ID: 1131162907

View in Genome Browser
Species Human (GRCh38)
Location 15:90120009-90120031
Sequence ATTAGGAAATTGAACCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131162907_1131162911 1 Left 1131162907 15:90120009-90120031 CCTCCTGGGTTCAATTTCCTAAT No data
Right 1131162911 15:90120033-90120055 ACTGAAAGGTGTCATTCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131162907 Original CRISPR ATTAGGAAATTGAACCCAGG AGG (reversed) Intergenic
No off target data available for this crispr