ID: 1131172021

View in Genome Browser
Species Human (GRCh38)
Location 15:90185252-90185274
Sequence TGCCATGGCAACAGGCTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 1, 2: 1, 3: 31, 4: 248}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131172021_1131172033 16 Left 1131172021 15:90185252-90185274 CCGGGGAGCCTGTTGCCATGGCA 0: 1
1: 1
2: 1
3: 31
4: 248
Right 1131172033 15:90185291-90185313 CCGCGTTCCCATGGCCACCGGGG 0: 1
1: 0
2: 1
3: 2
4: 73
1131172021_1131172027 -8 Left 1131172021 15:90185252-90185274 CCGGGGAGCCTGTTGCCATGGCA 0: 1
1: 1
2: 1
3: 31
4: 248
Right 1131172027 15:90185267-90185289 CCATGGCAGCGCAGGAGGCTGGG 0: 1
1: 0
2: 2
3: 31
4: 265
1131172021_1131172034 17 Left 1131172021 15:90185252-90185274 CCGGGGAGCCTGTTGCCATGGCA 0: 1
1: 1
2: 1
3: 31
4: 248
Right 1131172034 15:90185292-90185314 CGCGTTCCCATGGCCACCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 58
1131172021_1131172029 14 Left 1131172021 15:90185252-90185274 CCGGGGAGCCTGTTGCCATGGCA 0: 1
1: 1
2: 1
3: 31
4: 248
Right 1131172029 15:90185289-90185311 GCCCGCGTTCCCATGGCCACCGG 0: 1
1: 0
2: 0
3: 12
4: 90
1131172021_1131172031 15 Left 1131172021 15:90185252-90185274 CCGGGGAGCCTGTTGCCATGGCA 0: 1
1: 1
2: 1
3: 31
4: 248
Right 1131172031 15:90185290-90185312 CCCGCGTTCCCATGGCCACCGGG 0: 1
1: 0
2: 1
3: 7
4: 110
1131172021_1131172025 -9 Left 1131172021 15:90185252-90185274 CCGGGGAGCCTGTTGCCATGGCA 0: 1
1: 1
2: 1
3: 31
4: 248
Right 1131172025 15:90185266-90185288 GCCATGGCAGCGCAGGAGGCTGG 0: 1
1: 0
2: 3
3: 42
4: 355
1131172021_1131172028 7 Left 1131172021 15:90185252-90185274 CCGGGGAGCCTGTTGCCATGGCA 0: 1
1: 1
2: 1
3: 31
4: 248
Right 1131172028 15:90185282-90185304 AGGCTGGGCCCGCGTTCCCATGG 0: 1
1: 0
2: 0
3: 8
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131172021 Original CRISPR TGCCATGGCAACAGGCTCCC CGG (reversed) Intronic
900410003 1:2508129-2508151 GGCCTTGGGACCAGGCTCCCTGG - Intergenic
900524768 1:3123225-3123247 TGCCTTGGTATCAGGTTCCCAGG + Intronic
900932544 1:5746250-5746272 TGTCATGGCCAGAGGATCCCTGG - Intergenic
901236148 1:7668660-7668682 TCCCATGGCAACAGCCCGCCTGG - Intronic
901637967 1:10679215-10679237 TGGCAGGGCAGCAGGCTCCCAGG - Intronic
903369271 1:22824842-22824864 TGCCCTGGCCACAGGTGCCCTGG - Intronic
904484582 1:30816327-30816349 TACCATGGCGACGGGCTCCATGG - Intergenic
906777874 1:48546053-48546075 TGACAGTGCAACAGCCTCCCAGG - Intronic
907454217 1:54564855-54564877 TGCCATGGCATTAAGCTACCTGG - Intronic
910169581 1:84363089-84363111 TGCCATGGAAACTGCCTCCCCGG + Intronic
910655123 1:89610672-89610694 TCCCAGGGCAGCAGGCTCCAGGG + Intergenic
912572352 1:110633798-110633820 GGCCTTGGCACCTGGCTCCCAGG - Intergenic
