ID: 1131172926

View in Genome Browser
Species Human (GRCh38)
Location 15:90191196-90191218
Sequence GGCCCCAGTGGGGGTGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 0, 2: 6, 3: 68, 4: 501}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131172911_1131172926 11 Left 1131172911 15:90191162-90191184 CCCTCCCAGGGAGTGGCCAGCTC 0: 1
1: 0
2: 1
3: 27
4: 861
Right 1131172926 15:90191196-90191218 GGCCCCAGTGGGGGTGGTGCTGG 0: 1
1: 0
2: 6
3: 68
4: 501
1131172912_1131172926 10 Left 1131172912 15:90191163-90191185 CCTCCCAGGGAGTGGCCAGCTCA 0: 1
1: 0
2: 1
3: 15
4: 186
Right 1131172926 15:90191196-90191218 GGCCCCAGTGGGGGTGGTGCTGG 0: 1
1: 0
2: 6
3: 68
4: 501
1131172906_1131172926 30 Left 1131172906 15:90191143-90191165 CCTGTGGGGCGGAGGGATCCCCT 0: 1
1: 0
2: 1
3: 7
4: 118
Right 1131172926 15:90191196-90191218 GGCCCCAGTGGGGGTGGTGCTGG 0: 1
1: 0
2: 6
3: 68
4: 501
1131172917_1131172926 -5 Left 1131172917 15:90191178-90191200 CCAGCTCAGGCCCCAACAGGCCC 0: 1
1: 0
2: 5
3: 59
4: 500
Right 1131172926 15:90191196-90191218 GGCCCCAGTGGGGGTGGTGCTGG 0: 1
1: 0
2: 6
3: 68
4: 501
1131172915_1131172926 6 Left 1131172915 15:90191167-90191189 CCAGGGAGTGGCCAGCTCAGGCC 0: 1
1: 0
2: 3
3: 29
4: 366
Right 1131172926 15:90191196-90191218 GGCCCCAGTGGGGGTGGTGCTGG 0: 1
1: 0
2: 6
3: 68
4: 501
1131172914_1131172926 7 Left 1131172914 15:90191166-90191188 CCCAGGGAGTGGCCAGCTCAGGC 0: 1
1: 1
2: 1
3: 20
4: 259
Right 1131172926 15:90191196-90191218 GGCCCCAGTGGGGGTGGTGCTGG 0: 1
1: 0
2: 6
3: 68
4: 501
1131172910_1131172926 12 Left 1131172910 15:90191161-90191183 CCCCTCCCAGGGAGTGGCCAGCT 0: 1
1: 0
2: 2
3: 26
4: 283
Right 1131172926 15:90191196-90191218 GGCCCCAGTGGGGGTGGTGCTGG 0: 1
1: 0
2: 6
3: 68
4: 501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131172926 Original CRISPR GGCCCCAGTGGGGGTGGTGC TGG Intronic
900176913 1:1295075-1295097 GGGCCCACTGCGGGGGGTGCCGG - Intronic
900191688 1:1354790-1354812 GGCCACAGTAATGGTGGTGCAGG + Exonic
900340607 1:2187086-2187108 GGCCTGCGTGGGCGTGGTGCGGG + Intronic
900345568 1:2208744-2208766 GGCCCCAGAGGGGTTTGGGCCGG + Intronic
900353155 1:2246871-2246893 GGCCACAGTGGGCGAGGTGGAGG - Intronic
900409911 1:2507812-2507834 GACCCCAGCGGGGGTGGGGGTGG + Intergenic
900546207 1:3230673-3230695 GGCCCCGGTTGGGGTGAGGCAGG + Intronic
900792159 1:4687851-4687873 GGCCTCTGTGTGGGAGGTGCTGG + Intronic
900962270 1:5932536-5932558 GGCCCCATTGGCGGTGTTGGAGG - Intronic
901237848 1:7677031-7677053 AGCCCCAGTGGGTGTTGAGCTGG - Intronic
902285908 1:15408993-15409015 GGCCCCAGTGGTTCTGATGCTGG + Intergenic
902329655 1:15725093-15725115 GGCCCCAGGGGTGGTGGAGATGG + Intronic
