ID: 1131171929

View in Genome Browser
Species Human (GRCh38)
Location 15:90184965-90184987
Sequence CGGCGCAGCCCCTGGGGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 285}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131171929_1131171940 -4 Left 1131171929 15:90184965-90184987 CCGGGTCCCCAGGGGCTGCGCCG 0: 1
1: 0
2: 2
3: 32
4: 285
Right 1131171940 15:90184984-90185006 GCCGGGCCGGCCTGGCAAGGGGG 0: 1
1: 0
2: 0
3: 30
4: 351
1131171929_1131171946 26 Left 1131171929 15:90184965-90184987 CCGGGTCCCCAGGGGCTGCGCCG 0: 1
1: 0
2: 2
3: 32
4: 285
Right 1131171946 15:90185014-90185036 AGTGGACACTCCAGGAAGAGCGG 0: 1
1: 0
2: 3
3: 31
4: 282
1131171929_1131171938 -6 Left 1131171929 15:90184965-90184987 CCGGGTCCCCAGGGGCTGCGCCG 0: 1
1: 0
2: 2
3: 32
4: 285
Right 1131171938 15:90184982-90185004 GCGCCGGGCCGGCCTGGCAAGGG 0: 1
1: 0
2: 0
3: 15
4: 135
1131171929_1131171944 8 Left 1131171929 15:90184965-90184987 CCGGGTCCCCAGGGGCTGCGCCG 0: 1
1: 0
2: 2
3: 32
4: 285
Right 1131171944 15:90184996-90185018 TGGCAAGGGGGACGAGTCAGTGG 0: 1
1: 0
2: 0
3: 9
4: 154
1131171929_1131171939 -5 Left 1131171929 15:90184965-90184987 CCGGGTCCCCAGGGGCTGCGCCG 0: 1
1: 0
2: 2
3: 32
4: 285
Right 1131171939 15:90184983-90185005 CGCCGGGCCGGCCTGGCAAGGGG 0: 1
1: 0
2: 0
3: 15
4: 129
1131171929_1131171937 -7 Left 1131171929 15:90184965-90184987 CCGGGTCCCCAGGGGCTGCGCCG 0: 1
1: 0
2: 2
3: 32
4: 285
Right 1131171937 15:90184981-90185003 TGCGCCGGGCCGGCCTGGCAAGG 0: 1
1: 0
2: 1
3: 15
4: 194
1131171929_1131171945 18 Left 1131171929 15:90184965-90184987 CCGGGTCCCCAGGGGCTGCGCCG 0: 1
1: 0
2: 2
3: 32
4: 285
Right 1131171945 15:90185006-90185028 GACGAGTCAGTGGACACTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131171929 Original CRISPR CGGCGCAGCCCCTGGGGACC CGG (reversed) Intronic
900109736 1:1000391-1000413 CCGCCCAGCCCCGGGGGTCCCGG - Intergenic
900301552 1:1980528-1980550 CTGCGCAGGCGCTGAGGACCGGG + Intronic
900368214 1:2320088-2320110 CGGGGCAGCCCCTGGGCACATGG - Intergenic
900483180 1:2909243-2909265 CTGCCCAGCCCCTGGGCGCCTGG - Intergenic
900525224 1:3125264-3125286 CGGCCCAGCCCCTGGGCTCTGGG + Intronic
900824253 1:4913534-4913556 CGGCCCATCCCCTGGTGACCGGG + Intergenic
900992493 1:6104421-6104443 CCGGGCTGCCCCTGGGGGCCTGG - Exonic
901700951 1:11044580-11044602 GGGCTCAGCCTCTGGGGACCTGG + Intronic
903455436 1:23484017-23484039 CAGCGCCGCCCCTCGGTACCGGG + Exonic
904428381 1:30446319-30446341 CCCCGAAGCCCCTGGGGAACAGG - Intergenic
904697462 1:32338251-32338273 CAGGGCATCCCCTGGGGACCAGG - Intergenic
906534707 1:46545002-46545024 TGCCCCAGCCCCTGGGAACCAGG + Intergenic
907288229 1:53395868-53395890 CTGCGCAGGCACTGGGGACAAGG - Intergenic
909352749 1:74673660-74673682 CGCCGCCGCCCCTGGGCGCCCGG + Exonic
910231993 1:84997153-84997175 CGGGGCAGCCCCTTGGGGGCGGG - Intergenic
910413571 1:86972655-86972677 GGGCGCATCCCCTGGGGATAGGG + Intronic
912559106 1:110537575-110537597 GGGCTCAGGCCCTGGGAACCAGG + Intergenic
914984182 1:152442107-152442129 GGGGGCAGCACCTGGGGGCCAGG + Intergenic
