ID: 1131171582

View in Genome Browser
Species Human (GRCh38)
Location 15:90182844-90182866
Sequence CCGTCTCTACTGAAAATACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 28, 2: 77, 3: 119, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131171582 Original CRISPR CCGTCTCTACTGAAAATACA TGG (reversed) Intronic
900852521 1:5155192-5155214 CCTTCTTTATTGGAAATACATGG + Intergenic
901383786 1:8893165-8893187 CCGTCTCTACTAAAAATACACGG + Intergenic
901403248 1:9028878-9028900 CCATCTCTATTGAAAATACATGG - Intergenic
902593543 1:17492238-17492260 CCGTCTCTGCTAAAAATATAAGG + Intergenic
903099726 1:21018397-21018419 CAGTCTCTACTAAAAATACAGGG + Intronic
903951459 1:26998209-26998231 CCGCCTCTACTGAAAAAAAAAGG + Intronic
904766185 1:32849305-32849327 CCGTCTCTACAAAAAGTACCCGG - Intronic
905122066 1:35690012-35690034 CCGTCTCTACAAAAAATACCTGG - Intergenic
906029654 1:42708372-42708394 CCGTCTCTACAAAAATTAAAAGG - Intergenic
906977643 1:50592775-50592797 CTGTCTCTACTCAAAATGCCGGG + Intronic
907037197 1:51226939-51226961 CCATCTCTACTAAAAATACAAGG + Intergenic
907441710 1:54482729-54482751 CTGTCTCTACTAAAAGTACAAGG - Intergenic
907824320 1:58000739-58000761 CCGACCCTACTAAAAATACAAGG - Intronic
907886431 1:58596441-58596463 CCGTCTCTACTAAAAATTAGCGG - Intergenic
909011378 1:70339048-70339070 CCGTCTCTACTAAAAATAGCCGG + Intronic
911292724 1:96077560-96077582 CCATCTCTACTAAAAATACAAGG - Intergenic
911454217 1:98103099-98103121 TCATCTCTACTATAAATACATGG - Intergenic
912739440 1:112180167-112180189 CCATCTTTCCTGAAAATACCTGG + Intergenic
914729939 1:150361352-150361374 CCATCTCTACTAAAAATACAGGG - Intergenic
914796599 1:150925282-150925304 CCATCTCGACTAAAAATACAAGG - Intergenic
915174340 1:154002460-154002482 CCATCTCTACTAAAAATACGAGG + Intronic
915180702 1:154056958-154056980 CTTTCTCACCTGAAAATACATGG - Intronic
917296198 1:173522024-173522046 CCGTCTCTACTAACAATACACGG + Intronic
919910972 1:202110576-202110598 CCGTCTCTGCTAAAACTACAAGG - Intergenic
919941597 1:202290700-202290722 CCATCTCTACTAAAAATACAAGG + Intronic
920351440 1:205340643-205340665 CCGTCTCTACTAAAAATACCAGG - Intronic
920368354 1:205460538-205460560 CCGTCTCTACTCAAAATAAAAGG + Intergenic
920442603 1:205990941-205990963 CCGCCTCTACTAAAAATACGTGG - Intronic
921886117 1:220308142-220308164 CCATCTCTACTAAAAATACAAGG - Intergenic
922266175 1:223986101-223986123 CCGTCTCTACTAAAAATACAAGG + Intergenic
924117032 1:240757971-240757993 CCGTCTCTACTAAAGGTACAAGG - Intergenic
924761938 1:246995657-246995679 CCGTCTCTACTAAAAAGACACGG + Intronic
1062769850 10:90948-90970 CCATCTGTACCAAAAATACAAGG + Intergenic
1064093106 10:12402110-12402132 CTGTCTCTATTAAAAACACAAGG - Intronic
1064429421 10:15257997-15258019 CCTGCTCTCCTGAAAATACGGGG + Intronic
1064480225 10:15733374-15733396 CCATCTCTACACAAAATAGAAGG + Intergenic
1064801094 10:19073083-19073105 CCATCTCTAATAAAAATATAAGG - Intronic
1065711584 10:28523149-28523171 CCATCTCTACTAAAGATGCAAGG - Intergenic
1065791877 10:29268104-29268126 CCGTCTCTAGAAAAAATAAATGG - Intergenic
1066266035 10:33776337-33776359 CTGACTCCACTGAAAATACCCGG + Intergenic
1067113717 10:43418970-43418992 CCATCTTTACTAACAATACAAGG - Intergenic
1069009324 10:63353675-63353697 CCATCTCTACTAAAAATAACTGG - Intronic
1069501653 10:68958273-68958295 CTGTCTCTACAAAAAATAAAAGG - Intronic
1069502598 10:68967337-68967359 CCATCTCTACTAAAAATACGAGG - Intronic
1070072621 10:73104436-73104458 CTATCTCTACTAAAATTACAAGG - Intergenic
1070121220 10:73579119-73579141 CCATCTGTACTAAAAATACATGG - Intronic
1070270650 10:74951457-74951479 CCATCTCTACAAAGAATACAAGG - Intronic
1070722456 10:78765969-78765991 CCTCCTCTTCTGAAAATCCAGGG - Intergenic
1071007215 10:80896541-80896563 CCATCTCCACTGAGAAAACAGGG + Intergenic
1071144044 10:82545947-82545969 CGGTCTCTACTGAAATTAGCCGG - Intronic
1073156105 10:101348053-101348075 CCGTCTCTACTCAAAAAAATTGG - Intergenic
1073374736 10:103023380-103023402 CCATCTCTACTAAAAATAGAGGG + Intronic
1073384156 10:103109017-103109039 CCGTCTCAACTAAAAATACCAGG - Intronic
1074490624 10:113936381-113936403 CGGTTTCTACTAAAAAAACATGG - Intergenic
1074756102 10:116625281-116625303 CCGTCTCTACTAAAATTAGCTGG - Intronic
1075058072 10:119234843-119234865 CTGTCTCTACTAAAAATACAAGG - Intronic