916664148 1:166950309-166950331 TCCCATGGCAACAGCCTCCTTGG - Intronic
922806613 1:228393582-228393604 TGCCCCGTCAACAGCCTCCCTGG + Intergenic
1063123899 10:3123820-3123842 TGCCATGGCCAGAGCCTGCCAGG + Intronic
1063372366 10:5530200-5530222 TTCCATAGCAACAGGTTCTCAGG + Intergenic
1064409972 10:15096819-15096841 TTCCATGGCGACGGGCTCACTGG + Exonic
1064568995 10:16672975-16672997 GGCCCTGGAAACAGGCTGCCTGG - Intronic
1067063532 10:43090346-43090368 TGCCAACCCAAGAGGCTCCCGGG - Intronic
1067090141 10:43262275-43262297 TGCCATGGCAACCAGATCCAGGG + Intronic
1068386544 10:56335715-56335737 TGCCCTGGCACCAGGCTTCAAGG - Intergenic
1069058174 10:63866281-63866303 TGGCATAGCCACAGTCTCCCTGG - Intergenic
1069527133 10:69182228-69182250 GGCCATGGCAGGAGGATCCCTGG - Intronic
1069957781 10:72062222-72062244 TGCAATGGGGACAGGCTCGCAGG + Exonic
1070060938 10:72981989-72982011 TGCAATGGCTACTGGCCCCCAGG + Intergenic
1071140304 10:82501591-82501613 GGCTAAGGCAAGAGGCTCCCCGG - Intronic
1071918270 10:90320759-90320781 AGCCATGGCATCAGACTCCTGGG + Intergenic
1072231824 10:93420337-93420359 TGCCATGGTAACAGGTTTTCAGG + Intronic
1072231837 10:93420392-93420414 TGTCATGGGAACAGTCTTCCAGG + Intronic
1072671224 10:97431093-97431115 GCCCATGGCAACAGCCTCCGGGG + Exonic
1072708253 10:97697815-97697837 TGCCAGGCCTCCAGGCTCCCAGG - Intergenic
1072712241 10:97723384-97723406 AGTCATGGAAACAGGCTCACAGG + Intergenic
1073592607 10:104771161-104771183 TGCCTTTCCAACAAGCTCCCAGG - Intronic
1074230057 10:111524723-111524745 GACCATGCCAACAGGCTTCCTGG + Intergenic
1074540857 10:114364250-114364272 GGCCATGGATACAGGCCCCCAGG - Intronic
1076017541 10:127040135-127040157 TTCCCTGCCAACAGGCTCCCAGG - Intronic
1076556212 10:131322932-131322954 TGCCAGGGCAGGAGGCTGCCCGG + Intergenic
1076905552 10:133359011-133359033 TCCCATGGGGACAGGCTCCTAGG - Intergenic
1077870580 11:6259055-6259077 TGCCAGGGAAAAGGGCTCCCGGG - Intergenic
1080883632 11:36345668-36345690 TGCCAGGGCAAGAGGCACCTTGG - Intronic
1082269799 11:50157708-50157730 TTCCATGGCAGAAGGCTCCAGGG + Intergenic
1082677255 11:56120885-56120907 TGCCTTGGCAAATGGCCCCCAGG + Intergenic
1083821701 11:65175225-65175247 GCCCATGGCAACAGCCTCCGGGG - Intergenic
1084716931 11:70880071-70880093 TGCCAGGGCTCCAAGCTCCCCGG + Intronic
1085181947 11:74543525-74543547 TGCCAGTGCAACAAGCCCCCTGG + Intronic
1085294858 11:75425601-75425623 GGCCCTGGCACCCGGCTCCCCGG - Intronic
1085689211 11:78651902-78651924 TGCAATGATAACAGGTTCCCAGG - Intergenic
1086719406 11:90101498-90101520 TGCCCGGACCACAGGCTCCCCGG + Intergenic
1087135304 11:94710615-94710637 TCCCAAAGCCACAGGCTCCCTGG + Intronic
1088604358 11:111514007-111514029 TGCCATGACAAAAATCTCCCGGG + Intergenic