915110911 1:153564228-153564250 CTGCGCAGGCTCTGGGGAGCAGG + Intronic
916414036 1:164576388-164576410 CGGCGCCGCGCCGGCGGACCGGG - Intronic
916651682 1:166839648-166839670 CGGCCCAGCCGCCCGGGACCCGG - Intronic
916963206 1:169909773-169909795 CCGGGCAGCCCGTCGGGACCTGG + Intergenic
919926370 1:202193894-202193916 CGGTGCAGCCCGCCGGGACCGGG + Exonic
920703218 1:208233444-208233466 CTGTGCAGTCCCTGGGGGCCAGG - Intronic
922119093 1:222644508-222644530 CGCCGCTACCCCGGGGGACCCGG + Intronic
922583951 1:226719885-226719907 AGGCTGAGTCCCTGGGGACCCGG + Intronic
922883201 1:228998258-228998280 CGGCCCAGCACATGGGGAGCGGG - Intergenic
924225376 1:241917628-241917650 CGGCGGAGCACCTCGGGACCTGG - Intergenic
1066370485 10:34815077-34815099 CGGAGGAGCCGCTGGGGACTCGG + Exonic
1067089747 10:43260529-43260551 TGGCCCTGCCCGTGGGGACCAGG - Intronic
1074752652 10:116601643-116601665 CGAGGCAGCCCCTGGGCATCAGG - Intronic
1075754779 10:124801988-124802010 CGGCTCGCCCCCTGGGCACCAGG + Intronic
1076130398 10:128010098-128010120 CTGGGCAGCCCCTGGGTGCCAGG + Intronic
1076175689 10:128366218-128366240 GTGGGCAGCCCCTGCGGACCAGG + Intergenic
1076702848 10:132283164-132283186 TGGCGCAGTCCCTGGGGCCTGGG - Intronic
1077358209 11:2128290-2128312 AGGGGCAGACCCTGGGGGCCAGG + Intergenic
1080386261 11:31812888-31812910 CGCCGCAGCCCCTGGCAGCCGGG + Intronic
1080595891 11:33774235-33774257 CTGCGGAGCCACCGGGGACCGGG - Intronic
1081686004 11:45043433-45043455 CAGCCCAGCCCCTGAGCACCAGG + Intergenic
1083668040 11:64285877-64285899 CGGCTCAGGTCGTGGGGACCCGG - Intronic
1084117110 11:67048940-67048962 AGGAGCAGACCCTGGGGCCCTGG - Exonic
1084190056 11:67494699-67494721 CTGCCCCGCCCCTGGGGTCCTGG - Intronic
1084810218 11:71607491-71607513 AGGCGCCGCCCGCGGGGACCAGG + Intergenic
1084958096 11:72702182-72702204 CGGCGCTGACCGTGGGGAACAGG - Intronic
1085305044 11:75481208-75481230 CGGTGCAGCCCCTGGGGCCTTGG - Intronic
1085400077 11:76230590-76230612 AGGGTCAGCCCCTGGGGAGCAGG + Intergenic
1087078873 11:94150891-94150913 TGGAGGAGCTCCTGGGGACCAGG - Intronic
1089397517 11:118145802-118145824 CCTCTCTGCCCCTGGGGACCAGG - Intronic
1090450271 11:126800090-126800112 GGGCCCAGCCCCTGGAGATCTGG - Intronic
1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG + Exonic
1092940782 12:13405187-13405209 CAGAGCAGCCTCTGGGCACCAGG + Intergenic
1095942797 12:47737660-47737682 CGGAGCAGTCCCTGAGCACCCGG - Exonic
1101969979 12:109306071-109306093 CTGGGCAGCACCTGGGCACCTGG + Intronic
1102036159 12:109771589-109771611 CACCCCAGCCCCTGGGGAGCAGG + Intergenic
1103474803 12:121210425-121210447 CGGCGCGGCGGCTGGGGCCCAGG - Intronic
1103809966 12:123605451-123605473 GAGCTCAGGCCCTGGGGACCAGG + Intronic
1103856348 12:123973173-123973195 CGGGGAAGCCCCGGGGGAGCGGG - Exonic
1104549113 12:129739690-129739712 TGGTGCAGTCCATGGGGACCAGG - Intronic
1104930412 12:132336575-132336597 CGGCTCTGCGCCTGGGGCCCGGG + Intergenic
1104930429 12:132336618-132336640 CGGCTCTGCTCCTGGGGCCCGGG + Intergenic
1107017709 13:35721088-35721110 CGGTCCAGTCCCTGGGGACTGGG + Intergenic