1075404527 10:122185816-122185838 TCCTCTCTAGAGAAAATACAAGG + Intronic
1075857224 10:125640013-125640035 CCTTCTCTGCTGAGAACACATGG - Intronic
1076359525 10:129877318-129877340 CCATCTCTACTAAAAATACTGGG + Intronic
1076742198 10:132491742-132491764 CCGTCTCTACTAAAAACACAAGG - Intergenic
1076759247 10:132592575-132592597 CCATCTCTACTAAAAATAGCTGG - Intronic
1076985696 11:234585-234607 CCGTCTTTACTAAAAATACAAGG - Intronic
1077964495 11:7114186-7114208 CTGTCTCTACTAAAAAGAAAAGG + Intergenic
1078618154 11:12883839-12883861 CCGTCTCTACTAAAAATACATGG + Intronic
1083247574 11:61441358-61441380 CCGTCTCTACTAAAAATACTGGG + Intronic
1083456070 11:62779493-62779515 CCGTCTCTATTAAAAATATAAGG - Intronic
1083600794 11:63946373-63946395 CCGTCTCTACAAAAATTACCCGG - Intronic
1086216874 11:84394045-84394067 CTGTCTCTACTAAAAATAGCTGG - Intronic
1086515965 11:87613658-87613680 CCTTCTCTACTAATAATGCAAGG - Intergenic
1086614331 11:88797310-88797332 CCGTCTCTACTAAAAATTAGCGG - Intronic
1086799192 11:91150506-91150528 CCATCTCTACTAAAAATACAAGG - Intergenic
1087763031 11:102122245-102122267 CGATCTCTACTAAAAATAGAAGG + Intronic
1088094655 11:106084783-106084805 CCGTCTCTACTAAAAATACCAGG - Intronic
1090128557 11:124115911-124115933 CAGTCTCTTCTGTAAATACGTGG + Intronic
1090243433 11:125199671-125199693 CCATCTCTACTAAAAATACAAGG + Intronic
1090327278 11:125900009-125900031 CCGTTTGTACTCAAAATACCGGG - Exonic
1090432389 11:126656879-126656901 CCGTCTCTACTAGGAATACAGGG + Intronic
1090529881 11:127579296-127579318 CCATCTCTACTAAAAATACTGGG + Intergenic
1091258321 11:134211475-134211497 CTGTCTTTACAAAAAATACAGGG + Intronic
1091429131 12:417741-417763 CCGTCTCTACTAAAATTAGCTGG + Intronic
1091951666 12:4597902-4597924 CCATCTCTACTAAAAATAGCCGG + Intronic
1092351512 12:7759814-7759836 CCATCTCTACTAAAAATACTAGG - Intergenic
1093472333 12:19515927-19515949 CTGTCTCTACAAAAAATACATGG + Intronic
1095432571 12:42149763-42149785 CCGTCTCTACTAAAAACAGTCGG + Intergenic
1096373403 12:51087012-51087034 CCATCTCTACTAAAAATAGCTGG + Intergenic
1097038478 12:56139756-56139778 CCGTCTCTACTAAAAATTGGTGG - Intronic
1097044460 12:56177114-56177136 CCATCTCTACTAAAAAGACCAGG - Intronic
1097060454 12:56279464-56279486 CCGTCTCTATTAAAAACACAAGG + Intronic
1097781335 12:63708434-63708456 CTGTCTCTACTAAAAATACCTGG + Intergenic
1098213423 12:68190168-68190190 CCTCATCTACTGAAAAAACATGG - Intergenic
1099186033 12:79516258-79516280 CCGTCTCTACTAAAATTAGCCGG + Intergenic
1099298581 12:80862414-80862436 CTGTTTCTAGAGAAAATACATGG + Intronic
1099478970 12:83142593-83142615 CCGTCTCTACGAAACATACCCGG + Intergenic
1100583714 12:95959955-95959977 CCGTCTCTACTAAAAGTATCGGG - Intronic
1101907974 12:108841971-108841993 CTGTCTCTACCAAAAATACAAGG + Intronic
1102264875 12:111474911-111474933 CCATCTCTATTAAAAATACAAGG + Intronic
1102291793 12:111706946-111706968 CTGTCTCTACTAAAAATTCAGGG - Intronic
1103414252 12:120733269-120733291 CCGTCTCTACTAAAAATACAAGG - Intronic
1103720597 12:122973262-122973284 CCGTTTCTACTAAAAATACAAGG + Intronic
1104938277 12:132379008-132379030 CCGTCTCTACTAAAAATACATGG + Intergenic
1105249893 13:18688975-18688997 CTGTCTCTACTAAAAGTACTGGG + Intergenic
1105366636 13:19771307-19771329 CTGTCTCTACTAAAAATATGAGG - Intronic
1105567543 13:21565355-21565377 CTGTCTCTACTAAAAACACAAGG + Intronic
1107931706 13:45312498-45312520 CTGTCTCTACTGAATATACACGG + Intergenic
1108191492 13:47944950-47944972 CTATCTCTACTAAAAATACAAGG + Intronic
1109628629 13:65013548-65013570 CCATCTGTACTAAAAATACAAGG - Intergenic
1110083822 13:71351938-71351960 ATGTGTATACTGAAAATACATGG + Intergenic
1111147079 13:84196418-84196440 CTGTTTCCACTAAAAATACATGG + Intergenic
1112021825 13:95378546-95378568 CCTTCTCTACACAAAATAAATGG + Intergenic
1112585452 13:100715306-100715328 CAGTCTCTACTGTAGATAGAGGG + Intergenic
1112714406 13:102167128-102167150 CAATCTCTACTAAAAATACAAGG + Intronic
1112768552 13:102772735-102772757 CCGTCTCTACTAAAATTAGCTGG - Intronic
1113080646 13:106516326-106516348 CCCTCTCTACTTAAAATGCAAGG + Intronic
1113629383 13:111871694-111871716 ACATCTGTACTGAAAAAACAAGG - Intergenic
1113663248 13:112121524-112121546 CTGTCTCTACTGAAAATACAAGG - Intergenic
