTGGGAGGTGAGG - Intronic
921134161 1:212245255-212245277 GCTCCTGCTCTTGCCATGTGAGG + Intergenic
922005048 1:221521887-221521909 ACAGTTTCTCTTGCGAGGTGTGG + Intergenic
1067216944 10:44311063-44311085 GCGGCTGCGGTGGCCAGGTGAGG + Intergenic
1070768912 10:79070991-79071013 GCGGCTGGGCTGGCGGGGTGAGG + Intronic
1070900425 10:80023271-80023293 GAGGCTGCTCTGGCCAGGCGTGG + Intergenic
1073292710 10:102421254-102421276 GGGGCCGCTCTTGGGAGCTGGGG + Intronic
1073522798 10:104150336-104150358 GGGGCTGCTCTTGGGAGTTGTGG - Intronic
1076104683 10:127812103-127812125 GCTGCTGCTCTTGGCAGGTAGGG - Intergenic
1091528001 12:1324890-1324912 GCGACTGCCCATGTGAGGTGGGG - Intronic
1093691878 12:22118318-22118340 GTGGCTGTTGGTGCGAGGTGGGG - Intronic
1094375325 12:29783420-29783442 GCGGCGGCTAGCGCGAGGTGAGG + Intronic
1103459066 12:121089483-121089505 GCAGCTGCCCTGGCCAGGTGGGG + Intergenic
1104323732 12:127775758-127775780 CCAGCTACTCTTGGGAGGTGAGG + Intergenic
1104602641 12:130163464-130163486 GCGGGTGCTCCTGCGCGCTGTGG - Exonic
1105848253 13:24311623-24311645 GCGGCCGCTCTTCAGAAGTGAGG - Intronic
1106447660 13:29850641-29850663 GCGGCGGCTGCTGCGAGGGGGGG - Exonic
1107294889 13:38897921-38897943 GCTCCTGCTCCTGCGAGGGGTGG + Intergenic
1112305254 13:98267698-98267720 GCGGCTGCGCCTGCAGGGTGAGG - Intronic
1113710547 13:112461672-112461694 GCGCCTGCGCCTGAGAGGTGGGG - Intergenic
1118827623 14:69398311-69398333 GCGGCTCCTCTCGCGAGGATTGG - Exonic
1119484386 14:74978401-74978423 GCGCCTGGCCTGGCGAGGTGCGG - Intergenic
1120993711 14:90398722-90398744 ACAGTTTCTCTTGCGAGGTGTGG + Intronic
1122792483 14:104190164-104190186 GGGGCTGCTCTTGCGGGCAGAGG + Intergenic
1122855026 14:104555982-104556004 GCGGCTGCTCTGCAGAGCTGGGG + Intronic
1126823637 15:52528847-52528869 GCGGCCGCCCAGGCGAGGTGCGG - Exonic
1128594357 15:68930496-68930518 GCCGCTGCGCTTGCGCGCTGGGG + Exonic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1131107694 15:89745893-89745915 GTGGATGCTCTTTGGAGGTGTGG - Intergenic
1131160561 15:90102285-90102307 GCGGCTGCTCTTGCGAGGTGGGG + Exonic
1132399554 15:101496975-101496997 GCGGCGGCTCTGGGGAGCTGGGG - Intronic
1132638305 16:964856-964878 GCAGCTGCTTCGGCGAGGTGGGG - Intronic
1133188461 16:4116382-4116404 GCGGCAGCTCTTCCGACATGAGG - Intergenic
1141144579 16:81520045-81520067 GCGGCTGCTCTTGAGTGGCCTGG + Intronic
1152411203 17:80124135-80124157 GCGGCTGGTCCTGCAAGGGGTGG + Intergenic
1155322344 18:24631939-24631961 GGGGCTGCCCATGGGAGGTGGGG - Intergenic
1160552687 18:79705107-79705129 GCGGCTGCTCTGGCCGGGTGCGG + Intronic
1162824960 19:13245525-13245547 GGGGCTGCTCTTCAGAGCTGTGG + Intronic
1162938218 19:13992554-13992576 GCGGCTGCTCTAGGAAGGGGAGG + Intronic
1165861622 19:38912098-38912120 GCGGCTGCTCCTGCTGGGGGCGG - Exonic
1167027007 19:46927547-46927569 GTGGCTGCTCTGGAGAGGTGAGG + Intronic
1168684282 19:58338555-58338577 GAGGCTTCTCTTGGGAGGTGAGG - Exonic
935225129 2:101046497-101046519 GGGCCTTCTCTTGCAAGGTGGGG + Intronic
937950444 2:127383050-127383072 GCTCCTGCTCTTGCCAAGTGAGG - Intronic
938794593 2:134707007-134707029 GAGGCTGCTTCTGAGAGGTGGGG - Intronic
944882052 2:204023290-204023312 GAAGCTGCTCTTTCAAGGTGGGG - Intergenic
945674036 2:212833446-212833468 TCAGCAGCTCTTCCGAGGTGGGG + Intergenic