1109872121 13:68345690-68345712 TGCCTCAGCCCCTGGGGAGCTGG - Intergenic
1113539459 13:111095101-111095123 GGGGGCAGGCCCTGTGGACCTGG + Intergenic
1113799161 13:113077634-113077656 CGGCCCAGACCCTGGGCTCCAGG + Intronic
1114458466 14:22872219-22872241 CGGCGGAGCCCCGGGCGCCCAGG - Exonic
1115942637 14:38626925-38626947 CCCCACAGCCACTGGGGACCAGG - Intergenic
1117029399 14:51652497-51652519 CGGCGCAGCCCCCGGGAGCGCGG - Intronic
1118404982 14:65413405-65413427 TGGCGCAGCCCCGGGGGCGCGGG + Intronic
1118568827 14:67172495-67172517 CAGCTCAGGCCCTGGGGACATGG - Intronic
1119557782 14:75566897-75566919 CTGCTCAGCCCCTTGGGACCGGG - Intergenic
1119765884 14:77187443-77187465 CGGCTCAGCCCCTCGGAACCTGG - Intronic
1121108538 14:91296456-91296478 CAGCACAGCCCCTGGGGGCGAGG + Intronic
1122204839 14:100143216-100143238 CAGGGCAGTCCCTGGGGTCCAGG + Intronic
1122418449 14:101561226-101561248 AGCCGCTGCCGCTGGGGACCGGG - Intergenic
1122657913 14:103274158-103274180 GGGCCCAGCCCCTGGGGCCTCGG - Intergenic
1122833903 14:104421670-104421692 CTGGGCAGCTCCTGGGCACCTGG - Intergenic
1123009064 14:105338514-105338536 CTGCACAGCCCCCAGGGACCTGG - Intronic
1123041008 14:105490244-105490266 AGGCGCAGCCCGAGGGGTCCCGG - Intronic
1123441613 15:20295594-20295616 CGGCGCAGCCCGGGAGGATCAGG + Intergenic
1125516414 15:40323682-40323704 CCGCGCGGCCACTGGAGACCAGG + Intergenic
1127953605 15:63833874-63833896 CGCCGCAGCCTCTGCGGAGCCGG - Exonic
1128866072 15:71115832-71115854 CGGCGCAGCCCGCGGCGCCCCGG - Intronic
1130295840 15:82646911-82646933 CGGAGCAGCGGCTGGGGCCCTGG - Intronic
1131171929 15:90184965-90184987 CGGCGCAGCCCCTGGGGACCCGG - Intronic
1132800218 16:1748356-1748378 CAGCCCAGGCCCTGGGGTCCTGG + Intronic
1132978417 16:2721575-2721597 CTGGGCAGCCCCTGGGGGTCTGG + Intergenic
1133033631 16:3023066-3023088 CCCAGGAGCCCCTGGGGACCTGG - Intronic
1133052294 16:3124136-3124158 CGGCGCTGCCCCTCTGGGCCGGG + Intergenic
1133281875 16:4671251-4671273 CAGCTCAACCCCTGGGGGCCAGG - Intronic
1133729705 16:8569104-8569126 CAGCACTGCCCCAGGGGACCCGG + Intergenic
1133816069 16:9198453-9198475 CGGCACATGCCCTGGGGACCTGG + Intergenic
1133972286 16:10577037-10577059 GGTCCCAGGCCCTGGGGACCTGG + Intronic
1134222142 16:12363169-12363191 TGGGGTATCCCCTGGGGACCCGG - Intronic
1134573199 16:15309394-15309416 CAGCGCAGCAGCTGGGGCCCTGG - Intergenic
1134729185 16:16446564-16446586 CAGCGCAGCAGCTGGGGCCCTGG + Intergenic
1134938250 16:18265300-18265322 CAGCGCAGCAGCTGGGGCCCTGG - Intergenic
1135607422 16:23836376-23836398 CGGCGCTGCCCTCGGGGGCCCGG - Intronic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1136289237 16:29261654-29261676 GGACGCAGCCCGTGGGGAGCTGG + Intergenic
1136412709 16:30086327-30086349 CGGTGGAGCCGCTGGGTACCCGG + Exonic
1136501191 16:30670308-30670330 GGGGGCAGGACCTGGGGACCTGG + Exonic
1136686113 16:31995888-31995910 CCCGGCAGCCCCTGGGGCCCAGG + Intergenic
1136786726 16:32939417-32939439 CCCGGCAGCCCCTGGGGCCCAGG + Intergenic
1136883046 16:33914373-33914395 CCCGGCAGCCCCTGGGGCCCAGG - Intergenic
