ID: 1131171803

View in Genome Browser
Species Human (GRCh38)
Location 15:90184517-90184539
Sequence CTCCAGGCTCAGAGAGGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 1, 1: 0, 2: 6, 3: 64, 4: 459}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131171798_1131171803 24 Left 1131171798 15:90184470-90184492 CCTTGTGAGATCTCTAGTGTTCT 0: 1
1: 0
2: 1
3: 6
4: 160
Right 1131171803 15:90184517-90184539 CTCCAGGCTCAGAGAGGTTAAGG 0: 1
1: 0
2: 6
3: 64
4: 459
1131171800_1131171803 -4 Left 1131171800 15:90184498-90184520 CCACTTTACAGATGAAAAACTCC 0: 1
1: 0
2: 7
3: 110
4: 889
Right 1131171803 15:90184517-90184539 CTCCAGGCTCAGAGAGGTTAAGG 0: 1
1: 0
2: 6
3: 64
4: 459
1131171799_1131171803 -3 Left 1131171799 15:90184497-90184519 CCCACTTTACAGATGAAAAACTC 0: 1
1: 4
2: 40
3: 398
4: 2206
Right 1131171803 15:90184517-90184539 CTCCAGGCTCAGAGAGGTTAAGG 0: 1
1: 0
2: 6
3: 64
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131171803 Original CRISPR CTCCAGGCTCAGAGAGGTTA AGG Intronic
900237989 1:1601487-1601509 CACCTGGCGCAGAGAGGTTGGGG + Intergenic
900907156 1:5567261-5567283 CTCCAGGTTCAGATATGGTATGG - Intergenic
901026206 1:6279935-6279957 CTCCAGGCTCTGAGAGGAATGGG + Intronic
901084620 1:6602958-6602980 CGCCCGGCACAGAGGGGTTAAGG - Intronic
901314524 1:8297160-8297182 CTACATTCTCAGAGGGGTTACGG - Intergenic
901669792 1:10849558-10849580 AAACAGGCTCAGAGAGGTAACGG - Intergenic
902216604 1:14938155-14938177 ATTGAGGCTCAGAGGGGTTAAGG - Intronic
902244885 1:15114303-15114325 CTCCCTGCTCAGGGAGGTTGAGG - Intronic
902399053 1:16147736-16147758 ACCCAGGCACAGAGAGGTCAAGG + Intronic
902889801 1:19434272-19434294 ATCGAGGCTCAGAGAGGTGAAGG - Intronic
903141572 1:21342351-21342373 CAGCAGGCACAGAGAGGTGAAGG - Intronic
903340964 1:22654034-22654056 CAAGAGGCTCAGAGAGGTTAAGG + Intronic
903562433 1:24237923-24237945 ACCGAGGCTCAGAGAGGTTAAGG + Intergenic
903607223 1:24583909-24583931 ACGGAGGCTCAGAGAGGTTAAGG - Intronic
903710037 1:25316652-25316674 CTGGAGGCTCTGAGAGGTTGAGG + Intronic
903734725 1:25522860-25522882 CTGGAGGCTCAGAGAGGGCAAGG - Intergenic
905696900 1:39981119-39981141 CTCCAGGCTCAGAGAGGACAAGG + Intergenic
906063233 1:42961840-42961862 CTTCAGGCTCAGAGAAGAGAAGG - Intergenic
906144748 1:43553250-43553272 CTAGAGGCCCAGAGAGGTTAAGG - Intronic
906648245 1:47491603-47491625 CTGAAGGCTCAGACAGGTTCAGG + Intergenic
906678347 1:47709012-47709034 GGCCAGGCTCTGAAAGGTTAGGG - Intergenic
907497013 1:54851952-54851974 ACCCGGGCTCAGAGGGGTTAAGG + Exonic
907966384 1:59334084-59334106 CAGCAGGCACAGAGAGGTTAAGG - Intronic
908257516 1:62315151-62315173 CCTGAGGCACAGAGAGGTTATGG + Intronic
908555564 1:65254197-65254219 CTCCACACTCCGAGAGGGTAAGG - Intronic
909706476 1:78590941-78590963 CACTGGGCTCAGAGAAGTTAAGG + Intergenic
909979552 1:82082475-82082497 ATGCAGGCTCATTGAGGTTATGG + Intergenic
910367626 1:86483690-86483712 ATTCAGGTGCAGAGAGGTTAAGG + Intronic
910431035 1:87159978-87160000 CTGCAGGCCCAGAGAGTTTAAGG - Intronic
912217122 1:107627114-107627136 CTCCAGGCTCAGAGGGTTTCTGG + Intronic
912516311 1:110218677-110218699 CTTAAGGCTTGGAGAGGTTAAGG + Intronic
912577889 1:110692082-110692104 CTGAAGGCTCAGAGAGATTTAGG - Intergenic
913494726 1:119417904-119417926 ACTGAGGCTCAGAGAGGTTAAGG - Intronic
915714035 1:157927332-157927354 CACCAGGCTCAGAAAGTTTTTGG - Intergenic
915836709 1:159182494-159182516 ACCAAGGCTCAGAGAGGTTTAGG - Intronic
916240147 1:162631594-162631616 ATCCAGGCTCTGAAGGGTTAAGG + Intronic
916368047 1:164056138-164056160 ATTAAGGCTCAGAGAGGCTAAGG - Intergenic
916926810 1:169530230-169530252 TACCAGGCTAAGAGAGGTCAAGG + Intronic
917166080 1:172114730-172114752 ATTGAGGCTCCGAGAGGTTAAGG + Intronic
917313813 1:173704167-173704189 CTCTAGGCTCAGAGGGTTCAGGG + Intergenic
917717071 1:177749030-177749052 ATTCAGTCTCAGAGAGGTCAAGG + Intergenic
918084229 1:181231606-181231628 CTGCAGGCTCAAAGAGTTCAGGG - Intergenic
919258754 1:195161239-195161261 CTCCAGGAAAAGAGAGGTCAGGG + Intergenic
919490400 1:198198461-198198483 CTGCAGGCCCAGAGAGTTTAAGG + Intronic
920111325 1:203589320-203589342 CTCCAGGCCCAGAGTGGATCAGG - Intergenic
920213147 1:204343421-204343443 ACCAAGGCTCAGAGAGGTTAAGG + Intronic
922180590 1:223230020-223230042 ATCAAGGCTCAAAGAGGTTAAGG - Intronic
922516485 1:226211984-226212006 ACCGATGCTCAGAGAGGTTAAGG + Intergenic
923559600 1:235028488-235028510 AACCAGGCTCAGAGAGGGGAAGG + Intergenic
924335189 1:242980512-242980534 ATCAAGGCACTGAGAGGTTATGG - Intergenic
1065952894 10:30668024-30668046 CTTCAGGCTCAGAGCAGTCAGGG - Intergenic
1067707441 10:48620372-48620394 AAGCAGGCTCAGAGATGTTAAGG + Intronic
1068218252 10:54010660-54010682 CTGCAGTCACAGAGAGGTTGTGG - Intronic
1068632734 10:59314404-59314426 ATCAAAGCCCAGAGAGGTTAGGG + Intronic