1088788185 11:113201272-113201294 TGCCATGGTGACCGGCTCGCAGG - Intronic
1089781408 11:120875569-120875591 TGCCTTGCCAGCAGGCTCCCTGG - Intronic
1090242683 11:125195087-125195109 AGACATGGAAACAGACTCCCTGG - Intronic
1090263024 11:125335253-125335275 GGCCATGGTTTCAGGCTCCCAGG + Intronic
1090303284 11:125667086-125667108 TGCCTTGGTAACAGGATCACTGG - Intronic
1090433310 11:126664735-126664757 TGTCATTGAAACAGCCTCCCAGG - Intronic
1090825398 11:130381597-130381619 TTCCATGGCAAGTAGCTCCCTGG - Intergenic
1091332108 11:134737845-134737867 AGCCATGGCACATGGCTCCCAGG - Intergenic
1091980735 12:4861789-4861811 TGCCATGGCATAAGCATCCCTGG + Intergenic
1097622195 12:61953162-61953184 TCCCATGGCAATAGGTTCTCAGG - Intronic
1097978726 12:65715307-65715329 TGCCCTAGCCACAGCCTCCCAGG + Intergenic
1099077645 12:78130926-78130948 TGCCAAGGCAGCAGCCTCCAAGG + Intronic
1100337019 12:93641012-93641034 GCCCATGGCAACAGCCTCCGGGG - Intergenic
1100391188 12:94147903-94147925 TCCCTTGGCAACAGAGTCCCAGG - Intergenic
1100553865 12:95672856-95672878 GCCCATGGCAACAGCCTCCGGGG + Intronic
1101350991 12:103930004-103930026 TGCCATGGCTACCGTTTCCCCGG + Intergenic
1101361443 12:104031331-104031353 GCCCATGGCAACAGCCTCCGGGG + Intronic
1101427870 12:104602616-104602638 TGCCATGGCAACAGCCTCAGTGG + Intronic
1101639797 12:106579669-106579691 TGCCTTGACACCAGCCTCCCAGG + Intronic
1102826745 12:115953185-115953207 TGTCATAGCAACAGGCTGCTGGG + Intergenic
1103362413 12:120361879-120361901 TGCCATGGCAACCGGGCCCCAGG - Intronic
1103950995 12:124550896-124550918 TGCCATGGGAAGGGGCTGCCGGG - Intronic
1104365713 12:128174705-128174727 TGCCATGGCAACACCATGCCTGG + Intergenic
1105576940 13:21662348-21662370 TGCCAGGGCAACTGCTTCCCTGG + Intergenic
1110056951 13:70985635-70985657 AGCCATGGCAAAAGGATCCAGGG - Intergenic
1116019208 14:39441079-39441101 TGCGGGGGCAAGAGGCTCCCTGG - Intergenic
1117759850 14:59015354-59015376 TGCCATGAGGACAGGTTCCCTGG - Intergenic
1117823901 14:59680086-59680108 TCCCATGGCAACAGGTACCATGG - Intronic
1119165741 14:72490970-72490992 TGCATTGCTAACAGGCTCCCAGG + Intronic
1119184362 14:72629508-72629530 TGCCAGGGTAACAGGCCCCAGGG + Intronic
1119204323 14:72782929-72782951 TCCCATGGCTACAGGTCCCCAGG + Intronic
1119551514 14:75517387-75517409 TGACATGGCAACTGGCTCCCTGG - Intergenic
1119615508 14:76096243-76096265 CCCCAGGGCAACAGGCACCCAGG + Intergenic
1119736254 14:76984659-76984681 GGCCATGGCCACAGGCCACCAGG + Intergenic
1120950066 14:90032709-90032731 TGCTATAGTAACAGGCTGCCTGG - Intronic
1122496447 14:102159391-102159413 TGCACTTCCAACAGGCTCCCAGG - Intronic
1123403246 15:20005850-20005872 GGCTATGGCAGAAGGCTCCCAGG + Intergenic
1123512584 15:21012504-21012526 GGCTATGGCAGAAGGCTCCCAGG + Intergenic