1138265475 16:55656849-55656871 ACGCGCAGCCCCGGGAGACCTGG + Exonic
1141054909 16:80804942-80804964 CCGCGCAGCCCCGAGGGGCCAGG - Intergenic
1141132232 16:81444585-81444607 AGGGGCAGCCCCTGGGGAGGGGG - Intergenic
1141699028 16:85634017-85634039 CGGGGCTGCCGCTGGGCACCAGG - Exonic
1142094972 16:88234611-88234633 GGACGCAGCCCGTGGGGAGCTGG + Intergenic
1142150093 16:88508878-88508900 CCGCGGGGCCCCTGAGGACCTGG - Intronic
1203088962 16_KI270728v1_random:1201087-1201109 CCCGGCAGCCCCTGGGGCCCAGG + Intergenic
1142486774 17:252635-252657 CGGCGCTGCCCGTGAGGACGAGG - Intronic
1142762374 17:2050106-2050128 CCTCGCAGCCCCTAGGGACCCGG + Intergenic
1142764298 17:2056983-2057005 CGGCTCAGCCCCCGGGGCCACGG - Exonic
1143543421 17:7582768-7582790 CGGCGCAATCCCTGGGAGCCAGG + Intergenic
1143631385 17:8142357-8142379 CGGGGCTGAGCCTGGGGACCAGG - Exonic
1143724034 17:8833147-8833169 CTCCGCTGCCCCTGGGGGCCCGG + Intronic
1143725418 17:8841813-8841835 CAGCACAGCAACTGGGGACCTGG - Intronic
1144211270 17:13017638-13017660 CGGCGCAGCCTCTGAGCATCGGG - Intronic
1144573732 17:16416256-16416278 GGGACCAGGCCCTGGGGACCCGG - Intronic
1144787506 17:17840200-17840222 CGGCGCAGCCAATGGGCGCCCGG + Intergenic
1144850386 17:18241151-18241173 AGGCAGAGCCCCTGGGGACTGGG - Intronic
1145912905 17:28552652-28552674 CGGGGCAGTACCTGGGGCCCCGG - Exonic
1146889679 17:36498331-36498353 TGGGGCTGCCCCTGGGGAGCTGG + Exonic
1147134883 17:38428831-38428853 CTGCCCAGCCGCTGGGGGCCTGG - Intronic
1147147075 17:38491556-38491578 CCCGGCAGCCCCTGGGGCCCAGG + Intronic
1147442137 17:40453804-40453826 CTGCCCAGCCCCTGGGGCTCAGG + Intronic
1147572344 17:41579155-41579177 CCCCCCAGCCCCTGGGGATCAGG + Intergenic
1148591119 17:48817288-48817310 CGGTCCAGCCCCTGGCGCCCGGG - Intergenic
1151826666 17:76527699-76527721 CAGGGCAGCCCCGGGGGATCCGG - Exonic
1151940412 17:77288302-77288324 CAGCGCTGCACCTGGGAACCAGG + Intronic
1152017102 17:77757926-77757948 AGGGGCTCCCCCTGGGGACCAGG + Intergenic
1152531719 17:80922868-80922890 CAGCTCAGCCCGTGGGGCCCCGG - Intronic
1152552214 17:81035444-81035466 CGGCGCGGCCACCCGGGACCCGG + Intronic
1152567387 17:81106387-81106409 GGGGGCAGCTCCTGGGGGCCAGG + Intronic
1152900264 17:82937067-82937089 TGGCACAGCCGCTAGGGACCAGG + Intronic
1152929372 17:83102039-83102061 CGGAACAGCCCCTTGGGGCCAGG + Intergenic
1152945507 17:83195570-83195592 CGGCCAAGCCCCTGTGGCCCAGG + Intergenic
1160024938 18:75209245-75209267 CGGCGCAGCCCCCGCGAACCCGG + Exonic
1160610558 18:80081634-80081656 CGGCTCTGCCCCTGGACACCAGG + Intronic
1160775550 19:853484-853506 CGGGGCCGCTCGTGGGGACCTGG + Intronic
1160793519 19:933592-933614 CGGGGCAGCCCCTTCGGCCCTGG + Intronic
1161429637 19:4224198-4224220 TGGCCCAGCTCCTGGGTACCCGG + Intronic
1161500204 19:4610313-4610335 GGGCAGAGCCCCTGGGGATCAGG + Intergenic
1162300600 19:9842754-9842776 CGGCGCAGGCATTGGGCACCTGG + Intronic
1162428552 19:10612620-10612642 CGCTGCAGCCCTTGGGGACTTGG + Intronic
1162445071 19:10718027-10718049 GGGCGCAGCCCCCGGGGCCGGGG + Intergenic
