ID: 1131163525

View in Genome Browser
Species Human (GRCh38)
Location 15:90125811-90125833
Sequence CGCTGTTCATGTGGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131163519_1131163525 3 Left 1131163519 15:90125785-90125807 CCCAAAAAACTGCAGTGGAACTC No data
Right 1131163525 15:90125811-90125833 CGCTGTTCATGTGGGGCAGATGG No data
1131163520_1131163525 2 Left 1131163520 15:90125786-90125808 CCAAAAAACTGCAGTGGAACTCA No data
Right 1131163525 15:90125811-90125833 CGCTGTTCATGTGGGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131163525 Original CRISPR CGCTGTTCATGTGGGGCAGA TGG Intergenic
No off target data available for this crispr