1069653456 10:70069327-70069349 CTCCAGACTCAGAGAGGAAGAGG - Intronic
1069855104 10:71435882-71435904 CTCCAGCCTCAGTGTGGTGAGGG - Intronic
1069858975 10:71458430-71458452 AACGAGGTTCAGAGAGGTTAAGG - Intronic
1069861348 10:71473585-71473607 ATTGAGGCTCAGAGAGGTTGAGG - Intronic
1069923808 10:71834168-71834190 ATGGAGGCTCAGAGAGGTTAAGG - Intronic
1070256166 10:74814460-74814482 CTCCAGCCTGGGAGAGGTCATGG + Intergenic
1070542217 10:77424370-77424392 ATGAAGGCTCAGAGAGGTCAAGG + Intronic
1070625277 10:78046710-78046732 ATTGAGGCTCAAAGAGGTTAAGG + Intronic
1071335511 10:84597232-84597254 CTCCAGGCTCTGAGAATTTTAGG + Intergenic
1071439096 10:85674591-85674613 CTGGAGGCTCTGAGAGGTTAAGG + Intronic
1071574211 10:86714178-86714200 ATTGAGGCCCAGAGAGGTTAAGG + Intronic
1071801341 10:89065234-89065256 ATACAGGCTCAGGAAGGTTACGG - Intergenic
1072195319 10:93112939-93112961 CTCCAGGCTCATCGAGGAAAGGG - Intergenic
1072211419 10:93250030-93250052 ATTGAGGCTCAGGGAGGTTAAGG + Intergenic
1072483797 10:95834706-95834728 CTCCAGTCTCAGTGAGCTTAGGG + Intronic
1074051091 10:109881901-109881923 CTTGAGGCTCAGAGAGGATTGGG - Intronic
1074155037 10:110790876-110790898 CTGAAGCCTCAGAGAAGTTAAGG - Intronic
1074558725 10:114515890-114515912 CTACCGGCTCAGAGAGGACATGG + Intronic
1075387124 10:122062946-122062968 ATCAGGGCTCAGAGAGGTTAAGG + Intronic
1075414467 10:122252283-122252305 ATGGAGGCTCAGAGAAGTTAAGG - Intronic
1075635811 10:124029579-124029601 CGCCAGGCTCGGAGATGTCAGGG - Intronic
1077219020 11:1407220-1407242 CACCAAGCTCAGAGAGGGCAGGG - Intronic
1077278245 11:1728053-1728075 TTCCAGGCTGAGACAGGTCAGGG - Intergenic
1078516880 11:12030127-12030149 CAGCAGGGTCAAAGAGGTTATGG - Intergenic
1078753701 11:14188754-14188776 AGACAGGCTCAGAGAGATTAAGG - Intronic
1079096260 11:17512318-17512340 AATCAGGCCCAGAGAGGTTAAGG - Intronic
1080397232 11:31901473-31901495 ATAAAGGCTCAGAGAGGTGAAGG - Intronic
1081703961 11:45169692-45169714 CCCCAGGCCCAGAGAAGTTAAGG + Intronic
1081968070 11:47181459-47181481 CTGGAAGCTCAGAGAGGCTAAGG - Intronic
1082988469 11:59187284-59187306 ATTGAGGCACAGAGAGGTTAAGG - Intronic
1083140149 11:60714895-60714917 CACGAGGCTGAGAGAGGATAGGG + Intronic
1083826560 11:65207136-65207158 ATTCAGGTTCACAGAGGTTAGGG + Intronic
1083892067 11:65600432-65600454 TTCCAGGCTCAGAGAGGTTGAGG + Intronic
1084010495 11:66345835-66345857 ACCGAGGCTCAGAGAGGTAACGG + Exonic
1084174617 11:67416757-67416779 CGCCAGCCTCAGAGAGGGGAGGG + Intronic
1085198334 11:74685533-74685555 ATGGAAGCTCAGAGAGGTTAAGG - Intergenic
1085527641 11:77173532-77173554 CTGGGGGCTCAGGGAGGTTAAGG + Intronic
1087266146 11:96063346-96063368 CTGCAGGTTCTGAGAAGTTAGGG + Intronic
1087687146 11:101277723-101277745 CTTGAGGCACAGAGAGGTTAAGG + Intergenic
1088984262 11:114891795-114891817 CTCCAGGGAAATAGAGGTTAGGG + Intergenic
1089931394 11:122316872-122316894 CCTGAAGCTCAGAGAGGTTAGGG - Intergenic
1090452419 11:126818438-126818460 AAATAGGCTCAGAGAGGTTACGG - Intronic
1091680229 12:2521747-2521769 GTCCAGGCGGAGAGAGGTGAGGG - Intronic
1091769545 12:3142095-3142117 ACCAAGGCACAGAGAGGTTAAGG + Intronic
1091784960 12:3237724-3237746 CCCCAGGCACAGAGAGGGCAGGG + Intronic
1091818339 12:3456000-3456022 ACGCAGGCTCAGAGAAGTTAAGG - Intronic
1092725732 12:11483917-11483939 ACTGAGGCTCAGAGAGGTTAAGG + Intronic
1093669817 12:21860360-21860382 ATCAAGGCTGAGAGAGGTTAAGG - Intronic
1093976876 12:25432687-25432709 CTCCAGGGTCAAATAAGTTAGGG + Intronic
1094047998 12:26188135-26188157 GCCAAGGCTTAGAGAGGTTAAGG + Intronic
1095092239 12:38118093-38118115 CTACAGGCTCAGGGAGCTTTAGG + Intergenic
1095284720 12:40395277-40395299 CTGAAGGCTGAGAGAGGTAAGGG - Intronic
1095951881 12:47786062-47786084 CTCAAGGCTCAGGGAGGTTAAGG + Intronic
1096809788 12:54161943-54161965 CTCCAGGCTGAGCAAGGTTCTGG + Intergenic
1097195802 12:57241956-57241978 CTGCCGGCTCAGTGAGGCTAGGG + Intergenic
1101249058 12:102914423-102914445 ATTAAGGCTTAGAGAGGTTAAGG + Intronic
1101437178 12:104673783-104673805 TGCCAGACTCAGAGAGGTTAAGG - Intronic
1102207867 12:111102757-111102779 ACAGAGGCTCAGAGAGGTTAAGG - Intronic
1102383636 12:112488192-112488214 ATTAAGGGTCAGAGAGGTTAAGG + Intronic
1102422478 12:112814965-112814987 CTCCAAGCCTAGAGACGTTAAGG - Intronic
1102650871 12:114441519-114441541 CTCCAGGCCCAGAGAGGGGAAGG + Intergenic
1102869372 12:116401667-116401689 ACTCAGGCCCAGAGAGGTTAAGG + Intergenic
1103206271 12:119131440-119131462 ATCAAGGCTCAGAGAGGTTAAGG + Intronic
1103366609 12:120388904-120388926 ACTGAGGCTCAGAGAGGTTAGGG - Intergenic
1103436403 12:120930193-120930215 ACTGAGGCTCAGAGAGGTTAAGG + Intergenic
1103730959 12:123027517-123027539 CTCGAGGCTCAGAGATATCAAGG - Intronic
1103898388 12:124289675-124289697 CTGCAGGCTCCGAGAGGACACGG + Intronic
1104299033 12:127547149-127547171 ATAGAGGCTCAGAGAGGTTCAGG - Intergenic
