ID: 1131171095 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:90178796-90178818 |
| Sequence | GACAGCCCAGGTGGTGCTGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 346 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 28, 4: 316} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1131171088_1131171095 | 11 | Left | 1131171088 | 15:90178762-90178784 | CCAGAGAGCAATGTAGAGAGGTG | 0: 1 1: 0 2: 0 3: 16 4: 168 |
||
| Right | 1131171095 | 15:90178796-90178818 | GACAGCCCAGGTGGTGCTGAGGG | 0: 1 1: 0 2: 1 3: 28 4: 316 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1131171095 | Original CRISPR | GACAGCCCAGGTGGTGCTGA GGG | Intronic | ||