1163122106 19:15224114-15224136 CCTCGCAGCCCCTGGCGATCTGG + Intergenic
1163446411 19:17349030-17349052 CAGCCCATCCCCTGGGGTCCTGG - Intergenic
1163662838 19:18588939-18588961 CGGCGCAGACCCAGGGGCGCGGG + Intronic
1163687345 19:18719328-18719350 TGCTGCAGGCCCTGGGGACCCGG - Intronic
1163697041 19:18769223-18769245 GGGCACAGCGCCTGGGGCCCAGG + Intronic
1163715628 19:18870548-18870570 CGGCCCCGCCCCCGTGGACCCGG - Exonic
1165076136 19:33280973-33280995 AGGAGCTGCCCCTGGTGACCTGG - Intergenic
1165080409 19:33303146-33303168 CGGCGCCGCCCATGGGACCCCGG - Intergenic
1165243202 19:34482784-34482806 AGGTGCATCCCCTGGGGACTGGG + Intronic
1165247287 19:34504925-34504947 AGGCGCAGCCTGTGGGGCCCAGG + Exonic
1165432607 19:35781146-35781168 CAGCGCAGCACCTGGGGCACTGG - Exonic
1165467503 19:35983726-35983748 CTGCCCAGCCCTTGGGGTCCTGG + Intergenic
1166337378 19:42116684-42116706 AAGGGCAGCCACTGGGGACCAGG - Intronic
1167103405 19:47417513-47417535 CGAGGCAGCTCCAGGGGACCTGG - Intronic
1167557120 19:50203532-50203554 CGGCCCCGCCCCTGGGGGACGGG - Intronic
925426302 2:3751409-3751431 CGGAGCTGCACCTGGGGAGCTGG - Intronic
925686852 2:6481916-6481938 AGGCACAGGCCCTGGGGAGCTGG + Intergenic
926796654 2:16625232-16625254 CAGCCCAGCCTCTGGGGGCCTGG - Intronic
927210937 2:20638627-20638649 CCCTGCAGCCCCTGGGGATCTGG + Exonic
929075433 2:38076000-38076022 CCCCGCTGCCCTTGGGGACCTGG + Exonic
933759104 2:85662046-85662068 CATCCCAGCCCCTGGGCACCAGG + Exonic
934724589 2:96607581-96607603 CCGCGCAGACCCTTGGGGCCTGG + Intronic
935375155 2:102388172-102388194 GGGAGCTGCCCCTGGGCACCAGG - Intronic
940883256 2:158968340-158968362 AGGCGCAGCCCCGGGGGACCCGG + Intergenic
946410945 2:219514902-219514924 CTGCGCAGTCCGTGGGGGCCTGG - Exonic
947917812 2:233845527-233845549 TGGCGCTGCCCTGGGGGACCTGG + Intronic
948094857 2:235325377-235325399 AGCAGCAGCCCGTGGGGACCAGG + Intergenic
948116007 2:235494581-235494603 CGCCGCAGCCCCCGGGGAGCCGG - Exonic
948807554 2:240459559-240459581 GGCCACTGCCCCTGGGGACCAGG + Intronic
1171959843 20:31485698-31485720 CGCCCCAGCCCCGGGGGACGCGG + Intergenic
1172118720 20:32585495-32585517 CGGCCCGGCCCCTGGGGGCGCGG + Intronic
1175520984 20:59602828-59602850 CAGGACAGCCCCTGGGGACTTGG + Intronic
1175864716 20:62169138-62169160 GAGCGCAGCCCCTCGTGACCTGG + Intronic
1175875776 20:62228539-62228561 CAGGGCAGCTCCTGGGGACCTGG + Intergenic
1176293463 21:5058595-5058617 AGGCACAGGCCCTGGGGGCCTGG + Intergenic
1176547574 21:8208352-8208374 CGGCGCGCGCCTTGGGGACCGGG + Intergenic
1176555479 21:8252559-8252581 CGGCGCGCGCCTTGGGGACCGGG + Intergenic
1176566525 21:8391399-8391421 CGGCGCGCGCCTTGGGGACCGGG + Intergenic
1176574401 21:8435586-8435608 CGGCGCGCGCCTTGGGGACCGGG + Intergenic
1176611013 21:8986878-8986900 CGGCGCGCGCCTTGGGGACCGGG + Intergenic
1177779982 21:25611758-25611780 GGGAGCAGCCCCTGGGAAGCAGG + Intergenic
1178485877 21:33020016-33020038 CTGCGCAGCCCCGCGGGGCCGGG + Intergenic
1178922591 21:36748123-36748145 CGCCGCAGCCCCGGGAGGCCGGG - Exonic
