ID: 1131171095

View in Genome Browser
Species Human (GRCh38)
Location 15:90178796-90178818
Sequence GACAGCCCAGGTGGTGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 316}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131171088_1131171095 11 Left 1131171088 15:90178762-90178784 CCAGAGAGCAATGTAGAGAGGTG 0: 1
1: 0
2: 0
3: 16
4: 168
Right 1131171095 15:90178796-90178818 GACAGCCCAGGTGGTGCTGAGGG 0: 1
1: 0
2: 1
3: 28
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131171095 Original CRISPR GACAGCCCAGGTGGTGCTGA GGG Intronic