902770427 1:18642717-18642739 GGCCCCGGCTGGGGTGGAGCAGG + Intronic
903173808 1:21569119-21569141 GGCCCCCGTGGGGATGGTGGGGG + Intronic
903476429 1:23622186-23622208 GGCCTCAGTGGTGCTGGTGAAGG - Intronic
903560032 1:24220277-24220299 GGCCCCTGAGGAGGTGGTGCGGG - Intergenic
903817518 1:26075592-26075614 GGCCCAAGGGGTGGTGATGCTGG + Intergenic
904285619 1:29451672-29451694 GCCCCCACTGGGGGTGGGGAGGG - Intergenic
904400763 1:30254905-30254927 GGGCCAAGTGGGGGTGAAGCTGG + Intergenic
905089624 1:35418486-35418508 GGTTCCAGTGGGGGTGGAGATGG + Exonic
905809612 1:40902515-40902537 GGCCACAGTGGGGCTGGTTCTGG + Intergenic
906510447 1:46407668-46407690 GTCCCCAGTGAGGCAGGTGCTGG + Intronic
907306303 1:53514924-53514946 GGCCCCAGTGAGGGAGGTGCTGG + Intronic
908538747 1:65103153-65103175 AGCCCCAGTGGCGGTAGTGGTGG + Intergenic
909739126 1:79006662-79006684 GGCCGCAGTGGTGGCGGTGGCGG + Exonic
910209541 1:84779071-84779093 GGACCCAGTGGGGGTGGGGAGGG - Intergenic
911055185 1:93702541-93702563 GGCCCAGGTGGGGGTGGGGATGG + Intronic
911116075 1:94247709-94247731 GGCCGCTGTGGTGGTGGTGGTGG - Intronic
912422044 1:109548991-109549013 GGCCCCAGAGGGCGTGATGAGGG + Intronic
912764348 1:112395698-112395720 AGCGCCTGTGGGCGTGGTGCTGG - Intergenic
913132959 1:115859414-115859436 GGCAACAGTGGTGGTGGTGGTGG + Intergenic
914329005 1:146648663-146648685 GACCCCGCTGGGGGTGGGGCTGG - Intergenic
914717073 1:150262219-150262241 GACCCCAGTGCAGGTGGAGCTGG - Exonic
914802808 1:150973478-150973500 GGCCCCAGTGAGGGAAGTGGGGG + Intronic
914948005 1:152083152-152083174 AGCTCCAGTGGCAGTGGTGCTGG - Intergenic
915001726 1:152600380-152600402 GGCAGCAGTGGGGGAGGTGATGG + Intronic
915299701 1:154945026-154945048 AGCCCCGGTGGTGGTGGTGGTGG + Exonic
915380232 1:155433521-155433543 GGCACCAGGGGGGACGGTGCAGG - Intronic
916643529 1:166758365-166758387 GGCACAAGTGGTGGTGGTGGTGG + Intergenic
917991013 1:180378835-180378857 GTCCCCACTGGTGGTGGTGGTGG - Intronic
919220682 1:194624920-194624942 AGCCCCAGTGGGGGCGGGGGTGG + Intergenic
919414848 1:197295256-197295278 GGCCTGAGTGAGGGTGGTGCTGG + Intronic
919913906 1:202128557-202128579 GGCCCCAGTAGGGGTGGGGAGGG + Exonic
920022519 1:202966862-202966884 GGCCTCCCTGGGGGTGGGGCTGG - Exonic
920031532 1:203040304-203040326 TGACCCAGTGGGGGCGCTGCTGG + Intronic
920230826 1:204468712-204468734 GGCCCTGGTGGGGGAGGTCCAGG - Intronic
920352464 1:205346459-205346481 TGCCCCAGCTGGGGTGGTGAAGG - Intronic
921219532 1:212963322-212963344 GGCCCCAGTGGGCAGGGGGCTGG - Intronic
922427717 1:225514846-225514868 GGCCCTGGTGGGAGTGGTGGAGG + Exonic
922615803 1:226960597-226960619 GGCGGCAGTGGCGGTGGTGATGG + Intronic
923148424 1:231213839-231213861 GGCCACCGTGGGCGTGCTGCTGG + Exonic