1179863797 21:44205053-44205075 AGGCACAGGCCCTGGGGGCCTGG - Intergenic
1180233506 21:46442376-46442398 CCTCGCTGCCCATGGGGACCAGG - Intronic
1181019262 22:20090191-20090213 TGAGGCAGCCCCTGGGGCCCTGG + Exonic
1181084241 22:20431963-20431985 CAGCGCAGCACGTGGGCACCTGG + Exonic
1181512419 22:23394845-23394867 CAGCGCAGCCACTGGGCATCTGG - Intergenic
1181577621 22:23805341-23805363 CAGGACAGCCCATGGGGACCAGG + Intronic
1181941764 22:26483490-26483512 GGGCGCAGCCCCCGGGGCGCAGG + Intronic
1182146943 22:28002351-28002373 TTGCGCAGGCCCTGTGGACCTGG - Intronic
1182318350 22:29462720-29462742 CTTGGCAGCCCCTGGGAACCAGG + Intergenic
1182427845 22:30284283-30284305 CCGCCCTGCTCCTGGGGACCAGG - Intergenic
1182442166 22:30370974-30370996 TGGCAGAGCCCCTGGGCACCAGG - Intronic
1183313566 22:37124835-37124857 CCGGGCAGCCGCTGGGGCCCTGG - Intergenic
1183477222 22:38042320-38042342 AGTCACAGCCCCTGGGCACCTGG - Intergenic
1183702525 22:39458059-39458081 CGTAGCTACCCCTGGGGACCAGG + Intronic
1183856255 22:40636891-40636913 CGGCGCAGCCAATGGGCAACGGG + Intergenic
1184036569 22:41920820-41920842 CGGCCAGGGCCCTGGGGACCTGG + Intergenic
1184465838 22:44668628-44668650 CGCCGCAGCCCCCAGGGACTCGG - Intronic
1184674276 22:46032075-46032097 CGGCCCAGCCCCGGGGGAGGAGG + Intergenic
1184759492 22:46536750-46536772 CCGCGCAGCCGCCGGGGACGGGG + Exonic
1184807323 22:46803460-46803482 CGCCTCAGCTCCTGGGGGCCGGG - Intronic
1185085169 22:48737047-48737069 GAGCAGAGCCCCTGGGGACCAGG - Intronic
1185227089 22:49659415-49659437 CGGCCCTGCCCCTCGGGACTAGG - Intergenic
1185287797 22:50010334-50010356 CGGGGCAGCCTCTGGGGAACGGG + Intronic
1185400202 22:50611585-50611607 ATGGGCAGCCCCTGGGCACCTGG - Intronic
1185420193 22:50730761-50730783 CAGCGCAGCCCCGGGGGCCCGGG + Intergenic
1203252447 22_KI270733v1_random:124637-124659 CGGCGCGCGCCTTGGGGACCGGG + Intergenic
1203260504 22_KI270733v1_random:169723-169745 CGGCGCGCGCCTTGGGGACCGGG + Intergenic
952316651 3:32238332-32238354 CGGCGGAGTCCCTGGAGGCCTGG + Intergenic
954420512 3:50416589-50416611 CTGCACAGCCCCTGGGGCCCAGG - Intronic
956468558 3:69542275-69542297 CCGCGCGGGACCTGGGGACCCGG + Intronic
956613376 3:71146848-71146870 GGGCACAGCCCCTGGGGACTAGG - Intronic
957083355 3:75658091-75658113 CGGAGCACCCCGTGGGAACCCGG + Intergenic
960684799 3:120285419-120285441 CGGGGCCGCCCCAGGGGACTCGG - Intergenic
960970314 3:123134811-123134833 CGGCCCAGCTCCTGGGGGACAGG - Intronic
961077065 3:123992160-123992182 CGGCGCTACCCCTGGTGACCTGG - Intronic
961141751 3:124562139-124562161 AGGCTCAGGCACTGGGGACCAGG - Intronic
961307511 3:125969140-125969162 CGGCGCTACCCCTGGTGACCTGG + Exonic
961469538 3:127102727-127102749 GGGCGCAGCCCTTCGTGACCCGG + Intergenic
961754703 3:129121118-129121140 CGGCCCAGACCCCGGGGCCCAGG + Intronic
961754789 3:129121456-129121478 GGGCCCAGGCCCGGGGGACCCGG - Exonic
961821348 3:129577247-129577269 AGGAGCAGGCCCTGGGGAGCAGG + Intronic
965494590 3:169382328-169382350 CGGAGCAGCACCTGGGGAGGTGG + Intronic
966732553 3:183162858-183162880 CGGCGCAGCCGCCGGGGCCCGGG + Exonic