1104862210 12:131929621-131929643 CGTCAGGGTCCGAGAGGTTAGGG + Exonic
1104939476 12:132388136-132388158 ATGCAGGCTCAGAGAGGGGAGGG + Intergenic
1106687110 13:32072026-32072048 ATGCAGATTCAGAGAGGTTAAGG - Intronic
1108540581 13:51441117-51441139 CTTGATGCTCAGAGAGATTAAGG + Intronic
1109004465 13:56854036-56854058 TTCCAGGGTCAGAGATTTTAAGG - Intergenic
1109521199 13:63512296-63512318 AGCCAGGCTCAGAGGGGTGAGGG - Intergenic
1110145829 13:72189134-72189156 CTCTAGGTTCATAGAGGTTATGG + Intergenic
1110367295 13:74701331-74701353 CTCATAGGTCAGAGAGGTTAAGG + Intergenic
1112768589 13:102772891-102772913 CTTCAGGTTCAGAGAGGGCAGGG + Intronic
1113387003 13:109858036-109858058 TTCGAGGATCAGAGAGTTTAAGG - Intergenic
1113773206 13:112925466-112925488 CTTAAGGCTCCTAGAGGTTAGGG - Intronic
1114535307 14:23418682-23418704 AAACAGGCTCAGAAAGGTTAGGG + Intronic
1116428426 14:44818604-44818626 CTCCTGACACAGAGAGGTTATGG - Intergenic
1117173705 14:53127364-53127386 GCTGAGGCTCAGAGAGGTTAAGG - Intronic
1118063780 14:62168434-62168456 CTGCAGGCTTAGAGAGTTTACGG + Intergenic
1118688358 14:68313955-68313977 TTCCAGGCCTAGAGAGGCTATGG - Intronic
1118870580 14:69737718-69737740 CCCCAGGGTCAGGGAGATTAAGG - Intronic
1119688953 14:76655489-76655511 ATTAAGGCACAGAGAGGTTAAGG + Intergenic
1119704388 14:76774883-76774905 TCCCAGGCTCAGAGATGTTAAGG - Intronic
1119927798 14:78512949-78512971 CCCCAGGCTTAGAGAAGTAAGGG + Intronic
1119992495 14:79214995-79215017 CTCAAGGTCCAGAAAGGTTAGGG + Intronic
1120718022 14:87860981-87861003 CTCGAGACACAGAGAGGTTAAGG - Intronic
1121102141 14:91257106-91257128 CTCTAGGCTCAGGAAGGTTCTGG - Intergenic
1121662147 14:95643161-95643183 AGCGAGGCTCAGAGAGGTTGAGG + Intergenic
1121959345 14:98244525-98244547 TTCCCGGCACAGAGAGGTTAAGG - Intergenic
1122052370 14:99068570-99068592 GCAGAGGCTCAGAGAGGTTAAGG - Intergenic
1122295655 14:100704317-100704339 CAAAAGGCTCAGAGGGGTTAAGG - Intergenic
1122321713 14:100859499-100859521 CTCCAGCCTCAGGGAGGGCATGG - Intergenic
1122409882 14:101520439-101520461 CCTCGGGCTCAGAGAGGTCAAGG - Intergenic
1122425190 14:101601679-101601701 CAGAAGGCTCAGAGAGGTGAGGG - Intergenic
1122892687 14:104740198-104740220 GTCCTGCCTCAGAGAGGTGATGG + Intronic
1122985764 14:105210922-105210944 AGCCAGGGTCAGAGAGGCTAGGG - Intronic
1202903897 14_GL000194v1_random:57773-57795 CCCCAGGCTCTGAGAGCTCAGGG + Intergenic
1124425289 15:29558026-29558048 AATGAGGCTCAGAGAGGTTAAGG + Intronic
1127019941 15:54735587-54735609 TTTCAGGCTCAAAGATGTTAAGG - Intergenic
1127393760 15:58527398-58527420 CTCTAGACTCACAGAGGTTGAGG - Intronic
1127708673 15:61573537-61573559 CTCAAGACTCAAATAGGTTAAGG + Intergenic
1127917140 15:63464127-63464149 GTGGAGGTTCAGAGAGGTTAGGG - Intergenic
1128259674 15:66224176-66224198 ACCAAGGCTCAGAGAGGTGAAGG - Intronic
1128536839 15:68498031-68498053 ACTGAGGCTCAGAGAGGTTAAGG + Intergenic
1128988703 15:72240766-72240788 CTTCAGGGTAAGTGAGGTTAGGG - Intergenic
1129626679 15:77207936-77207958 CTCCAGGCTCATACAGGTCTAGG + Intronic
1129713381 15:77832950-77832972 AAACAGGCTCAGAGAGGTCAAGG + Intergenic
1129880449 15:79003294-79003316 CTCCAGGGGCACAGAGGTTGGGG - Intronic
1131171803 15:90184517-90184539 CTCCAGGCTCAGAGAGGTTAAGG + Intronic
1131336344 15:91553030-91553052 CTCCAGGCTTTGAGTAGTTAAGG + Intergenic
1133218260 16:4306638-4306660 CTCCAGGCTCAGAGGGATGGCGG + Intergenic
1133269797 16:4605279-4605301 TTCCAGGCTTAGAGAAGTCATGG + Intergenic
1133347137 16:5078652-5078674 CTGCAGGCTCCCAGAGGTTGGGG - Intronic
1133815707 16:9195828-9195850 CCTGAGGCTCACAGAGGTTAAGG - Intergenic
1134211855 16:12284280-12284302 CTTGAGGCTTAGAGAGGTTAGGG - Intronic
1134375481 16:13668682-13668704 ATAGAGGCTTAGAGAGGTTAAGG - Intergenic
1134506229 16:14809519-14809541 AGTGAGGCTCAGAGAGGTTAAGG - Intronic
1134574323 16:15319245-15319267 AGTGAGGCTCAGAGAGGTTAAGG + Intergenic
1134728094 16:16437053-16437075 AGTGAGGCTCAGAGAGGTTAAGG - Intergenic
1134816679 16:17211600-17211622 TCCCAGGCTCAGAGAGGGTGAGG + Intronic
1134939342 16:18274773-18274795 AGTGAGGCTCAGAGAGGTTAAGG + Intergenic
1135113553 16:19708437-19708459 ACCAAGGCTTAGAGAGGTTAGGG - Intronic
1135191844 16:20360778-20360800 CTGGAGGCTAAGAGAGGTTAGGG - Intronic
1135730062 16:24886841-24886863 CTGGAGGATCAGGGAGGTTAAGG + Intronic
1135742400 16:24987322-24987344 CTGCAGGCTCAGAATGGTTTTGG - Intronic
1136055351 16:27684229-27684251 ATGGAGGCACAGAGAGGTTAAGG + Intronic
1136300409 16:29330238-29330260 CTCAAGGCACAGACAGGTTGGGG + Intergenic
1136538554 16:30914850-30914872 ACTGAGGCTCAGAGAGGTTAAGG - Intergenic
1137575800 16:49599450-49599472 ACCAAGACTCAGAGAGGTTAAGG + Intronic
1137750712 16:50859354-50859376 ATTGAGGCTCAGAGATGTTAAGG - Intergenic
1138355812 16:56379581-56379603 TTACAGGCTCATAGACGTTAGGG - Intronic