1114146522 14:19983652-19983674 CCCTCTCTACCCCAAATACAGGG - Intergenic
1115091875 14:29586793-29586815 CCATCTCTACTAAAAATACCAGG - Intronic
1115567126 14:34634444-34634466 CTGTCTCTACTAAAAATTAAGGG + Intergenic
1116442416 14:44968418-44968440 CCGTCTCTACTAAAAATACTGGG - Intronic
1117710556 14:58524875-58524897 CCATCTCTACTAAAAATAGCTGG - Intronic
1118273615 14:64365954-64365976 CCGTCTCTACTAAAAATACCTGG - Intergenic
1118784082 14:69031143-69031165 TCATCTCTACAAAAAATACAAGG + Intergenic
1119276617 14:73362602-73362624 CCGTCTCTACAAAAAATAGCTGG - Intronic
1119803795 14:77468876-77468898 CCATCTCTACTAAAATTACGTGG - Intronic
1120111195 14:80559278-80559300 CCGTTTCTAATGCAATTACACGG + Exonic
1120129366 14:80786935-80786957 CCGTCTCTACTGTGAAAAGACGG + Intronic
1120787383 14:88550082-88550104 CTGTCTCTACTAAAAATACAAGG - Intronic
1120983003 14:90307701-90307723 CCATCTCTACTAAAAATACAGGG + Intronic
1121062467 14:90926233-90926255 CTGTCTCTACTAAAAATGCATGG + Intronic
1122700710 14:103586737-103586759 CCGTCTCTACTAAAAATACTGGG - Intronic
1123436631 15:20259323-20259345 CCCTCTCTACCAAAAATACATGG + Intergenic
1127629985 15:60819411-60819433 ACATCTCTCCTGAAAATACTAGG + Intronic
1128076984 15:64833312-64833334 CGGTCTCTGCTAAAAATACAAGG - Intergenic
1128204533 15:65839006-65839028 CCATCTCTACTAAAAATACAAGG - Intronic
1128999910 15:72323389-72323411 GCTTCTCTACTAAAAATACAAGG - Intronic
1129021183 15:72520202-72520224 GCTTCTCTACAGAAACTACAAGG - Intronic
1129551407 15:76453915-76453937 CTGTGTCTATTTAAAATACAGGG + Intronic
1130204770 15:81865734-81865756 CCATCTCTACTAAAAATAGCAGG + Intergenic
1130290213 15:82592415-82592437 CCATCTCTACCAAAAATACAGGG + Intronic
1130306029 15:82712629-82712651 CCATCTCTACTGGAAACAGAAGG + Intergenic
1130336789 15:82963392-82963414 CCATCTCTTCTGAAATGACATGG + Intronic
1131171582 15:90182844-90182866 CCGTCTCTACTGAAAATACATGG - Intronic
1132127919 15:99245978-99246000 CCGTCTCTACTAAAATTAGCTGG - Intronic
1132155129 15:99490622-99490644 CTGTCTCTACTGAAAATACAAGG - Intergenic
1132387252 15:101409283-101409305 CTGTCTCTATTAAAAATACAAGG + Intronic
1133208367 16:4247938-4247960 CCATCTCTACTAAAAATACCAGG + Intergenic
1133241792 16:4418492-4418514 CCGTCTCTACTAAAAATACAAGG + Intronic
1133500837 16:6365181-6365203 CCCTCTCTTCTTAAAATAGATGG + Intronic
1134088880 16:11379091-11379113 CTGTCTCTACTGAAAATAGCTGG + Intronic
1134091336 16:11393162-11393184 CCGTCTCTACTTAAAAAAAAGGG - Intronic
1136427238 16:30177067-30177089 CCGTCTCTACTAAAAAAATATGG + Intergenic
1136847938 16:33591532-33591554 CCCTCTCTATCAAAAATACATGG - Intergenic
1136989944 16:35145961-35145983 CCGTCTCTACTAAAATTAGCCGG - Intergenic
1137672317 16:50286220-50286242 CCATCTCTACAAAAAATACATGG + Intronic
1138567026 16:57841087-57841109 CCGTCTCTGCTGATAACGCAAGG - Intronic
1139234719 16:65325583-65325605 CCGTCTCTACTAAAAATACCAGG - Intergenic
1139555924 16:67710288-67710310 CGGTTTCTACTAAAAATACAGGG - Intronic
1139704083 16:68728464-68728486 CCATCTCTATTGAAAATACAAGG - Intergenic
1139742246 16:69045280-69045302 CCGTCTCTACTAAAATTAGCCGG + Intronic
1140260151 16:73371149-73371171 CTGTCTCTACTAAAAATATGTGG + Intergenic
1140413134 16:74753506-74753528 CCGTCTCTACTAAAAATAGCTGG + Intronic
1141118890 16:81335444-81335466 CTGTGTCTACTAAAAATACATGG + Intronic
1203109646 16_KI270728v1_random:1440181-1440203 CCCTCTCTATCAAAAATACATGG - Intergenic
1142724725 17:1804345-1804367 CTGTCTCTACTAAAAATACAGGG - Intronic
1143169803 17:4922075-4922097 CTGTCTCTACTAAAAATTCAGGG + Intergenic
1143945318 17:10586579-10586601 CCGTTTCTACAAACAATACAAGG - Intergenic
1144292149 17:13837221-13837243 CCGTCTCTACTAAAAATACAAGG - Intergenic
1144522436 17:15962686-15962708 CCGTCTCTACTAAAAATGCGTGG - Intronic
1144867432 17:18345545-18345567 CCGTCTCTACTAAAAATACATGG - Intronic
1145931992 17:28692460-28692482 CCATCTCTACTAAAAATATAAGG + Intronic
1146047879 17:29525564-29525586 CCTTCTCTACTAAAAACACGAGG - Intronic
1146050926 17:29552891-29552913 CCATCTCTACTAAAAATACATGG + Intergenic
1146070183 17:29673397-29673419 CCATCTCTACTAAAAATACAAGG + Intronic
1146228310 17:31087002-31087024 GCAACTCTACTAAAAATACACGG + Intergenic
1146593631 17:34150940-34150962 CCATCTCTACTAAAAATACCAGG + Intronic