967970963 3:194999197-194999219 CGACCCAGCCCCAGGGGACACGG + Intergenic
968225541 3:196969870-196969892 CGCCGCAGCTCGCGGGGACCTGG - Intergenic
968512273 4:1000996-1001018 GAGCGCAGGCCCTGGGGCCCTGG + Intronic
968628327 4:1637872-1637894 CAGTGCAGCCCCTGGGTCCCTGG - Intronic
968945158 4:3659823-3659845 CAGGGAAGCCACTGGGGACCTGG - Intergenic
969231062 4:5831618-5831640 CTGGCCAGCCCTTGGGGACCTGG + Intronic
969356884 4:6633205-6633227 CAGCACAGCCCCTGGACACCTGG - Intergenic
969617668 4:8262914-8262936 CGGGGCTGACCCTGGGGCCCTGG - Intergenic
970433747 4:16012999-16013021 AGGCGCACACTCTGGGGACCTGG + Intronic
975556817 4:75673369-75673391 CGTCGCAGCGCCTGGCGCCCGGG - Exonic
975671745 4:76787276-76787298 CAGCACAGCCCCTGGGGAATCGG + Intergenic
977666104 4:99649327-99649349 CTTCGCAGCCCCTGGGGCCACGG - Exonic
981093326 4:140755805-140755827 TCGCCCAGCCCCAGGGGACCGGG + Intronic
986074412 5:4319851-4319873 CGGAGCAGACCCCGGGGACCAGG - Intergenic
986721191 5:10563019-10563041 TGGCGCAGCCGCTGGGGACCAGG - Intergenic
992042372 5:72848548-72848570 CGGCCCAGCCCCCGGCGGCCGGG + Intronic
994072771 5:95620614-95620636 CCGCGCGGCCACGGGGGACCTGG + Exonic
994679275 5:102865619-102865641 CGGCGCAGCCCCTGTAGAGCCGG - Intronic
997266290 5:132496985-132497007 CGGCGCGGCCCCGCGGAACCCGG - Intergenic
997351823 5:133236466-133236488 TGTCTCAGCCCCTGGGGAACTGG - Intronic
998407682 5:141883216-141883238 CTGGGCAGCCCCCGGGGACCCGG + Intergenic
998435907 5:142108769-142108791 CGACGCGGCCCCTGGGGAAGAGG - Exonic
999111005 5:149121398-149121420 AGGGGGAACCCCTGGGGACCAGG + Intergenic
999265642 5:150265109-150265131 CAGGGCAGCCCCTGGGGGCTGGG + Intronic
1001561260 5:172670343-172670365 CGCGGCGCCCCCTGGGGACCTGG + Intronic
1002431604 5:179207410-179207432 CGGCAGAGCCTCAGGGGACCTGG + Intronic
1003084961 6:3053693-3053715 CGGCTCCGCCCTGGGGGACCAGG + Intergenic
1003272080 6:4616039-4616061 TGCCCCAGCCACTGGGGACCAGG + Intergenic
1003859499 6:10309166-10309188 CAGAGCAGCACTTGGGGACCAGG - Intergenic
1007169108 6:39850033-39850055 AGCCCCAGCCCCAGGGGACCTGG + Intronic
1007625390 6:43243629-43243651 CGGCGCATCCCCCGGGGCCGGGG - Intergenic
1013538769 6:111087619-111087641 CGGCGGAGCCCCTGGCGGGCGGG - Exonic
1018423769 6:163662479-163662501 CACTGCAGCCTCTGGGGACCGGG + Intergenic
1018618122 6:165707247-165707269 CCACCCATCCCCTGGGGACCAGG - Intronic
1019248280 6:170724218-170724240 CAGTGCAGCCTCTGGGGTCCTGG + Intergenic
1019475529 7:1242397-1242419 AGGCGCAGCCTGTGGGGGCCGGG - Intergenic
1019613593 7:1948809-1948831 AGGCACAGCCCCTGGAGCCCAGG - Intronic
1019985367 7:4651500-4651522 CCTCACAGCCCCTGGGGACCAGG + Intergenic
1020309117 7:6855570-6855592 AGGCGCCGCCCCCGGGGCCCAGG - Intergenic
1022099796 7:27162160-27162182 CGGAGAAGCCCCTGAGGAGCTGG - Intergenic
1022134165 7:27431822-27431844 CAGGGCAGTCCCTGGGGACTTGG - Intergenic
1022943188 7:35258362-35258384 AGGCGCCGCGCCTTGGGACCCGG - Intergenic
1024224513 7:47315349-47315371 CGGGGCAGCCCCCCGGGACCGGG + Intronic
1025029874 7:55548383-55548405 GGGCGGAGCCTCTGAGGACCAGG - Intronic