1138601113 16:58055124-58055146 CCCAAGGCTCAGAGAGGTGAAGG + Intergenic
1140477443 16:75245899-75245921 CTAGATGCTCAGAGAGGCTAAGG - Intronic
1140841136 16:78840267-78840289 ATCAAGGCACAGAGAGGTTCAGG - Intronic
1140904213 16:79396588-79396610 CTTGAGCCTCAGAGAGGTCATGG - Intergenic
1141104671 16:81223722-81223744 CTTCATGCACACAGAGGTTAAGG - Intergenic
1141142543 16:81506157-81506179 ACCAAGGCTCGGAGAGGTTAAGG + Intronic
1141223676 16:82094884-82094906 ATGGAGGCTCAGAGAAGTTAAGG + Intronic
1141929833 16:87194977-87194999 AAACAGACTCAGAGAGGTTAAGG + Intronic
1141938841 16:87260842-87260864 CTGCAGGGTCAGACAGGTCATGG + Intronic
1142201984 16:88765452-88765474 CTCAAGGCACAGAGAGGGGAGGG - Intronic
1142685263 17:1574054-1574076 CTGCAGGCTCAGAGCAGTTCAGG - Intronic
1143284052 17:5776028-5776050 ATTGAGGCTCAGAGAGGTTAAGG + Intronic
1143698728 17:8641016-8641038 ATGGAAGCTCAGAGAGGTTAAGG - Intergenic
1144439737 17:15270897-15270919 CTCCAGGCACAGAGGTGGTATGG + Intergenic
1144627420 17:16851307-16851329 ACTGAGGCTCAGAGAGGTTAAGG - Intergenic
1144708907 17:17387761-17387783 CTGGAAACTCAGAGAGGTTAGGG - Intergenic
1144879020 17:18421412-18421434 ACTGAGGCTCAGAGAGGTTAAGG + Intergenic
1144892130 17:18500220-18500242 CTGCAGGCTCAGGGAGGCGAGGG + Intergenic
1145140086 17:20444068-20444090 CTGCAGGCTCAGGGAGGCGAGGG - Intergenic
1145153217 17:20522982-20523004 ACTGAGGCTCAGAGAGGTTAAGG - Intergenic
1145294557 17:21578081-21578103 CTCCAGACTCAGAGAGGTGATGG - Intergenic
1145369276 17:22295095-22295117 CTTCAGACTCAGAGAGGTGATGG + Intergenic
1146687063 17:34848361-34848383 ATCAAGGCTCAGGCAGGTTAAGG - Intergenic
1146927431 17:36754612-36754634 GACGAGGCTCGGAGAGGTTAGGG + Intergenic
1147581551 17:41629982-41630004 ACGGAGGCTCAGAGAGGTTAAGG - Intergenic
1147653831 17:42077401-42077423 ATTGAGGCTCAGAGAGGTGAAGG + Intergenic
1147950871 17:44107256-44107278 GAGAAGGCTCAGAGAGGTTAAGG - Intronic
1148025902 17:44587457-44587479 ATCCAGGCTGAGAGAGGCCATGG + Intergenic
1148554947 17:48572874-48572896 GTCCAGTCTCAGCGAGGTCAAGG + Intronic
1148583325 17:48758829-48758851 CTCCAGGCTCAGAGATATCTGGG - Intergenic
1148736197 17:49866333-49866355 ACCAAGGCTCAGAGAAGTTAAGG + Intergenic
1149033591 17:52110390-52110412 ATTGAGGCTCAGAGAGGTTAAGG - Intronic
1149533570 17:57415105-57415127 ATCTAGGCTCATAGATGTTATGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151352845 17:73541930-73541952 AGGCAGGCTCAGAGAGGTTTGGG - Intronic
1151376264 17:73691047-73691069 CTCCGGCCTCAGAGAGGACATGG + Intergenic
1151989364 17:77564400-77564422 CTCTAGGCTCAGAGAAGGGAGGG - Intergenic
1152268611 17:79310616-79310638 CTGCAGGCTCACAGAGGAGAAGG + Intronic
1152472381 17:80497176-80497198 CCCCAGGCTCAGGGACGTGAAGG - Intergenic
1153920217 18:9782267-9782289 CCCCAGGCCCAGGGCGGTTAGGG + Intronic
1154197153 18:12274993-12275015 AGCAAGGCTCAGAGAAGTTAAGG - Intronic
1154370624 18:13758920-13758942 CTCCAGGAACAGAGAGGCCAAGG + Intronic
1156270332 18:35524638-35524660 GCCGAGGGTCAGAGAGGTTAAGG - Intergenic
1156332885 18:36141392-36141414 CATCAGGCTCAGAGTTGTTAGGG + Intronic
1156665409 18:39399555-39399577 CTCCATGTTCAGAGTGGTCATGG + Intergenic
1157295319 18:46437960-46437982 CTCCAGGCTCAGGGAGCTTTGGG - Intronic
1160369538 18:78360464-78360486 CACCAGGCACAGAGAGGCAAAGG + Intergenic
1160441880 18:78899392-78899414 CTCCAGGCTCAGGGAGATGGGGG - Intergenic
1161119989 19:2520451-2520473 ATGGAGGCTCAGAGAGGTTAAGG + Intronic
1161637336 19:5397103-5397125 TTCCAGGCTCAGATAAGTTTAGG + Intergenic
1162938670 19:13995133-13995155 GCTGAGGCTCAGAGAGGTTAAGG + Intronic
1162955394 19:14094972-14094994 GCGCAGGCCCAGAGAGGTTAAGG - Intronic
1162966528 19:14158832-14158854 ATGAAGGCTCAGAGAGGTCAGGG - Intronic
1163450883 19:17376851-17376873 ACTCAGGCTCAGAGAGGTGAGGG + Intronic
1163577426 19:18118836-18118858 ACCCAAGCACAGAGAGGTTAAGG - Intronic
1163597185 19:18226931-18226953 ATCCAGGCTCTGAGATCTTAGGG - Intronic
1164998534 19:32741657-32741679 CTTCTGTCTCAGACAGGTTAGGG - Intronic
1165043915 19:33089252-33089274 ACCAAGGGTCAGAGAGGTTAAGG + Intronic
1165388617 19:35526115-35526137 ACAAAGGCTCAGAGAGGTTAGGG - Intronic
1166041108 19:40203600-40203622 GTACACGCTCAGAGAGGTAAGGG - Intronic
1166337299 19:42116210-42116232 CTCCAGAGTCAGGGAGGTGATGG + Intronic
1166563740 19:43750636-43750658 CACCAGGCCCAGAGAGATTCTGG + Exonic
1166950267 19:46422549-46422571 GCCAAGGCTCAGAGAGGTGAAGG - Intergenic
1167015739 19:46839814-46839836 CTCCAGGATCAGAGGGGGTTAGG - Intronic
1167112131 19:47468727-47468749 ACCAAGGCGCAGAGAGGTTACGG + Intronic
1167390193 19:49189883-49189905 CATGAGGCACAGAGAGGTTAAGG - Intronic
925140444 2:1546684-1546706 CTCCAGGTTCACAGAGGCTCTGG - Intergenic
925896062 2:8473189-8473211 ATTGAGGCTCACAGAGGTTAAGG - Intergenic