1147181975 17:38692260-38692282 CCATCTCTACTAAAAATACGAGG - Intergenic
1147192294 17:38745040-38745062 CCATCTCTACTAAAAATACATGG + Intronic
1147231650 17:39023742-39023764 CCATCTCTACTAAAAATAGCCGG - Intergenic
1147273054 17:39290731-39290753 CCATCTCTACAAAAAATAAAAGG - Intronic
1147292099 17:39451718-39451740 CCGTCTCTACTAAAAATAGCTGG - Intergenic
1147780554 17:42938172-42938194 CCGTCTCTATAAAAAATAAATGG + Intergenic
1147932637 17:43992408-43992430 CCGTCTCTACTAAAAATACAAGG + Intronic
1148248374 17:46051777-46051799 ATGTCTCTGCTGAAAATAAATGG - Intronic
1148380809 17:47195527-47195549 CAGTCTCTACTAAAAATACTTGG - Intergenic
1148704821 17:49620305-49620327 CTGTCTCTACTAAAAATACCAGG + Intronic
1148774131 17:50085040-50085062 CCGGCTCTACTAAAAATGCTGGG + Intronic
1150269682 17:63855596-63855618 CCGTCTCTACTAAAATTAGCCGG + Intergenic
1150353352 17:64462794-64462816 CTGTCTTTACTAAAAATACATGG - Intronic
1150372362 17:64651039-64651061 CTGTCTCTACTAAAAATACATGG + Intronic
1150736228 17:67741731-67741753 CTGTCTCTACTAAAAGCACAGGG - Intronic
1151538790 17:74753716-74753738 TCGTCTCTACCAAAAAAACAGGG + Intronic
1152881524 17:82818894-82818916 CCGTCTCTGCTAAAAATACAAGG + Intronic
1153552435 18:6275515-6275537 TCGTTTCCACTGAAAAAACAGGG + Intronic
1154368107 18:13729958-13729980 CCGTCTCTACAAAAAATAGCTGG - Intronic
1154438936 18:14369921-14369943 CTGTCTCTACTAAAAGTACTGGG - Intergenic
1156860831 18:41834625-41834647 CTGTCTCTATTAAAGATACAAGG - Intergenic
1156990924 18:43406564-43406586 CCATCTTTACTAAAAATACTGGG - Intergenic
1157230907 18:45915106-45915128 CTGACTCTACTAAAAATACAAGG + Intronic
1157742689 18:50107285-50107307 CTGTCTCCACTAAAAATACCAGG - Intronic
1158584994 18:58724972-58724994 CCATCTCTACTAAAAATGTATGG + Intronic
1158970101 18:62658467-62658489 CTGTCTCTACTAAAAATAATTGG - Intergenic
1159577093 18:70192508-70192530 CCATCTCTACAAAAAATAAAAGG + Intronic
1160760265 19:780602-780624 CCATCTCTATTAAAAATAAAAGG - Intergenic
1161413123 19:4128189-4128211 CTGTCTCTACTAAAAATACAAGG + Intergenic
1161426521 19:4206621-4206643 CCGTCTCTACAAAAAGTATAGGG + Intronic
1161828351 19:6584857-6584879 TCACCTCTACTGAAAATACAGGG - Intronic
1162656926 19:12138280-12138302 CCATCTCTACTTAAAATACATGG + Intronic
1163108986 19:15146372-15146394 CCATCTCTACTAAAAATAGCCGG + Intergenic
1163626566 19:18393450-18393472 CCGTCTCTACTAAAATTAGCCGG + Intronic
1165193843 19:34085863-34085885 CTGTCTCTACAAAAAATACAAGG - Intergenic
1165886353 19:39081828-39081850 CCGTCTCTACTAAAAATACAAGG + Intergenic
1166968058 19:46542893-46542915 CCGTATCTACTTAAACTAAAAGG + Intronic
1167051184 19:47079723-47079745 CCGTCTCTACTGAAAATAGCTGG + Intronic
1167239478 19:48334751-48334773 CCGTCTCTACAAAAAATATCGGG - Intronic
1167399274 19:49254193-49254215 CCGTCTCTACTAAAATTAGTTGG + Intergenic
1167839758 19:52105916-52105938 CCGTCTCTACAAAAATTACCTGG - Intergenic
1167893084 19:52558244-52558266 CCGCCTCTACTAAAAATACAAGG - Intronic
926536049 2:14114287-14114309 CCGTCACTATCGAAAATATATGG - Intergenic
926604492 2:14883797-14883819 CCATCTCTACAAAAAATACCTGG + Intergenic
927127760 2:20028496-20028518 CTGTCTCTACTAAAAATACAAGG - Intergenic
927852274 2:26506827-26506849 CCGTCTCTACTAAAATTAGCTGG + Intronic
928695091 2:33841179-33841201 CCGTCTCTACTAAAATTAGCTGG + Intergenic
930731244 2:54729963-54729985 CCATCTCTACAGAAAATACAAGG + Intronic
933290032 2:80427645-80427667 CTGTATCTACTGGAAATTCAGGG + Intronic
933294231 2:80471481-80471503 CAGTCTCTACTAAAAATATCTGG + Intronic
934073512 2:88407668-88407690 CTGTCTCTACTAAAAATAGTCGG + Intergenic
937881693 2:126871882-126871904 CCGTCTCTACTAAAAATAGACGG + Intergenic
937931285 2:127207192-127207214 CTGTCTCTAAAAAAAATACATGG + Intronic
939823122 2:146981303-146981325 CCGTCTCTACTAAAAATACAAGG + Intergenic
941569942 2:167157958-167157980 TCTTCTCCACTGAAAATAAAAGG + Intronic
943280293 2:185923737-185923759 TCATCTCTACAAAAAATACATGG + Intergenic
944775448 2:202959646-202959668 CTGTCTCTACTAAAAATACCAGG + Intronic
944803968 2:203262848-203262870 CCATCTCTACTAAAAATAGCAGG - Intronic
945091415 2:206179499-206179521 CTGTCTCTACTAAAAATACCTGG - Intronic
945097783 2:206235959-206235981 CTGTCTCTACTAATAATACTTGG - Intergenic
947193693 2:227539583-227539605 CCGTTTCTACAAAAAATAAATGG + Intronic