945995236 2:216430967-216430989 GCGCCTGTTCTGGAGAGGTGAGG + Intronic
948155360 2:235777012-235777034 GCGTCTGCTCTTGAGAGGCCAGG + Intronic
1172774215 20:37397828-37397850 AGGGCTGCTTTGGCGAGGTGTGG + Exonic
1175870197 20:62205756-62205778 GCTGCTGTGCTGGCGAGGTGAGG - Intergenic
1175874674 20:62223736-62223758 GAGGCTGCTCCTGGGTGGTGTGG - Intergenic
1178400225 21:32279061-32279083 GCCGCTGCTCATGCGCGGGGCGG + Exonic
1179504008 21:41828109-41828131 GAGGCAGCTCCTGCGGGGTGGGG - Intronic
1181580219 22:23824100-23824122 GAGGCTGGTCCTGCCAGGTGAGG + Intronic
1183280671 22:36930429-36930451 TCAGCTGCTCCTGGGAGGTGAGG + Exonic
1183403584 22:37618934-37618956 GAGGTTGCTCTTGTGTGGTGGGG - Intronic
1183522013 22:38300944-38300966 GCGGCTGATCTGGGGAGGAGGGG + Exonic
1184773501 22:46611632-46611654 GAGGCTGCCCTTCTGAGGTGTGG + Intronic
1185359885 22:50399683-50399705 GGGGCTGCTCCAGGGAGGTGAGG + Intronic
949915138 3:8955479-8955501 GCGGCTTATCTTGGGAGGGGAGG + Intronic
950072634 3:10164877-10164899 GCGGCTTCTCTAGCCAGGGGCGG - Exonic
951029411 3:17864176-17864198 GCGGCTGCTACTGGGAGATGGGG + Intronic
953137671 3:40197105-40197127 GCGGCAGGTCGTGGGAGGTGAGG + Intronic
954292138 3:49655351-49655373 GCTGCTGCTTTGGCCAGGTGGGG - Exonic
954801119 3:53187420-53187442 GCGGGGGCTCTTGGGAGGGGAGG + Intronic
960874671 3:122284765-122284787 GCTGCTGCTCTTGCTGGGTTAGG - Exonic
961967952 3:130925788-130925810 GCAGCTGCTGTTGCGGGGGGTGG + Intronic
962927516 3:140008527-140008549 GCAGCTGTTCTTGCAATGTGTGG + Intronic
969544829 4:7819048-7819070 GGCGCTGCTCTTGCTGGGTGGGG - Intronic
977060848 4:92255260-92255282 GCGGCTCCCCTTGCCAGGTGTGG + Intergenic
983571583 4:169214247-169214269 GCTTCTGCTCTTGCCATGTGAGG + Intronic
997224541 5:132199030-132199052 GAGGCTGCTCTTGGGAGTTCTGG - Intronic
999189903 5:149739599-149739621 GTGTCAGGTCTTGCGAGGTGCGG + Intronic
999200084 5:149810032-149810054 GAGGCTGGTCTTGAGAGATGCGG + Intronic
1006802921 6:36770791-36770813 GCTGCTGCTGTTGAGAGGTTGGG - Intronic
1006908366 6:37548015-37548037 GAGGCTGCTCTGGCCTGGTGTGG + Intergenic
1007358211 6:41335912-41335934 GCTGCTGCTGTTCCCAGGTGAGG + Exonic
1019689671 7:2403629-2403651 GCGGCTGCGGGCGCGAGGTGAGG + Exonic
1020181333 7:5924751-5924773 GGGGCAGCTCTGCCGAGGTGAGG - Intronic
1020301600 7:6800139-6800161 GGGGCAGCTCTGCCGAGGTGAGG + Intronic
1026850398 7:73719794-73719816 GGGGCTGCTCGTGCGGGGTGGGG - Intergenic
1027374574 7:77537332-77537354 GCGGCTGCTCCTGGAAGTTGTGG + Exonic
1034963174 7:155374686-155374708 GCGGCTGCCCCTGCGGGGTTCGG + Intergenic
1038403860 8:27307423-27307445 GAGGCTGCTCTTGTTTGGTGGGG - Intronic
1039069290 8:33635098-33635120 GAGGCTACACTTACGAGGTGGGG - Intergenic
1039474847 8:37834207-37834229 TCTGCTGCTCTTGCTAGCTGGGG - Intronic
1045189738 8:99871050-99871072 GAGGCTGCTGTTGCCAGGTTTGG + Intronic
1053207382 9:36198286-36198308 GCGGTGGCTCTGGCGGGGTGCGG - Intronic
1057484160 9:95469057-95469079 GTGGCTGCTGTAGGGAGGTGGGG + Exonic
1060417292 9:123440446-123440468 GCAGCTGCTCTTCTGGGGTGGGG + Exonic
1062426358 9:136507949-136507971 GCGGCTACTCCTGCAAGGTGGGG - Exonic
1203791084 EBV:151891-151913 GCCGCTGCTCTTCCTGGGTGAGG - Intergenic
1190094438 X:47467404-47467426 GTGGCAGCTCATGTGAGGTGAGG - Exonic