1025940946 7:66075927-66075949 GAGCGCAGCCCTTGGGGACGCGG - Intronic
1027138256 7:75639352-75639374 CGCCCGAGCCCCCGGGGACCGGG + Intronic
1027200605 7:76061763-76061785 AGGCGCAGCCCCTGGCGTCCTGG + Intronic
1029285892 7:99465922-99465944 TGGCGCAGGCCCTGGGCAGCAGG + Intronic
1029524865 7:101088318-101088340 CAGGGCTGCCCCTGGGCACCAGG + Exonic
1029569992 7:101363006-101363028 CGCAGCAGCCCGCGGGGACCCGG - Exonic
1034242957 7:149624096-149624118 CCGCGCCGACCCTGGGGAGCTGG + Intergenic
1034269709 7:149797647-149797669 CCGGGAAGCCCCTGGGGACCCGG - Intergenic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1035762495 8:2079638-2079660 CTGCTCAGCCCCTGGGGATTTGG + Intronic
1038295941 8:26291354-26291376 CGGCGCAGGCCCTGCCGGCCGGG + Intergenic
1039414344 8:37380559-37380581 AGAAGCAGCCCCTGAGGACCAGG + Intergenic
1045007429 8:97928558-97928580 TGGCTCAGCCCCTGGGGCTCAGG + Intronic
1047097840 8:121642796-121642818 CAGGTCAGCCCCTGGGGACTGGG - Intergenic
1049599316 8:143499732-143499754 CCACGGAGGCCCTGGGGACCGGG + Intronic
1049659016 8:143811457-143811479 CCTCACAGCCCCTGGAGACCGGG + Intronic
1053350429 9:37410418-37410440 AGGCTCAGACCCTGTGGACCTGG + Intergenic
1053527651 9:38846142-38846164 TGGAGCAGCACCTGGAGACCAGG + Intergenic
1054199877 9:62070571-62070593 TGGAGCAGCACCTGGAGACCAGG + Intergenic
1054638479 9:67517786-67517808 TGGAGCAGCACCTGGAGACCAGG - Intergenic
1057024595 9:91725451-91725473 CGGGGCAGCCCCAGGGCAGCTGG - Intronic
1057076583 9:92141339-92141361 CGGCGCAGCCCGCCGGGACCGGG + Intergenic
1057198513 9:93128181-93128203 CAGCGCTGTCCCTGGGGCCCTGG + Intronic
1057228832 9:93306601-93306623 CGGGGCAGCCCCTGGAGAGAGGG - Intronic
1057665233 9:97039340-97039362 CCGCGCAGCCCCCGGGCGCCCGG - Intronic
1057757849 9:97852139-97852161 CGGCGCGGCCCCTCTGGCCCGGG - Intergenic
1058825760 9:108774747-108774769 CGGCTCAGCAAGTGGGGACCAGG - Intergenic
1058885954 9:109321057-109321079 CGGCGCAGCCCCGAGGGAGGAGG - Intergenic
1059349504 9:113654479-113654501 GGGCGTGGCCCCTGGGTACCAGG - Intergenic
1060087247 9:120714116-120714138 CGGCCCAGGCCCCGAGGACCGGG - Exonic
1061208517 9:129177638-129177660 CCGCGCAGCCCCTGGGCGCCGGG + Exonic
1061378684 9:130241337-130241359 CAGGGCAGCCCCTGAGGACCGGG + Intergenic
1062272020 9:135714140-135714162 CGGCAAAGACCCTGGGGACGGGG + Intronic
1062309331 9:135927471-135927493 GGGTGCAGCCCCTGGGGACAAGG - Intergenic
1062457559 9:136646697-136646719 CTCCACAGCCCCTGGGGTCCTGG + Intergenic
1203468852 Un_GL000220v1:107788-107810 CGGCGCGCGCCTTGGGGACCGGG + Intergenic
1203476673 Un_GL000220v1:151760-151782 CGGCGCGCGCCTTGGGGACCGGG + Intergenic
1186638134 X:11427762-11427784 CTGCGGAGCCGGTGGGGACCTGG + Intronic
1189325263 X:40107731-40107753 CGGCGCGGGCCCTGGGGTGCGGG + Intronic
1190264233 X:48817878-48817900 CCGGGCAGCCCTTGGGAACCAGG + Intronic
1192139732 X:68637471-68637493 TGGCTCAGCCCCTTGGGGCCTGG + Intergenic
1192341720 X:70268622-70268644 AGGCCTAGCCCCTGGGGACCTGG + Intronic
1195942125 X:110175333-110175355 GGGAGGAGCCCCTGGGGGCCTGG + Exonic