1168952637 20:1812826-1812848 CCATCTCTACTAAAAATACAAGG + Intergenic
1169429945 20:5527689-5527711 CCAACTCTACAGAAAATAGAAGG + Intergenic
1169728471 20:8761762-8761784 CCGTCTCTACTAAAAATAGCGGG - Intronic
1169842212 20:9951892-9951914 CCATCTCTACTAAAAATACAAGG + Intergenic
1170450331 20:16476917-16476939 CCATCTCTACTAAAAATACATGG - Intronic
1170634848 20:18095281-18095303 CTGTCTGTACTAAAAATACAAGG + Intergenic
1171458401 20:25284594-25284616 CTGTCTCTACAAAAAATACAAGG - Intronic
1171791767 20:29533068-29533090 CAGTCTCTAAAGAAAATAAAGGG - Intergenic
1171856575 20:30349815-30349837 CAGTCTCTAAACAAAATACAGGG + Intergenic
1172344505 20:34186982-34187004 CCGTCTCTAGTAAAAATACTAGG - Intergenic
1173238408 20:41270216-41270238 CCGTCTCTACTAAAAATGGCCGG + Intronic
1173995275 20:47333428-47333450 CCGTCTCTACTAAAAATACATGG + Intronic
1174013892 20:47472465-47472487 CCGTCTCTACTGAAATTAGCCGG + Intergenic
1174063632 20:47849425-47849447 CCATCTCTACCAAAAATACATGG - Intergenic
1174344655 20:49921329-49921351 CTGTCTCCACAAAAAATACAAGG - Intergenic
1174427731 20:50444695-50444717 CCGTCTCTACTAAAAATACACGG + Intergenic
1175947895 20:62567149-62567171 CCGTCTCTCCTGTAAATTAAAGG + Intronic
1176456748 21:6919507-6919529 CTGTCTCTACTAAAAGTACTGGG + Intergenic
1176834921 21:13784567-13784589 CTGTCTCTACTAAAAGTACTGGG + Intergenic
1177015890 21:15786524-15786546 CTGTATCTACTGAAATTATATGG - Intronic
1177546323 21:22562919-22562941 CCGTCTCTACTAAAAATACAAGG - Intergenic
1177996627 21:28107773-28107795 CTGTCTCTAGTGAAAGTACCAGG - Intergenic
1178219249 21:30637549-30637571 CCGTTTCTACCGAAAATACAAGG - Intergenic
1178440403 21:32593770-32593792 CCCTCTCCACGGAAGATACAGGG + Intronic
1178542637 21:33467322-33467344 TCATCTCTTCTAAAAATACAAGG + Intronic
1179415434 21:41194571-41194593 CTGACTTTAATGAAAATACAAGG + Intronic
1180781826 22:18524729-18524751 CTATCTCTACTGAAAATACAAGG + Intergenic
1181238712 22:21464072-21464094 CTATCTCTACTGAAAATACAAGG + Intergenic
1181940685 22:26473580-26473602 CCGTCTCTACTAAAAATACTGGG + Intronic
1182238599 22:28896432-28896454 CTGTCTCTACTAAAAATATAGGG - Intronic
1183209112 22:36439503-36439525 CCGTCTCTACTAAAAATACTGGG + Intergenic
1183969382 22:41465331-41465353 CCGTCTCTACTAAAAATACGTGG - Intronic
1184958404 22:47908988-47909010 CCATCTCTACTAAAAATACAAGG - Intergenic
1185158636 22:49209202-49209224 CTGTGTCTACTGGAAAGACACGG - Intergenic
1185390025 22:50554820-50554842 CTGTCTCTATTAAAAATACAAGG + Intronic
950075283 3:10182579-10182601 CCATCTCTACTAAAAATACAAGG - Intronic
951118926 3:18900168-18900190 CCATCTCTACTAAAAATACAAGG + Intergenic
952927584 3:38332626-38332648 CTGTCTCTAGTAAAAGTACAAGG + Intergenic
953559700 3:43977389-43977411 CCGTCTCTACTAAAAATGCCGGG - Intergenic
954174749 3:48835329-48835351 CTATCTCTACTGAAAAAAAATGG + Intronic
954362411 3:50129034-50129056 CCGTCTCTACTAAAATTAGCTGG - Intergenic
954666053 3:52253039-52253061 CCATCTCTACTAAAAATATTGGG - Intergenic
955040780 3:55315901-55315923 CTGACTCTACTAAAAATATAAGG - Intergenic
955324190 3:57997083-57997105 CCATCTCTACAAAAAGTACAGGG - Intergenic
955451903 3:59077499-59077521 CCGTCTCTTCTAAAAATACATGG + Intergenic
956365644 3:68499348-68499370 CCCTCTCTACTAAGAATTCAAGG - Intronic
956717139 3:72088447-72088469 CTGCCTCTACTAAAGATACAAGG + Intergenic
956768980 3:72508390-72508412 CCGTCTCTACTAAAAATAGCCGG + Intergenic
956841199 3:73141945-73141967 CCGTCTCTACTAAAAATAGCCGG - Intergenic
957806052 3:85150728-85150750 CCGTCTCTACTAAAAAAAAAAGG + Intronic
959394723 3:105823177-105823199 CTGCTTCTACTGAAAATAGATGG + Intronic
960589696 3:119353630-119353652 CTGTCTCTACTAAAAATACATGG + Intronic
960714583 3:120562641-120562663 CCATCTCTATTGAAAAAAAAAGG + Intergenic
961250707 3:125502696-125502718 CCATCTCTACTAAAACTACATGG + Intronic
961753323 3:129110664-129110686 CCGTCTCTATTAAAAATGCCAGG + Intronic
961769969 3:129241844-129241866 CCGTCTCTACTAAAATTAGCTGG + Intergenic
962213242 3:133497024-133497046 CCGTCTCTATTTAAAATTTAAGG - Intergenic
962521699 3:136203043-136203065 CTGTCTCTACTAAAAATTCGTGG - Intergenic
962559276 3:136589059-136589081 CCATGTCTATTAAAAATACAAGG - Intronic
963704596 3:148670242-148670264 CCATCTCTACTAAAAACACAGGG - Intergenic