926105318 2:10146162-10146184 CTTGAGGCTCAGGGAGGTTAAGG + Intronic
927062458 2:19436739-19436761 CTCCAGTCTCAGAGATGAGAGGG + Intergenic
927361607 2:22241585-22241607 TCACAGTCTCAGAGAGGTTAAGG - Intergenic
927719610 2:25374134-25374156 CTCCAGGGTCTTAGAGCTTAAGG - Intergenic
928088196 2:28358749-28358771 CCCAAGTCTCAGAGAGGTTTGGG - Intergenic
928401734 2:30983972-30983994 ACCCGGGCTCAGAGAGGTTAGGG - Intronic
929146637 2:38712324-38712346 CTACAGGCTCAGGGAGCTTCAGG - Intronic
929790227 2:45017012-45017034 CTCAAGGCTCAGAGGGCTCAGGG - Intergenic
929828416 2:45328570-45328592 CTCCTGGCTCAGTTAGGTTAGGG + Intergenic
930115943 2:47718329-47718351 CGCCAGGCTCAGCGGGGCTATGG - Intronic
930715765 2:54592882-54592904 CCCAAGGCTCAGTGAGGTTAAGG - Intronic
931467447 2:62503485-62503507 ATCCAGGGTCACAGAGGTTTGGG - Intronic
931745912 2:65291992-65292014 ATCTAGGCACAGAGAGGATAAGG - Intergenic
932340621 2:70960805-70960827 ATCCAAGCCCAGAGAGGTGAGGG - Intronic
932456567 2:71853151-71853173 CTCCAAGATCAGAGAGCTGAGGG + Intergenic
933843842 2:86309228-86309250 TTACAGGTCCAGAGAGGTTAGGG - Intronic
937107801 2:119334604-119334626 CACCAGGGTCCGGGAGGTTAAGG + Intronic
937153182 2:119699982-119700004 CTCCAGACTTAGAGAGCTCATGG + Intergenic
937267353 2:120624915-120624937 GCCCAGGCTCAGAGCAGTTATGG + Intergenic
937337884 2:121072877-121072899 CTCCAGGCTGGCAGGGGTTAGGG - Intergenic
937950776 2:127386911-127386933 CTTGAGGCTCAGAGAGATTAAGG - Intronic
938292338 2:130156828-130156850 ATCAAGGTTCAGAGAGGTTAGGG + Intronic
938701848 2:133886531-133886553 AGCCAGGCTAAGAGAGATTACGG + Intergenic
941055499 2:160783396-160783418 CTGCAGGCCCAGAGGGTTTAGGG - Intergenic
942098392 2:172555564-172555586 TTCCAGGGTCAGAGAGCTTCAGG - Intronic
944898108 2:204186584-204186606 CTCTTTGCTCAGAGAGGTGAAGG - Intergenic
945964824 2:216175394-216175416 CTGCAGGATCACAGAGGTGATGG - Intronic
946105189 2:217363065-217363087 GCTGAGGCTCAGAGAGGTTAAGG + Intronic
946614958 2:221499330-221499352 CTGCAAGCTCAGAGATGTTAAGG - Intronic
946756723 2:222954455-222954477 ATTGAGGCTCAGAGATGTTAAGG + Intergenic
947242652 2:228013143-228013165 TTCTAAGCTCAGAGATGTTATGG - Intronic
948486404 2:238284001-238284023 CACAAGGCTCAGGGAGGTTAAGG - Intronic
948897553 2:240934364-240934386 CTCCGGGCTCAGAGAGGAGCTGG + Intronic
1168833588 20:861289-861311 GTCAAGGTGCAGAGAGGTTAAGG + Intergenic
1168860397 20:1042273-1042295 CTCCATGGTCAGAGAGGTAAGGG + Intergenic
1169049808 20:2566175-2566197 TATTAGGCTCAGAGAGGTTAAGG - Intronic
1169075421 20:2757121-2757143 CTCCAGGCTGAGACAGGGGAGGG + Intronic
1170157728 20:13284048-13284070 ACTGAGGCTCAGAGAGGTTAAGG - Intronic
1170368087 20:15618895-15618917 TTCCAGGATCAGAGATTTTAAGG + Intronic
1172188812 20:33049248-33049270 CTCCAGGCTCAGTGTGCTGATGG + Intergenic
1172250388 20:33475443-33475465 CTCCAGGCTCAGAGCAGTTAAGG - Intergenic
1172273680 20:33668354-33668376 CTCCTGGCCCAGAAAGGGTATGG - Exonic
1172841511 20:37905007-37905029 ACCAAGGCTCAGAGAGGTGAAGG + Intronic
1173147056 20:40534051-40534073 ATTGAGGCTTAGAGAGGTTAAGG - Intergenic
1173182313 20:40814586-40814608 ACCAAGGCACAGAGAGGTTAAGG - Intergenic
1173350504 20:42241036-42241058 AGTGAGGCTCAGAGAGGTTAAGG + Intronic
1173518715 20:43683374-43683396 AGCAAGGCTCAGAGAGGTTGGGG + Intronic
1174178771 20:48661917-48661939 ATCAAGGCTCGGAGAGGTAAAGG + Intronic
1174275790 20:49403156-49403178 CAAAAGGCTCAGAGAAGTTAAGG + Intronic
1174288690 20:49491095-49491117 ATTGAGGCTCAGAGAGGTTAGGG - Intergenic
1174449140 20:50609126-50609148 CACCAGGCTCAGAGAGGGGTGGG + Intronic
1174459950 20:50675449-50675471 ATCAAGACTCAGAGAAGTTAAGG + Intronic
1174514019 20:51077309-51077331 AGCAAGGCACAGAGAGGTTAAGG + Intergenic
1174803397 20:53584350-53584372 CTGCAGGCTCAGAGAAGCCAAGG + Intronic
1174874783 20:54215639-54215661 ATAGAGGCTTAGAGAGGTTATGG + Intronic
1175047607 20:56122090-56122112 GTTAAGGCTCAGAAAGGTTAAGG + Intergenic
1175189441 20:57201275-57201297 GCCCAGGCTCTGACAGGTTAGGG + Intronic
1175205781 20:57310091-57310113 ACTGAGGCTCAGAGAGGTTAAGG - Intergenic
1175488072 20:59359675-59359697 CTGCAGGCACAGACAGGTAAAGG - Intergenic
1175488260 20:59361098-59361120 GCTGAGGCTCAGAGAGGTTAAGG + Intergenic
1175523803 20:59619776-59619798 CCTCAGGTTCAGAGAGGTGAAGG + Intronic
1175897891 20:62347462-62347484 CTTCTGGCTCAGGGAGGTTTTGG - Intronic
1176623267 21:9072541-9072563 CCCCAGGCTCTGAGAGCTCAGGG + Intergenic
1176872965 21:14098845-14098867 CTACAGGCTCAGGGAGCTTCAGG - Intergenic
1179085364 21:38211954-38211976 ACAGAGGCTCAGAGAGGTTAAGG - Intronic
1179555561 21:42173298-42173320 CTTCAAGCTCAGAGAGGTTCCGG - Intergenic
1181759581 22:25048983-25049005 GTTGAGGCTCAGAGAGGTTGAGG + Intronic
1182049668 22:27303085-27303107 ATTGAGGCTCAGAGAGGTGAAGG + Intergenic
1182080801 22:27527236-27527258 CTCCAGGCTCAGAAAGGAAAGGG + Intergenic