1124604448 15:31160353-31160375 TGGGAGGGCAAGAGGCTCCCAGG - Intronic
1125534332 15:40434810-40434832 TGTCATGGGAAGAGGCTCACAGG + Intronic
1126906636 15:53375041-53375063 TGCCCTTCCAACAGGCTCTCTGG + Intergenic
1128997428 15:72307176-72307198 TTCCATGGCAGCTGCCTCCCTGG + Intronic
1130298874 15:82665510-82665532 TGCCAAGGCCACAGGCTACCAGG - Exonic
1130639125 15:85654589-85654611 AGCCAAGGCAAGAGGATCCCAGG + Intronic
1131172021 15:90185252-90185274 TGCCATGGCAACAGGCTCCCCGG - Intronic
1131287762 15:91075917-91075939 TGCCATGGAAACATGCTTCCTGG + Intergenic
1131399891 15:92116042-92116064 TGCCATGGCAGCAGGTACCAGGG + Intronic
1131820173 15:96264575-96264597 TGCATTTGCAACAGGCTCCCAGG + Intergenic
1132457041 16:29751-29773 GGCCCTGGGACCAGGCTCCCGGG - Intergenic
1132584850 16:701631-701653 AGCCATGGGAACCGGCTCCTTGG - Intronic
1135417534 16:22280142-22280164 TACCATGGCAACAGGGTGGCAGG - Intronic
1135436140 16:22427931-22427953 TCTCATGCCAGCAGGCTCCCAGG - Intronic
1135544032 16:23353964-23353986 TGTATTGACAACAGGCTCCCTGG + Intronic
1136136504 16:28259557-28259579 TGCCAGGCCCACAGGCACCCTGG - Intergenic
1136344121 16:29664235-29664257 TACCATGGCAACTGTCTCTCTGG + Exonic
1136344132 16:29664289-29664311 TACCATGGCAACTGACTCTCTGG + Exonic
1136344145 16:29664343-29664365 TACCATGACAACTGGCTCTCTGG + Exonic
1137715178 16:50594221-50594243 AGCCCTGGCATCAGGGTCCCTGG + Intronic
1137912449 16:52391867-52391889 TGCCATGGCTTCAGCCTCCATGG + Intergenic
1137968855 16:52963678-52963700 TGCCATGACAACAGGATACAGGG - Intergenic
1138036212 16:53609331-53609353 GGCCAAGGCAAAAGGATCCCTGG - Intronic
1138529672 16:57628263-57628285 TGCCACGGCAACAGGGCCCTTGG - Intronic
1139337885 16:66245751-66245773 TGCCATGGCCAGAGGTTCCCGGG + Intergenic
1139544519 16:67644033-67644055 TGAGAGGGCAACAGGCTACCAGG + Intergenic
1141040107 16:80665868-80665890 TGATGTGGCAACAGGCACCCAGG + Intronic
1141102666 16:81209377-81209399 TCCCTTGGCCACTGGCTCCCAGG + Intergenic
1141188561 16:81806957-81806979 TCCCATGGCTCCCGGCTCCCTGG - Intronic
1141787996 16:86214472-86214494 TGCATTTCCAACAGGCTCCCAGG - Intergenic
1141910897 16:87057698-87057720 CTCCATGGCAACAACCTCCCAGG + Intergenic
1142045353 16:87921762-87921784 TCTCATGCCAGCAGGCTCCCAGG - Intronic
1142121494 16:88388695-88388717 GGCCCTGGCATCAGGCTCTCCGG - Intergenic
1142121508 16:88388756-88388778 GGCCCTGGCACCAGGCTCTCCGG - Intergenic
1142121522 16:88388817-88388839 GGCCCTGGCACCAGGCTCTCCGG - Intergenic
1142121553 16:88388939-88388961 GGCCCTGGCACCTGGCTCCCCGG - Intergenic
1142605491 17:1078891-1078913 AGCCATCGCTCCAGGCTCCCCGG + Intronic
1142613860 17:1124033-1124055 TGCCATGGCAACAGAGGCCGAGG - Intronic
1143906933 17:10216452-10216474 CGTCATGGCAACATGCTCCCTGG - Intergenic