964136826 3:153353680-153353702 CTGTCTATACTAAAAATACAGGG + Intergenic
964399860 3:156287654-156287676 CTATCTCTACTAAAAATACAAGG + Intronic
964758517 3:160111073-160111095 CTGTCTCTACTAAAAATACCTGG - Intergenic
966243321 3:177778725-177778747 CATTCTCTACTGAAAGAACAAGG + Intergenic
966762817 3:183432216-183432238 CCGCCTCTCCTAAAAATACCCGG + Intergenic
966788440 3:183641320-183641342 CCGTCTCTACTAAAAATACATGG + Intronic
966791272 3:183672692-183672714 CCGTCTCTACTAAAAAATTATGG + Intronic
966801679 3:183769855-183769877 TCATCTCTACTAAAATTACAAGG - Intronic
967059076 3:185855432-185855454 TCATCTCTACAAAAAATACAAGG + Intergenic
967548126 3:190756901-190756923 CTGCCTCTACAAAAAATACAAGG - Intergenic
968388962 4:172881-172903 CCGTCTCTACTAAAATTAGATGG + Intergenic
968814762 4:2816208-2816230 CCATTTCTACTAAAAATACCAGG - Intronic
969047199 4:4345004-4345026 CCGTCTCTACTAAAATTAGCTGG - Intergenic
969122739 4:4921862-4921884 CCGTCTCTACTAAAAATACATGG - Intergenic
970557837 4:17253575-17253597 CCATCTCTACTAAAAATACAAGG + Intergenic
970613626 4:17747619-17747641 CCGCCTCTATTAAAAATTCAAGG + Intronic
971291913 4:25350437-25350459 CTGTCTCTACTAAAAATACAGGG - Intronic
971292105 4:25352584-25352606 CTGTCTCTACTAAAAATACAGGG - Intronic
971690291 4:29825382-29825404 CTGTCTCTACTAAAAATATAAGG - Intergenic
971808427 4:31391507-31391529 CTGTGTATACTGAAAATGCAAGG - Intergenic
973093221 4:46164389-46164411 CCGTCTCTACTAAAAATACAAGG - Intergenic
974043278 4:56876313-56876335 CCATCTCTACTAAATATACAAGG + Intergenic
974672441 4:65049554-65049576 CCATCTCTGCTGAAAAAACCAGG + Intergenic
975330103 4:73103017-73103039 CTATCTCTAGTGAAAAAACAAGG + Intronic
976729845 4:88250731-88250753 CAGTCTTTACTAAAAATACAAGG - Intergenic
977757612 4:100691505-100691527 CCGTCTCTACTAAAATTAGCCGG + Intronic
979008771 4:115339743-115339765 CTGTCCCTACTGAAAATAGGAGG - Intergenic
980877856 4:138679973-138679995 CCGTCTCTACTAAAATTAGTGGG + Intergenic
980939009 4:139254964-139254986 CCGTCTCTACTAAAAATACAAGG - Intergenic
982015349 4:151147921-151147943 CCCTCTCTACAGTAAATACATGG - Exonic
982654853 4:158135158-158135180 CCATCTCTACTAAAGATACCGGG + Intronic
983238371 4:165205779-165205801 CCGTCTCTTCTAAAAATAGCCGG - Intronic
983604167 4:169566931-169566953 CCGTCTCTACAAAAAATAGCTGG + Intronic
983617073 4:169719292-169719314 CTGTCTCTACTGAAAATAATTGG + Intronic
985250928 4:188023578-188023600 CCATCTCTACTAAAACTACGTGG + Intergenic
985616392 5:924684-924706 CTGTCTCTACTAAAAATAAAAGG - Intergenic
985998559 5:3612022-3612044 CTGTCTCTACTAAAAATACATGG - Intergenic
987825012 5:23020209-23020231 CTGTCTCTACTAAAAGAACAGGG - Intergenic
987941788 5:24548288-24548310 CCATCTCTACTAAAAATACATGG - Intronic
989279774 5:39627507-39627529 CGGTGTCAAGTGAAAATACATGG + Intergenic
989578348 5:43009590-43009612 CCGTCTCTACAAAAAATTCTGGG + Intergenic
990260788 5:54020317-54020339 CAGTCTCTACTGACACTGCAGGG - Intronic
993528695 5:88999336-88999358 CCGTCTCTACAGAAATTAGCTGG - Intergenic
994164247 5:96592226-96592248 CTGTCTCTGCTAGAAATACAGGG + Intronic
994289804 5:98015205-98015227 CCCTCACTACTCAAAATACTTGG - Intergenic
995463010 5:112421908-112421930 TTGTCTCTACTAAAAATACAGGG - Intergenic
996719657 5:126617782-126617804 CCGTCTCTACAAAGAATAAAAGG - Intronic
996981699 5:129503666-129503688 CCATCTCTACTAAAAATATGTGG + Intronic
997220949 5:132163459-132163481 CAGGCTCTGCTGTAAATACATGG - Intergenic
997327823 5:133036610-133036632 CTGTCTCTATTAAAAATACAGGG + Intergenic
997966171 5:138358151-138358173 CCATCTCTACTAAAATTACATGG - Intronic
998117226 5:139547384-139547406 GCGTCTCTACTAAAAATACATGG - Intronic
998305214 5:141069387-141069409 CTGTCTCTACTAAAAATAGCCGG - Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999536731 5:152525641-152525663 CCTTCTCTACTAAAATCACAGGG + Intergenic
1001261077 5:170229312-170229334 TCGTATCTACTGAATCTACAAGG + Intergenic
1002260084 5:177987170-177987192 CCGTGTCTACTAAAGATACTGGG - Intergenic
1002593853 5:180309580-180309602 CCATCTCTACTAAAAATAGCTGG - Intronic
1003088203 6:3078321-3078343 CCCTCTCTACAAAAAATAAAAGG + Intronic
1003412653 6:5879268-5879290 CCGTCTCTGCAAAAAATAGATGG - Intergenic
1004366278 6:15015650-15015672 CCATTTCTACTAAAAATACATGG - Intergenic