1182246659 22:28963566-28963588 CTCCAGGATCAGAGAGAATGGGG - Intronic
1182417591 22:30231407-30231429 ACCAAGGCTCAGAGAGGTGAAGG + Intergenic
1183101698 22:35588135-35588157 TTAGAGGCACAGAGAGGTTAAGG - Intergenic
1183321627 22:37168515-37168537 AAACAGGCTCAGAGAGGTAAAGG - Intronic
1183504222 22:38200186-38200208 CTGGAGGCTCAGAGAGGTGAAGG - Intronic
1183531082 22:38353665-38353687 AAGGAGGCTCAGAGAGGTTAAGG - Intronic
1183599143 22:38830002-38830024 AAACAGGCTCAGAGAAGTTAAGG - Intronic
1183600741 22:38839008-38839030 ACCAAGGTTCAGAGAGGTTAAGG - Intronic
1183750662 22:39718504-39718526 ACCAAGGCTCAGAGAGCTTAAGG + Intergenic
1183948948 22:41342128-41342150 GGCAAGACTCAGAGAGGTTAGGG - Intronic
1184231811 22:43162486-43162508 CTCTAAGCTCAGAGAGGGGAAGG + Intronic
1184255520 22:43284613-43284635 CTTGAGGCACTGAGAGGTTAGGG - Intronic
1184413976 22:44341545-44341567 AAACAGGCCCAGAGAGGTTAGGG + Intergenic
1184445812 22:44546169-44546191 CTCAACGCTCAGAGAAGTGAGGG - Intergenic
1184516301 22:44964920-44964942 GCCAAGGCTCAGAGATGTTAAGG - Intronic
1184535574 22:45084527-45084549 TCTGAGGCTCAGAGAGGTTATGG + Intergenic
1184683936 22:46087586-46087608 GCACTGGCTCAGAGAGGTTATGG + Intronic
1185000571 22:48242962-48242984 CTGCAGGCTCAGAGATGTGCTGG + Intergenic
1185375954 22:50482652-50482674 CTCCAGGCACAGAGGGGTGCCGG + Exonic
950128047 3:10522783-10522805 CTGGAGGCTCAGAGAGGTAATGG + Intronic
950193960 3:10995950-10995972 CTCCAGGCACAGAGAAGCTCAGG - Intronic
950633715 3:14300675-14300697 CTTAAGGCTCAGAGAGTTGAAGG + Intergenic
952816735 3:37452941-37452963 CTCCAGGCCCTGCGAGGTTCAGG - Intronic
953026652 3:39148984-39149006 TTGGAGGCACAGAGAGGTTAAGG - Intronic
953330165 3:42046067-42046089 CTGCAGGCTCAGAGATGTGTAGG - Intronic
953690010 3:45109954-45109976 CAGAAGGTTCAGAGAGGTTATGG - Intronic
954154074 3:48675056-48675078 TTCCAGGGTAAGAGAGGATAGGG - Intronic
954440169 3:50517417-50517439 CTCCTGCCTCAGAGAGGGAAGGG - Intergenic
954649358 3:52150804-52150826 CCTGAGGGTCAGAGAGGTTAGGG - Intronic
955360450 3:58269480-58269502 CTCCAGACTCAGACATGTAATGG - Intronic
955429550 3:58828402-58828424 CTGGAGGCACAGAGATGTTAGGG + Intronic
955522979 3:59793019-59793041 TTCCAGGCTCTGGGAGGTCAGGG + Intronic
956808966 3:72846155-72846177 CTCTAGGCTTATAGAGTTTAGGG - Intronic
957468476 3:80626827-80626849 TTCCAGGATCAGAGATTTTAAGG + Intergenic
957767817 3:84648647-84648669 CTCCAGGCTCAGAGATTTCCAGG + Intergenic
960624109 3:119663488-119663510 CAGCAGGCTCAGAGAGGCTAAGG + Intronic
960989179 3:123299813-123299835 CCCCAGGCTCAGAGGAGTCACGG - Intronic
961381855 3:126500561-126500583 GCAGAGGCTCAGAGAGGTTAAGG + Intronic
961498745 3:127315445-127315467 CTACAGGACCAGAGAAGTTATGG - Intergenic
961683363 3:128613597-128613619 CTTGAGGCCCAGAGAGGTCAGGG + Intergenic
962826281 3:139103032-139103054 ATATAGGCTCAGAAAGGTTAAGG - Intronic
962943319 3:140145301-140145323 TACCAGGCTCAAAGATGTTATGG - Intronic
965815754 3:172635031-172635053 TCTGAGGCTCAGAGAGGTTAAGG + Intronic
966586264 3:181629019-181629041 AAACAGGCTCAGAGAGGTGAAGG - Intergenic
966601676 3:181781664-181781686 AAGCAGGCTCCGAGAGGTTAAGG + Intergenic
966984722 3:185168707-185168729 CTGGAGGCACAGAGAGGTTAAGG + Intergenic
967190199 3:186978237-186978259 AAACAGTCTCAGAGAGGTTAAGG + Intronic
967355616 3:188567255-188567277 GTTGAGGCGCAGAGAGGTTAAGG - Intronic
968927625 4:3558141-3558163 GCTGAGGCTCAGAGAGGTTAAGG + Intergenic
969281740 4:6175209-6175231 CTGAAGGCTCAGAAAGGTTAAGG + Intronic
969350198 4:6593884-6593906 ACCAAGGCCCAGAGAGGTTAAGG + Intronic
969581283 4:8067068-8067090 GTCGAGGCTCAGAGAGGCGAGGG + Intronic
969922727 4:10556019-10556041 AGCAAGGCTCAGAGAGGTTGAGG - Intronic
970313325 4:14805500-14805522 CTGAAGGCTCAGAGAAATTATGG - Intergenic
970431271 4:15991029-15991051 TTCAAGGCTCAGAGGGGTTTGGG + Intronic
971176868 4:24290443-24290465 ATGGAGGCTCAGAGAGGCTAAGG - Intergenic
973236953 4:47915453-47915475 CTCCAGGCTTAGTGAGTTTTAGG + Intronic
974014663 4:56638004-56638026 CTCCAGACACTGAGAGGTAAGGG + Intergenic
975495325 4:75030293-75030315 GTTAAGGCTCAGAGAGATTAAGG - Intronic
977954816 4:103014892-103014914 ATTGAGACTCAGAGAGGTTAAGG - Intronic
978947326 4:114515672-114515694 CTCAAGTCTAAGAGAGGTTAGGG - Intergenic
979241924 4:118454768-118454790 ATCAAGGCACTGAGAGGTTATGG + Intergenic
979407540 4:120331721-120331743 CTCCAGGCTCAGTGAGAAAAGGG - Intergenic
981070385 4:140529495-140529517 TTCCAGGCTGAGAGATGTCAAGG - Intronic
982211431 4:153039701-153039723 ACAAAGGCTCAGAGAGGTTAAGG + Intergenic
982277940 4:153656030-153656052 CTCCAGACTCAGAGAGGAAGGGG - Intergenic
983338786 4:166430867-166430889 CACAAGTCCCAGAGAGGTTAGGG + Intergenic
983514340 4:168640762-168640784 ATTAAGGCTCAGTGAGGTTAAGG + Intronic