1147155990 17:38544721-38544743 TGCTCTGGCACCAGGCTCCCAGG + Intronic
1149013919 17:51886477-51886499 TGCACTGGCAATAAGCTCCCAGG + Intronic
1150003778 17:61457219-61457241 GGCCATCGCCACAGGCTCCCGGG - Intronic
1151815489 17:76469553-76469575 TGCCCTGACCACAGGCACCCAGG + Intronic
1152327015 17:79647598-79647620 TGGGATGGCCCCAGGCTCCCGGG - Intergenic
1152425535 17:80216643-80216665 CGCCATGGCCACAGTGTCCCAGG - Intronic
1153588083 18:6644601-6644623 GGCCATGAAAACAGGCTCCTGGG - Intergenic
1153996079 18:10442619-10442641 GGACATTGCAGCAGGCTCCCAGG - Intergenic
1154217221 18:12423904-12423926 GGCCATGGGAACAGTCCCCCAGG + Intronic
1158570831 18:58595860-58595882 TGCCATTCTAACAAGCTCCCAGG + Intronic
1158623197 18:59049996-59050018 TGCTCAGGCAACAGCCTCCCTGG - Intergenic
1160224946 18:77005349-77005371 CGCCATGGCAACATGGTACCTGG - Intronic
1161028037 19:2045656-2045678 TGACCTGGCATCCGGCTCCCGGG - Intronic
1163332897 19:16652602-16652624 TACCTTGGCAACAGTCTTCCTGG + Intronic
1163457807 19:17418819-17418841 TGTCATGGCAACAGGGTAACAGG - Intronic
1163734077 19:18968001-18968023 GGCCATGACGACAGGCTCTCTGG + Intergenic
1165427309 19:35753277-35753299 TGCCCTGGCACCAGGCTGCTGGG - Intronic
1165595467 19:37008722-37008744 TGCCACCGCAACGGGCACCCGGG - Intronic
1166000812 19:39876504-39876526 TGCCAAGCCACCAGGCTCCTAGG + Intronic
1166003594 19:39892757-39892779 TGCCAAGCCATCAGGCTCCTAGG + Intronic
1166377398 19:42335251-42335273 TGCCCTGGCCATAGGCTGCCGGG - Intronic
1166896903 19:46028979-46029001 GGTCAGGGAAACAGGCTCCCAGG + Intergenic
1166953757 19:46448037-46448059 TGGCCTGGGAACAGGCTTCCAGG - Intergenic
1167150776 19:47708225-47708247 AGCCATGGCAATGGGCCCCCTGG + Intergenic
1168097911 19:54125910-54125932 TGACAAGACATCAGGCTCCCTGG - Intronic
927026539 2:19074010-19074032 TGCCTTGGCCAAAGGCTCCTAGG + Intergenic
928362961 2:30680306-30680328 TGCCGTGGCAACAGTCACCTTGG + Intergenic
929439006 2:41950811-41950833 TGGCATGTCAACAGGTTCCAGGG + Intronic
929810498 2:45185404-45185426 TGCTATGGCAACAGTCTCCTTGG + Intergenic
930313804 2:49772760-49772782 TGCTGGGGCAGCAGGCTCCCTGG - Intergenic
934045899 2:88172227-88172249 TGACATGGCATCTGGCTCCTGGG + Exonic
934898825 2:98141016-98141038 TGCCTTGGCACCTGGCTCTCAGG + Intronic
935434780 2:103018130-103018152 TGCCACGAGAACATGCTCCCTGG - Intergenic
940591112 2:155728958-155728980 ACCCTTGGCAACCGGCTCCCAGG + Intergenic
942709203 2:178813714-178813736 TTCCATGGCACCAGCCTCTCTGG + Intronic
946862689 2:224015014-224015036 TGCCATGGCACCACCCTCCCTGG - Intronic
946862703 2:224015052-224015074 TGCCACGGCACCACCCTCCCTGG - Intronic
947621476 2:231593860-231593882 GGCCATAGCCACAGGCTTCCTGG + Exonic