1004414043 6:15408091-15408113 CCATCTCTACAAAAAATACAAGG + Intronic
1004676629 6:17849071-17849093 CCATCTCTACTAAAAAGGCACGG - Intronic
1005485470 6:26295188-26295210 CCATCTCTACTAAAAATGCAAGG - Intergenic
1005750187 6:28875015-28875037 CCATCTCTACTAAAAATACCTGG + Intergenic
1005761782 6:28974137-28974159 CCATCTCTACTAAAAATACATGG - Intergenic
1005953751 6:30649389-30649411 CCATCTCTACTGAAAACAGGAGG - Intronic
1006009532 6:31030923-31030945 CTGTCTCTGTTGCAAATACACGG - Intronic
1006476124 6:34255334-34255356 CCGTCTTTACTAAAAATAGCCGG + Intergenic
1006483077 6:34314250-34314272 CCATCTCTACTGAAAATATAAGG + Intronic
1006725902 6:36198654-36198676 CCGTCTCTACTTTATATAGATGG + Intronic
1006922708 6:37637070-37637092 CCTTCTTTACTGCAAAGACAGGG - Exonic
1007190716 6:40015451-40015473 CCATCTCTACTAAAAATATTTGG - Intergenic
1007576999 6:42931529-42931551 CCGTCTCTACTAAAAATAGCCGG - Intronic
1007911927 6:45524348-45524370 CAGTCTCTCTGGAAAATACATGG - Intronic
1008637127 6:53421920-53421942 CCATCTCTACTAAAAATAGTAGG - Intergenic
1008672510 6:53785826-53785848 CCATCTCTACTAAAAATACATGG - Intergenic
1009242156 6:61196561-61196583 CCATCTCTACTAAAAATACAAGG - Intergenic
1010216900 6:73411012-73411034 CCGTCTCTACTAAATTTACCCGG + Intronic
1012863883 6:104595062-104595084 TCATCTCTACAAAAAATACAGGG + Intergenic
1015226116 6:130859348-130859370 CAGTCTCTACTAAAAACACCAGG + Intronic
1018018432 6:159733741-159733763 CCGTCTCTACTAAAAATACAAGG + Intronic
1019270553 7:144713-144735 CCGTCTCTCCTGAATATGAAGGG - Intergenic
1019464717 7:1181375-1181397 CTGTCTCCACTGAAAAGAAAGGG - Intergenic
1019926034 7:4192445-4192467 CTGTCTCTACTAAAAATACAAGG - Intronic
1020072416 7:5235881-5235903 CCGTCTCTACTAAAAATACATGG + Intergenic
1020182309 7:5931826-5931848 CCCCATCTACTAAAAATACAAGG + Intronic
1020300601 7:6792931-6792953 CCCCATCTACTAAAAATACAAGG - Intronic
1020930486 7:14387249-14387271 CCGTCTCTACTAAAATTAGCTGG + Intronic
1021897295 7:25249451-25249473 CTGTCTCTACTAAAAATGCATGG - Intergenic
1022361897 7:29668692-29668714 AAGTCTCTAGTGAAAATACCTGG + Intergenic
1022459032 7:30586677-30586699 CCGTCTCTACTAAAAATACATGG + Intergenic
1022699496 7:32745043-32745065 AAGTCTCTAGTGAAAATACCTGG - Intergenic
1022988666 7:35685806-35685828 TCATCTCTACTAAAAATACGTGG + Intronic
1023427064 7:40049031-40049053 CCATCTCTACTAAAAATAGCTGG + Intronic
1024245037 7:47463081-47463103 CCGTCTCTAGGAGAAATACAGGG + Intronic
1025608565 7:63057111-63057133 CCATCTCTACTAAAAAGAAAAGG - Intergenic
1025610014 7:63069912-63069934 CCGTCTCTACTAAAAATAGCTGG - Intergenic
1026120735 7:67534783-67534805 CCGTCTCTACTAAAATTAGCTGG - Intergenic
1027170840 7:75871177-75871199 CCGTCTCTACTAAAAATACATGG + Intronic
1029118163 7:98248669-98248691 CCATCTTTACTGAAAAAAAAAGG + Intronic
1030150060 7:106395355-106395377 CCATCTCTACTTAAAAAAAATGG + Intergenic
1031392694 7:121235153-121235175 CAGTCTCCACTAAAAATAAATGG + Intronic
1032241961 7:130169064-130169086 CCGTCTCTACCAAAAATACCCGG + Intronic
1033180805 7:139175987-139176009 CTGTCTCTACTAAAAATACCGGG - Intronic
1033364032 7:140657834-140657856 CTGTCTCTACTAAAAATACTCGG + Intronic
1034519122 7:151605185-151605207 CCGTCTCTACTAAAAATACAAGG - Intronic
1036110014 8:5888011-5888033 CTGTCTCTACTAAAAATACCCGG - Intergenic
1036450169 8:8859180-8859202 CCGTCTCTACAAAAATTACATGG + Intronic
1037489014 8:19378872-19378894 CCATCTCTACAAAAAAAACATGG + Intronic
1037550911 8:19970462-19970484 CCTTATTTACTGAGAATACAGGG + Intergenic
1037681820 8:21103995-21104017 CCTTCTCTACTAAAAATGCCAGG + Intergenic
1038660339 8:29491669-29491691 CCGTCTCTACAGAAATTAGCTGG - Intergenic
1038796412 8:30714369-30714391 CTGTCTCTACTAAAAATACCAGG - Intronic
1039607354 8:38892516-38892538 CTGTCTCTACTAAAAATACATGG - Intergenic
1039722928 8:40184382-40184404 CCATCACTAATGAAAATAAAAGG - Intergenic
1041046882 8:53895815-53895837 CTATTTCTACTAAAAATACAAGG - Intronic
1041091633 8:54306882-54306904 CCGTCTCTACCAAAAATAGCTGG + Intergenic
1042392227 8:68249112-68249134 CTGTCTCTACTAAAAATACTGGG - Intergenic
1043259201 8:78176447-78176469 CAGTCTCTACTGCAAACACCAGG - Intergenic
1043278508 8:78432827-78432849 GTGTCTCTACTAAAAATACCGGG + Intergenic
1043855059 8:85255489-85255511 CTGTCTCTACTAAAAATGCCAGG - Intronic