983646988 4:170001914-170001936 CTCCAGGCCCAGAGAGAATGGGG - Intronic
985317836 4:188677231-188677253 TTCCATGCTCATGGAGGTTAAGG + Intergenic
986452639 5:7881476-7881498 CTGCAGGCTCAAAGAGTTCAAGG + Intronic
987279866 5:16402072-16402094 CTGAAGGCTGAGAGAGGTGAGGG - Intergenic
987365164 5:17142031-17142053 ATCCAGGCTTGGAGAGGTTCAGG - Intronic
988187137 5:27880409-27880431 CTACAGGCTCAGTGATTTTATGG + Intergenic
988509976 5:31856484-31856506 ATGCAGGCTCAGAGAGGGTGAGG - Intronic
990490422 5:56297877-56297899 CCTAAAGCTCAGAGAGGTTATGG + Intergenic
991453401 5:66777082-66777104 ATCGAAGCTCAGAGAGGTCAAGG + Intronic
995907995 5:117149579-117149601 CTCCTGGATGAGAGAGGTAAGGG - Intergenic
996988122 5:129593188-129593210 CTTCAGGATCAGAGAGATTTGGG - Intronic
997714581 5:136032608-136032630 CTCCAAGCTCAGAGAACTTCAGG - Intronic
998132926 5:139660238-139660260 CTGCAGGCTCAAAGAGGCTCTGG + Intronic
999275696 5:150328642-150328664 CATCAGGCTCAGAGAGGGAAAGG - Intronic
999743377 5:154573886-154573908 CCCCAGCCTCAGGGAGGTTGAGG + Intergenic
1001397446 5:171427523-171427545 GTGGAGACTCAGAGAGGTTAAGG - Intronic
1001428104 5:171638008-171638030 ACTGAGGCTCAGAGAGGTTAAGG - Intergenic
1001557254 5:172645219-172645241 GTGGAGGCTCAGAGAGGTCAAGG + Intronic
1001594978 5:172892489-172892511 CCCAAGGCTCCGAGAGGTCAAGG - Intronic
1001951484 5:175819786-175819808 GGCCAGGCTCAGAGAGGTGAAGG + Intronic
1002123154 5:177021588-177021610 CATCAGGATCAGGGAGGTTAAGG + Intronic
1004093067 6:12525050-12525072 ATTGAGGCTCAGAGAAGTTAGGG - Intergenic
1006299274 6:33185233-33185255 CTCCAAGGTCATAGAGGTTTGGG + Intronic
1006520730 6:34569528-34569550 TTTGAGGCACAGAGAGGTTAAGG + Intergenic
1006742740 6:36321032-36321054 ACCGAGACTCAGAGAGGTTAAGG + Intronic
1006813095 6:36833227-36833249 ATTGAGGCTCAGAGAGGTGAAGG - Intronic
1006844352 6:37051989-37052011 AAACAAGCTCAGAGAGGTTAAGG - Intergenic
1008652902 6:53581341-53581363 CTCCTGACTCACAGTGGTTATGG + Intronic
1008728174 6:54446780-54446802 GACCAGACTCAAAGAGGTTAGGG + Intergenic
1010133925 6:72527730-72527752 TTCCAGCTTCACAGAGGTTATGG - Intergenic
1012071949 6:94632905-94632927 CTCCAAGAACAGGGAGGTTAGGG - Intergenic
1013294359 6:108745579-108745601 GTACAGGTCCAGAGAGGTTACGG - Intergenic
1013605330 6:111742183-111742205 ATCTAACCTCAGAGAGGTTAAGG + Intronic
1013646022 6:112142194-112142216 GTACAGGCTCAGAGACGTGAAGG + Exonic
1014457052 6:121648017-121648039 ATTGAGGTTCAGAGAGGTTAAGG + Intergenic
1014812488 6:125902357-125902379 TTGGAAGCTCAGAGAGGTTAAGG + Intronic
1015724108 6:136282098-136282120 GAACAGGCTCAGAGAGCTTAAGG - Intronic
1018834273 6:167471351-167471373 CTCCAGGCCCATACAGGTTCAGG - Intergenic
1020078839 7:5275648-5275670 GCCCAGGCTCAGAGAGGTAGAGG - Intronic
1021425346 7:20493787-20493809 GCCAAGGCTTAGAGAGGTTAAGG + Intergenic
1022474560 7:30701462-30701484 CTCCAAGCTCTGGGAGGATAAGG + Intronic
1022816065 7:33915587-33915609 ATGAAGGCTCAGAGAGGGTAAGG - Intronic
1023434998 7:40133671-40133693 CTCCAGGCTCAAAAGGGGTAGGG + Intronic
1025200048 7:56956519-56956541 GCCCAGGCTCAGAGAGGTAGAGG + Intergenic
1025671896 7:63620413-63620435 GCCCAGGCTCAGAGAGGTAGAGG - Intergenic
1025871565 7:65439148-65439170 CTCCAGGCCTAGAGGGGTAATGG + Intergenic
1026836932 7:73645846-73645868 AAACAGGCTCAGAGAGGTCAAGG - Intergenic
1026880657 7:73904877-73904899 CTCCGGCCTCAGCGAGGTTGGGG - Intergenic
1026900592 7:74034776-74034798 AATCAGGCTCAGAGAGGTTAAGG - Intronic
1027519970 7:79193861-79193883 CCCCAGGCAAAGAGAGGATATGG + Intronic
1029526345 7:101096500-101096522 ACTGAGGCTCAGAGAGGTTAAGG - Intergenic
1029581910 7:101441941-101441963 AAACAGGCTCAGAGAGGTTTAGG + Intronic
1030130634 7:106196582-106196604 GTTGAGGCCCAGAGAGGTTAAGG + Intergenic
1030282871 7:107795213-107795235 GGCAAGGCTCAGAGAGGTTAAGG - Intronic
1030297727 7:107945678-107945700 TCTCAGACTCAGAGAGGTTAAGG - Intronic
1030567285 7:111174512-111174534 TTCAAGGTTCAGAGTGGTTACGG + Intronic
1031991560 7:128202268-128202290 CTCCAGGCTGAAAGGGGTGAAGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032789361 7:135231296-135231318 CCCCAGGCTCAGAGAGGGCCAGG - Intergenic
1032985946 7:137337381-137337403 ATGCAGGCTTAGAGAAGTTAAGG - Intronic
1034111060 7:148537834-148537856 CCCAAGGCTCGGAGAAGTTAAGG - Intergenic
1036618447 8:10406285-10406307 ACACAGGTTCAGAGAGGTTAAGG - Intronic
1036787890 8:11700043-11700065 ATGGAGGCTCAGAGAGGTTAAGG - Intronic
1037667050 8:20978857-20978879 ATCCAGGCTCCGAGGGGATATGG - Intergenic
1039833058 8:41233122-41233144 AACCAGGCACTGAGAGGTTAAGG - Intergenic
1040700529 8:50058149-50058171 CTGCAGACTCTGAGAGGTTGGGG + Intronic
1042197208 8:66241316-66241338 CTGCAGACTCAGGGAGCTTACGG + Intergenic
1042199909 8:66271357-66271379 CTATAGACTCAGAGAAGTTAAGG - Intergenic
1043448912 8:80347043-80347065 AAAGAGGCTCAGAGAGGTTAAGG - Intergenic