948213766 2:236214173-236214195 TGCATTGCCAACAAGCTCCCGGG - Intronic
1169211550 20:3768463-3768485 TGCCATGGCGACCGCCTCCATGG - Intergenic
1169767897 20:9168570-9168592 TGCATTGCTAACAGGCTCCCAGG + Intronic
1170205200 20:13790544-13790566 TGCCATGACAACAGACTGTCAGG - Intronic
1170376349 20:15704628-15704650 TGCCATTCTAACAAGCTCCCAGG + Intronic
1170743196 20:19075656-19075678 AGACATGGCACCAGGCTCGCCGG - Intergenic
1171961495 20:31498024-31498046 AGTCATGGCAACAGTCTCCTTGG + Intergenic
1173065057 20:39702811-39702833 TGCAATTCCAACAAGCTCCCAGG - Intergenic
1174830693 20:53809426-53809448 GGCAATGGCAGCAGGCTGCCTGG + Intergenic
1175704657 20:61167892-61167914 TGTCATGGCATCAGGCTGACAGG - Intergenic
1175943908 20:62550091-62550113 TGCCATGCCAGCCGGCTCCTAGG - Intergenic
1177649269 21:23939597-23939619 TGCCATTGAAATAGGCTCTCTGG + Intergenic
1178590897 21:33908974-33908996 TTCACTGCCAACAGGCTCCCAGG + Intronic
1179166396 21:38938525-38938547 TACCATGGCAACAGTGTCCCTGG - Intergenic
1179391975 21:41002352-41002374 CTCCATGGCAACAGGGTTCCAGG - Intergenic
1179800928 21:43811209-43811231 TGCAGTGGGAACAGGCACCCTGG + Intergenic
1181032599 22:20155512-20155534 TTCCATGGCAACTGGCGTCCAGG - Intergenic
1181623303 22:24105619-24105641 TTCCAGGGAAACAGGCACCCTGG - Intronic
1182303474 22:29351955-29351977 TGCCATGGCTGCAAGCTCCTGGG + Intronic
1183463617 22:37968045-37968067 TTCCGTGGCAACCAGCTCCCTGG - Exonic
1183632133 22:39040138-39040160 CGCCATGGGAACACGCTACCAGG + Intergenic
1183637953 22:39076539-39076561 CGCCATGGGAACACGCTACCAGG + Intronic
1184089251 22:42283715-42283737 TGCCCTGGCCCGAGGCTCCCCGG - Intronic
1184634720 22:45817957-45817979 TACCTTAGCAACGGGCTCCCAGG + Intronic
949750143 3:7342816-7342838 TGGCATGTCAGCAGGCTGCCTGG - Intronic
949965075 3:9348989-9349011 GCCCATGGCAACAGCCCCCCGGG + Intronic
952942135 3:38453624-38453646 TGCAGTGGCCACAGGCTCCCGGG + Intergenic
953665806 3:44925650-44925672 TGCCAGGACAACAGTCTCCCAGG + Exonic
953882933 3:46700995-46701017 TGCCATGGTGACAGGCGCTCAGG - Intergenic
954492027 3:50915601-50915623 TGCCAGGGCAGCAGTTTCCCAGG + Intronic
960925700 3:122793662-122793684 AGCCATGGCAGCAGGCTCCGAGG - Exonic
961406673 3:126684642-126684664 TGCCATGGCAACTTGTTCCCTGG - Intergenic
962025803 3:131546431-131546453 TCCTATAGCAACAGACTCCCTGG + Intronic
962266672 3:133948908-133948930 GGCCAAGTCAAGAGGCTCCCTGG - Exonic
963048819 3:141124909-141124931 TGCATTTTCAACAGGCTCCCAGG + Intronic
966719340 3:183045855-183045877 TGTCATGGTATGAGGCTCCCAGG - Intronic
967267350 3:187702277-187702299 TACCATGGTAACAGGTTCCAGGG - Exonic
968453034 4:684006-684028 TGCCAGGGCCACAGGCACCACGG - Intronic
968922585 4:3530376-3530398 TGCCATAGTACCAGGCTCTCTGG + Intronic