1043938223 8:86167624-86167646 TCGTCTCTACTAAAAATATGTGG + Intergenic
1044179560 8:89173007-89173029 CTGTCTCTAATGAAAACAAAGGG - Intergenic
1044602769 8:94022202-94022224 CCGTCTCTACTAAAAATACAAGG + Intergenic
1044617028 8:94152835-94152857 CCTTCTCTACTAAAAATAAAAGG - Intronic
1045365909 8:101475990-101476012 CCATCTCTACTAAAAATACTGGG + Intergenic
1045990337 8:108298989-108299011 CCGTCTCTACAAAAAAAATATGG - Intronic
1046530797 8:115442789-115442811 CTGTCTCTACTAAAAAAAAAAGG + Intronic
1046551398 8:115722621-115722643 CTGTCTCTTCTAAAAATACAAGG - Intronic
1046573773 8:115999708-115999730 CCCTCTCTGCTGAAAATCCTAGG - Intergenic
1047246403 8:123148883-123148905 TCGTCTCTACTAAAAATAGCCGG + Intronic
1047485109 8:125322886-125322908 CCATCTCTACTAAAAATACAAGG + Intronic
1047681744 8:127260633-127260655 TTGTCTCTACTGAAAATACTGGG + Intergenic
1047917754 8:129600980-129601002 CAATTTCTACTAAAAATACAAGG - Intergenic
1048147828 8:131862738-131862760 CCGTCTCTACTAAAAATACTGGG + Intergenic
1050359763 9:4818708-4818730 CTGTCTCTACTAAAAATAGCTGG + Intronic
1053248564 9:36555524-36555546 CTGTCTCTACTAAAAATAGCTGG - Intergenic
1053484389 9:38441132-38441154 CCATCTCTACAAAAAATAAAAGG - Intergenic
1054735788 9:68748780-68748802 CCGTCTCTACTAAAAATAGCAGG - Intronic
1055105869 9:72512234-72512256 CCATCTCTACTAAAAATACCAGG + Intergenic
1055293369 9:74808033-74808055 CAACCTCTACAGAAAATACAAGG - Exonic
1055469617 9:76598284-76598306 CCATCTCTACTAAAAGGACAAGG + Intergenic
1055528519 9:77159555-77159577 CCGTCTCTACAGAAATTAGCTGG + Intergenic
1055719004 9:79150567-79150589 CCGTCTCTACAGAAATTAGCTGG - Intergenic
1056164674 9:83929612-83929634 CCATCTCTACTAAAAATACTGGG - Intergenic
1056292013 9:85153175-85153197 CCATCTCTACTAAAAATAAAAGG - Intergenic
1057093726 9:92284612-92284634 CTGTCTCTACTAAAAATGCGTGG + Intronic
1059100297 9:111465011-111465033 CCGTCTCTACTAAAAATACAAGG + Intronic
1059209402 9:112498623-112498645 CCATCTCAACTAAAAATAAAAGG - Intronic
1060395028 9:123310179-123310201 CCATCTCTACTAAAAATACAAGG - Intergenic
1060604699 9:124903315-124903337 CTATCTCTGCTAAAAATACAAGG + Intronic
1061316630 9:129800352-129800374 CCGTCTCTACTAAAAACAGATGG + Intergenic
1061928172 9:133817480-133817502 CCATCTCTACTAAAAATACTCGG + Intronic
1062125748 9:134861160-134861182 CCATCTCTACTAAAAATACATGG + Intergenic
1062530845 9:136999200-136999222 CTGTCTCTACTACAAATACAAGG - Intergenic
1185578564 X:1192982-1193004 CCATCTCTACTAAAAATACAAGG - Intronic
1185647113 X:1623731-1623753 CTGTCTCTATTAAAAATACGTGG - Intronic
1185647127 X:1623817-1623839 CTGTCTCTACTAAAAATAAGTGG - Intronic
1185681535 X:1892433-1892455 CCGTCTCTACTGAAAAACACGGG + Intergenic
1186804438 X:13126064-13126086 CTGTCTCTACTAAAAATACATGG - Intergenic
1187046185 X:15649417-15649439 CTGTCTCTATTGAAAATGTAAGG - Intronic
1187240977 X:17512900-17512922 CAGTCTCTACTGAACTTACTTGG - Intronic
1189400249 X:40661380-40661402 CTATCTCTACTGAAAATACAAGG - Intronic
1189427638 X:40915670-40915692 CCATCTCTACTAAAAATACCAGG - Intergenic
1189500488 X:41551722-41551744 CTGTCTCTACTAAAAATATGTGG + Intronic
1189543895 X:42021774-42021796 CCATCTCTACTAAAAATAAAAGG - Intergenic
1190003035 X:46707908-46707930 CCTTCTCTACTAAAAATACAAGG - Intronic
1190086384 X:47398840-47398862 CTGTCTCTACTAAAAATACTGGG - Intronic
1190389746 X:49920330-49920352 CCATCTCTACTAAAAATACATGG - Intergenic
1190676751 X:52789250-52789272 CCGTCTCTACCAAAAATACCTGG - Intronic
1190885161 X:54525205-54525227 CCGTCTCTACTAAAAATACACGG + Intergenic
1193127456 X:77884898-77884920 CCGTCTCTACTAAAATTAGCCGG + Intronic
1195646915 X:107242426-107242448 CCTTCTCTACTGAAAATGCGAGG + Intronic
1196667265 X:118329841-118329863 CCATCTCTACTAAAAATAGCCGG - Intergenic
1196695946 X:118611913-118611935 CTGTCTCTACTAAAAATACTGGG - Intronic
1196908728 X:120464911-120464933 CCATCTCTACTAAAAATACAAGG - Intronic
1197563873 X:128057147-128057169 CTGTCTCTACTAAAAATAGCTGG + Intergenic
1198246631 X:134838473-134838495 CCGTCTCTACTAAAATTAGCTGG - Intronic
1198471200 X:136948765-136948787 CCATCTCTACTAAAAATACGGGG - Intergenic
1199756225 X:150867591-150867613 CTGTCTCTAATAAAACTACATGG + Intronic
1201284139 Y:12364634-12364656 CTGCCTCTACAAAAAATACAAGG - Intergenic