1043586376 8:81774302-81774324 CTGAAGCCTCAGAGAGATTAAGG - Intergenic
1044474642 8:92612083-92612105 AACCAAGCTCAGAGAGGTTCTGG - Intergenic
1045005124 8:97910784-97910806 CTGAAGGCTCAGAGAAGTTAGGG - Intronic
1045507422 8:102788630-102788652 ATCGAAGCTCAGAGAGGTTATGG - Intergenic
1046962554 8:120125958-120125980 CTCCCGGCGCAGAGAGGTGGAGG - Intronic
1047173904 8:122522331-122522353 CTCAAGGCTCAGAGAGAATAAGG + Intergenic
1047217300 8:122886935-122886957 ATGGAGGCTCAGATAGGTTAAGG + Intronic
1047224275 8:122943417-122943439 ACTAAGGCTCAGAGAGGTTAAGG - Intronic
1048690688 8:136959639-136959661 ACTGAGGCTCAGAGAGGTTAAGG + Intergenic
1048853832 8:138669626-138669648 ACTCAGGCTCAGAGAGGTTTAGG - Intronic
1049337241 8:142092931-142092953 AGCCAGGCACAGAGAGGCTAAGG - Intergenic
1049399037 8:142416658-142416680 CTCCAAGCTCAGAGGGGTGCTGG - Intergenic
1049434721 8:142581206-142581228 CCCCAGGCTGAGAGAGGAGAGGG - Intergenic
1049770117 8:144376034-144376056 CCCAAGGCCCAGAGAGGTTATGG - Intronic
1051726124 9:20089441-20089463 CCCCAGGCTGAGAGCTGTTAGGG - Intergenic
1052325499 9:27213176-27213198 AACCAGGCTAAGAGAGCTTAAGG - Intronic
1052512326 9:29437803-29437825 CTGCAGGGCCAGAGAGGTAAAGG - Intergenic
1052959095 9:34279272-34279294 TTTCAGGCTCAGAGAGATAAAGG + Intronic
1053289635 9:36871429-36871451 CTCCCAGCCCTGAGAGGTTAGGG - Intronic
1053384686 9:37677555-37677577 GTACAGGCTCAGGGAGGCTAAGG + Intronic
1053802481 9:41773220-41773242 GCTGAGGCTCAGAGAGGTTAAGG + Intergenic
1054142756 9:61541850-61541872 GCTGAGGCTCAGAGAGGTTAAGG - Intergenic
1054190790 9:61984566-61984588 GCTGAGGCTCAGAGAGGTTAAGG + Intergenic
1054462506 9:65473000-65473022 GCTGAGGCTCAGAGAGGTTAAGG - Intergenic
1054647584 9:67603151-67603173 GCTGAGGCTCAGAGAGGTTAAGG - Intergenic
1055428206 9:76217518-76217540 ACTGAGGCTCAGAGAGGTTATGG + Intronic
1055824697 9:80309331-80309353 CTTCATGTTCAGAAAGGTTAGGG + Intergenic
1057859834 9:98632241-98632263 CTGGAGGCTTAGAGAGGTTAAGG - Intronic
1058575080 9:106392391-106392413 GTCACAGCTCAGAGAGGTTAAGG - Intergenic
1058970411 9:110077180-110077202 ACCAAGGCTCAGAGAGGTTAAGG - Intronic
1059688440 9:116660437-116660459 ATGGAGGCTTAGAGAGGTTAAGG - Intronic
1059811127 9:117856796-117856818 CGCAAGGCTCAGAGTGGTGATGG - Intergenic
1059811182 9:117857420-117857442 ATTAAGGCTCAGAGAGGTGAAGG - Intergenic
1060034226 9:120241346-120241368 GCCAAGGTTCAGAGAGGTTAAGG + Intergenic
1060413891 9:123417469-123417491 CAGGAGGCCCAGAGAGGTTAAGG + Intronic
1060680782 9:125562100-125562122 CTCCAGCATCACAGAGGTTCAGG + Intronic
1060869324 9:127027021-127027043 CTCCTGGCTCAGAGTCATTAAGG - Intronic
1060940674 9:127541406-127541428 ACTGAGGCTCAGAGAGGTTAAGG + Intronic
1060969851 9:127731803-127731825 GTCAAGGCTCAGTGAGGTTCTGG + Exonic
1060975335 9:127761840-127761862 ATGCAGGCTCAGAGAGGTGAAGG - Intronic
1061112541 9:128584990-128585012 ATTCAGGCTCAGAAAGGGTAAGG - Intronic
1061206402 9:129166416-129166438 CTGGAGGCTCAGGGAGGTGAAGG + Intergenic
1061242885 9:129384433-129384455 ATGGATGCTCAGAGAGGTTAAGG - Intergenic
1061441140 9:130604499-130604521 ACACAGGCTCAGAGACGTTAAGG - Intronic
1061755418 9:132808998-132809020 CTGCAAGCTCAGAGATGCTAGGG + Intronic
1061811478 9:133164671-133164693 AGACGGGCTCAGAGAGGTTATGG + Intergenic
1062186590 9:135221701-135221723 TTCCGGGCTCAGAGAGGTCAGGG - Intergenic
1062395577 9:136351326-136351348 CTCCAGGCCCAGGGAGGCTGGGG - Intronic
1203775547 EBV:71184-71206 CTCTAGGGTCAGAGAGGCCAGGG + Intergenic
1203746453 Un_GL000218v1:42968-42990 CCCCAGGCTCTGAGAGCTCAGGG + Intergenic
1189377353 X:40475999-40476021 CTCCCTGCTCAGAGAGGCCAGGG - Intergenic
1190075874 X:47316829-47316851 CTCCAGGGTCAAAAAAGTTAGGG - Intergenic
1190756926 X:53409317-53409339 CTCCTGGCTCAGAGAGCTCTGGG + Intronic
1191863686 X:65686679-65686701 GTGGAGGCTCAGGGAGGTTAAGG - Intronic
1192212192 X:69134864-69134886 ATTGAGGCTCAGAGAGGTAAAGG + Intergenic
1192236723 X:69300812-69300834 ATCAAGGCTCGGAGAGGTGAAGG - Intergenic
1192598000 X:72431900-72431922 ATCGAGGCTTAGAGAGGTGAAGG + Intronic
1196634540 X:117986999-117987021 TTTCAGGCTCAGAGTGGTGAAGG - Intronic
1196742058 X:119033784-119033806 ACCAAGGCTCAGAGAGGTTAAGG + Intergenic
1196754234 X:119143861-119143883 ATTAAGGCTCAGAAAGGTTAAGG + Intronic
1198412883 X:136389636-136389658 CTCGAGTCTCAGAGAGGGGAAGG + Intronic
1201159785 Y:11157982-11158004 CCCCAGGCTCTGAGAGCTCAGGG + Intergenic
1201593045 Y:15636715-15636737 AGCCAGGCGCAGAGTGGTTAAGG + Intergenic
1201768477 Y:17595219-17595241 CTGCAGGCTCAGGGAGCTTCAGG - Intergenic
1201833077 Y:18310766-18310788 CTGCAGGCTCAGGGAGCTTCAGG + Intergenic
1202389633 Y:24356593-24356615 ATCAAGGCACTGAGAGGTTATGG + Intergenic
1202481151 Y:25313521-25313543 ATCAAGGCACTGAGAGGTTATGG - Intergenic