924263400 1:242254682-242254704 AGCCTCAGTGGTGGTGGTGGTGG - Intronic
1062853101 10:760217-760239 GGCCCCAGTGGTGGCAGTGGGGG - Intergenic
1062944914 10:1452966-1452988 GGCCTCAGTGGGGTTGGGCCGGG + Intronic
1063187227 10:3662666-3662688 GGCCCCAGTGGGATTGGAGAAGG + Intergenic
1064042734 10:11982418-11982440 GGAGCCAGTGGGCCTGGTGCAGG - Intronic
1065023059 10:21516763-21516785 GGGCCCGGTGGTGGTGGTGGTGG + Exonic
1065484196 10:26221468-26221490 GGTGCTAGTGGTGGTGGTGCTGG + Intronic
1066721395 10:38343790-38343812 AGCCTCAGTGGTGGTGGTGGTGG + Intergenic
1067446456 10:46351127-46351149 GGCCCCTGTGGAGCTGGTGGTGG - Intergenic
1067590926 10:47509640-47509662 GGCCCCTGTGGAGCTGGTGGTGG + Intronic
1067638045 10:48017740-48017762 GGCCCCTGTGGAGCTGGTGGTGG + Intergenic
1069386155 10:67884883-67884905 GGCCCCAGAGCGTGAGGTGCCGG + Exonic
1069707396 10:70467394-70467416 GGTCCCAGTGGTGGAGGTGGGGG + Intergenic
1069896676 10:71684425-71684447 GTCTCCAGGGGGGGTGGAGCAGG - Intronic
1070134645 10:73682163-73682185 GGCCCCTGTGGAGCTGGTGGTGG + Intronic
1071603510 10:86970312-86970334 GGCCCCAGCCGGGATGGGGCGGG - Intronic
1071676336 10:87659571-87659593 GGACCCTCTGGGGGTGGGGCGGG + Intergenic
1072784324 10:98269517-98269539 GGGCCCAGCTGGGGTGGGGCAGG - Intergenic
1073071790 10:100798873-100798895 TGCCGCCGTGGGGGTGGGGCTGG + Intronic
1073426686 10:103459321-103459343 GGCTGCAGTGAGGGTGCTGCTGG + Intergenic
1073828517 10:107355036-107355058 GGCCCCAGTGGTGGTAGTGGTGG - Intergenic
1074855963 10:117473662-117473684 GGAGCCAGTGGGGATGGAGCAGG + Intergenic
1074865471 10:117542282-117542304 TGCCCCGGAGGGAGTGGTGCTGG + Intergenic
1075402670 10:122172377-122172399 AGCCCCAGGAAGGGTGGTGCTGG - Intronic
1076252187 10:128993720-128993742 GGACCCAGAGGGGCTGGAGCAGG - Intergenic
1076526420 10:131115251-131115273 GGCTCCAGGGGAGGTGCTGCCGG - Intronic
1076574021 10:131452005-131452027 GGAGCCTGTGGGGGTGGTGGAGG - Intergenic
1076873892 10:133206599-133206621 GGCCCCAGTGGGGTGGGGCCTGG + Intronic
1076904589 10:133355694-133355716 GGCCCCAGTGGGGATGGGGCAGG + Intronic
1077099993 11:818468-818490 GCCCCCAGTAGGGCTGGGGCAGG + Intergenic
1077187787 11:1243197-1243219 GGCCACAGTTGTGGTGGTGGTGG - Exonic
1077188210 11:1244868-1244890 GGCCACAGTTGTGGTGGTGGTGG - Exonic
1077188743 11:1246968-1246990 GGCCACAGTTGTGGTGGTGGTGG - Exonic
1077189165 11:1248639-1248661 GGCCACAGTTGTGGTGGTGGTGG - Exonic
1077189732 11:1250838-1250860 GGCCACAGTTGTGGTGGTGGTGG - Exonic
1077269059 11:1666547-1666569 GGCCCCTGGGTGGGTGGTGGGGG - Intergenic
1077271489 11:1684168-1684190 GGCCCCTGGGTGGGTGGTGGGGG + Intergenic
1077319493 11:1934927-1934949 GGCCCCAGGGCCGGAGGTGCCGG - Intronic