969690041 4:8699187-8699209 TGCCCTAGCACCAGGATCCCTGG + Intergenic
971494735 4:27251774-27251796 AACCATTTCAACAGGCTCCCAGG + Intergenic
973199440 4:47483893-47483915 GGCCTTGGCATCAAGCTCCCCGG + Intergenic
975041039 4:69744210-69744232 TACCAGGGCAGCAGGCTCTCGGG + Intronic
976539668 4:86259056-86259078 TTCCAGGGCAACAGTCTCTCTGG + Intronic
976564139 4:86534017-86534039 GGTTATGGCAACAGGATCCCTGG - Intronic
982204219 4:152984892-152984914 TGCCATGAGAAGAGGCTTCCTGG + Intergenic
985521142 5:374304-374326 AGCCAGGGCAAGAGGCGCCCCGG - Intronic
985827055 5:2200289-2200311 TGCCATCTCAAGATGCTCCCCGG + Intergenic
986423783 5:7610320-7610342 TGCCCTGGCATCATGCACCCTGG - Intronic
987375653 5:17231552-17231574 AGCCATACCAACAGGCTCCCAGG + Intronic
991592227 5:68265132-68265154 TGCATTTCCAACAGGCTCCCAGG - Intronic
992952366 5:81872926-81872948 TAGTATGGCAGCAGGCTCCCCGG - Intergenic
993045162 5:82858305-82858327 TGCCTTGTTAACAAGCTCCCAGG + Intergenic
995418089 5:111932816-111932838 TGCCTTGGCAACAGAATCCCTGG + Intronic
997885959 5:137630177-137630199 AGCCCTGGCCTCAGGCTCCCAGG - Intronic
998265789 5:140666547-140666569 TGCCATGGCACCAGGTGCCATGG + Intronic
998387110 5:141763714-141763736 TGCCATGGCAACAGCCTCCCGGG - Intergenic
1003076124 6:2985175-2985197 TGCCAGGGCGGCAGGATCCCAGG - Intergenic
1006896548 6:37475064-37475086 TGCCATGGCAGCAGCCTCACTGG + Intronic
1011091480 6:83606630-83606652 TGCCAAGCCATCAGGGTCCCAGG + Intronic
1011556542 6:88575614-88575636 TGGCACGGCAACAGGCATCCAGG + Intergenic
1016390465 6:143569344-143569366 CACCATGGCAACAGTCTCCTTGG + Intronic
1016796293 6:148121465-148121487 TGACATGGCAACAGTGTCCCAGG - Intergenic
1019180734 6:170186162-170186184 TGCCATGGTCTCAGGCTGCCGGG + Intergenic
1019719345 7:2559048-2559070 TGCCATGGCAGCGGGGTCGCGGG + Exonic
1020049668 7:5073068-5073090 GGCCACGGCGACAGGCTCCGGGG + Exonic
1023421418 7:39984183-39984205 TGCCAAGGCAGGAGGATCCCTGG + Intronic
1025615798 7:63114793-63114815 GGCCATGGCCACAGGTGCCCGGG + Intergenic
1028934678 7:96451836-96451858 TGCCAAGAGAACAGGCTCCCAGG - Intergenic
1028957225 7:96707157-96707179 TGCAATTTTAACAGGCTCCCAGG + Intronic
1029127997 7:98308462-98308484 TGCCATCCCGCCAGGCTCCCAGG + Intronic
1029403911 7:100361811-100361833 TGCCAGGGAAACAGGCTCGTGGG + Intronic
1030240664 7:107319858-107319880 GGCCATGGCAGCAGGGTCACTGG + Intronic
1031344372 7:120647261-120647283 TGCACTAGCAACAGGCTGCCTGG + Intronic
1033583787 7:142759586-142759608 TGCCCTGGCAACCTGCTCTCAGG - Intronic
1034210568 7:149358877-149358899 TCCCAGGGCAGCAGGCTCCGGGG + Intergenic
1034377315 7:150657497-150657519 TGCAATGGCAACCTGCTCTCAGG - Intergenic
1034417198 7:150971401-150971423 TGCCATGGTAACAGGGTCAGAGG - Intronic
1035083575 7:156237180-156237202 TGCCCGGGCACCAGGCTGCCAGG + Intergenic
1035680528 8:1484161-1484183 TGCCAAGGCCACAGCCTCCTGGG + Intergenic
1036224558 8:6946576-6946598 AGCCTAGGCATCAGGCTCCCAGG + Intergenic
1037521377 8:19683313-19683335 TGCCATGACAACTGGCCCCCAGG - Intronic
1038705072 8:29885896-29885918 TGCCATGGCAACAGTCACCATGG + Intergenic
1039966276 8:42286428-42286450 TGCCATGGGAACAGCCACACTGG + Intronic
1041006772 8:53503300-53503322 TGCGTTGTCGACAGGCTCCCAGG - Intergenic
1045921295 8:107532725-107532747 TACCCTGGCAACAGGCACCATGG - Intergenic
1049276176 8:141721153-141721175 AGCCATGGCCACAGGCTCCAAGG - Intergenic
1053288453 9:36864715-36864737 AGCCCTGGCGGCAGGCTCCCAGG - Intronic
1054892268 9:70263725-70263747 TACCCTGGCCTCAGGCTCCCTGG + Intronic
1056224752 9:84483869-84483891 TGCCATGACAGCAGGAACCCCGG - Intergenic
1056274361 9:84978957-84978979 TGCTATTGCAACATGCTGCCTGG + Intronic
1056320553 9:85430962-85430984 TGCCATGGAAACCAGCTCCCTGG + Intergenic
1056338450 9:85601080-85601102 CGCCTTGCAAACAGGCTCCCAGG + Intronic
1056706107 9:88953865-88953887 TGCCAGGGCAGCTGGGTCCCAGG + Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1056898332 9:90572874-90572896 TGCATTTCCAACAGGCTCCCAGG + Intergenic
1057796738 9:98163101-98163123 TGCCATGGGATTAGGCTCCGGGG + Intronic
1059299252 9:113299075-113299097 TGCCATGGAGACAGGCCCCTGGG - Exonic
1060059800 9:120448906-120448928 AGTCATGGCAACAGTCTCCTGGG + Intronic
1060379246 9:123150712-123150734 AGTAATGTCAACAGGCTCCCAGG + Intronic
1061152189 9:128835239-128835261 TGCCCAGGCAAGAGGCTCCTGGG - Intronic
1062281413 9:135753590-135753612 TGTGCTGACAACAGGCTCCCAGG - Intronic
1062629680 9:137458250-137458272 TGGCATGGCAACAGGCCTCCTGG - Intronic
1185566579 X:1099651-1099673 GGCCAGGGCCACAGGCTACCAGG - Intergenic
1187649760 X:21389739-21389761 TGGCCTGGCATCAGGATCCCTGG + Intronic
1188380592 X:29486983-29487005 TGCCTTTCCAACAAGCTCCCAGG + Intronic
1189996797 X:46646772-46646794 GCCCATGGCAACAGCTTCCCCGG - Intronic
1190436603 X:50431805-50431827 TGCCATGTCAACAGGACCCTGGG - Intronic
1192196812 X:69034097-69034119 TGCCATGGCAATGGCCTGCCAGG - Intergenic
1192551834 X:72060771-72060793 TGCCATGGCAACGGGCAGCTGGG - Intergenic
1193135736 X:77969064-77969086 GCCCATGGCAACAGCCTCCAGGG - Exonic
1195311838 X:103639121-103639143 TGCCATGACAACAGTATCCAGGG - Intergenic
1195701341 X:107707978-107708000 TGCCCTGGGGACAGCCTCCCAGG + Intergenic
1196855198 X:119976118-119976140 GGCCATGGCAGGAGGCTCACTGG - Intergenic
1198690585 X:139279989-139280011 TGCAATTCTAACAGGCTCCCAGG - Intergenic
1200399320 X:156009975-156009997 GGCCCTGGGACCAGGCTCCCGGG + Exonic
1201943467 Y:19484102-19484124 TGCCTTGGCAAATGGCACCCTGG + Intergenic