1077415063 11:2420994-2421016 GCCCCCAGCGGTCGTGGTGCTGG + Intronic
1077477073 11:2795573-2795595 AGCCCCAGTGGGTGTGGGGTAGG - Intronic
1077870595 11:6259105-6259127 GGCGGGAGTGGGGGTGGGGCCGG - Intergenic
1078105487 11:8355625-8355647 GGCCCCAGAGGCTGTGCTGCTGG - Intergenic
1078390324 11:10931280-10931302 GGAGCCCGTGGTGGTGGTGCTGG + Intergenic
1079129701 11:17740374-17740396 TGCCCCAGAGGAGGTGATGCTGG + Intronic
1081600370 11:44488536-44488558 GGTGCCACTGGGGCTGGTGCTGG - Intergenic
1081778890 11:45696261-45696283 GGCAGCAGTGGTGGTGGTGGTGG - Intergenic
1083505790 11:63156413-63156435 TGCCCCAGTGGGGGAGTTGCAGG - Intronic
1083624227 11:64063870-64063892 AGCCCCAGAGAGGGTGGTGGAGG + Intronic
1083719544 11:64597636-64597658 GGCCCCGGTGGGTGTAGGGCAGG + Intronic
1083776933 11:64898603-64898625 TGCCCCAGGGTGGATGGTGCAGG + Intronic
1083895751 11:65618940-65618962 GGCCCAGGTTGGGGTGGAGCAGG + Exonic
1084114454 11:67033605-67033627 GAGCCCAGAAGGGGTGGTGCTGG - Intronic
1084425415 11:69081507-69081529 GGGGCGAGTGGGGGTGGGGCCGG - Intronic
1084612148 11:70210067-70210089 GGCCCCACTGGGAGTGGGGGTGG - Intergenic
1084732719 11:71083717-71083739 GGCCACAGGGGGTGTGGTCCTGG - Intronic
1085013767 11:73159323-73159345 GGCCTCAGTGGGGATGGTGTGGG - Intergenic
1085024850 11:73230386-73230408 GGCCACAGTGGAGGTGGGACTGG - Intronic
1085095874 11:73760499-73760521 GGCCGCACCGGGGGCGGTGCGGG + Intronic
1086338282 11:85821939-85821961 GGCCCCAGTGCTGGTGTGGCTGG - Intergenic
1086753539 11:90529738-90529760 GGCCACAGTGGGGCAGGGGCAGG - Intergenic
1087556656 11:99729887-99729909 GGGGCCTGTGGGGGTGGTGGTGG + Intronic
1089489119 11:118870711-118870733 GGCTACTGTGGGGGTGCTGCTGG - Intergenic
1089493912 11:118899175-118899197 GCCCCCACTGGGGGTGGGGGCGG - Exonic
1090394654 11:126410879-126410901 CTCCCCAGAGGAGGTGGTGCTGG + Intronic
1091283211 11:134394048-134394070 GGCCCGGGAGGCGGTGGTGCTGG - Intronic
1091764098 12:3107091-3107113 GGCAGCAGTGGTGGTGGTGGCGG - Intronic
1092396829 12:8134489-8134511 GGCACCAGAGGGGACGGTGCAGG + Intronic
1093181589 12:15972782-15972804 GGGATCAGTGGGAGTGGTGCGGG + Intronic
1095638372 12:44457645-44457667 GGCCCCAGGGGTGGGGGTGGTGG + Intergenic
1096182881 12:49560149-49560171 GGCCCCAGTGGGAGGGGAGGGGG + Intronic
1096981074 12:55728557-55728579 GGCCCCAGAGGCGGCGGGGCGGG - Intronic
1098114750 12:67163055-67163077 GTACCCAGTGGGGGTTGTGAAGG + Intergenic
1099034816 12:77573084-77573106 GGACCCAGTAGCGATGGTGCTGG + Intergenic
1100088087 12:90936328-90936350 TGCTCCAGTGGAGGTGGTGGTGG + Intronic
1100266235 12:92978898-92978920 GGCACTAGTGGGGGTGGGGTGGG - Intergenic
1100611491 12:96194787-96194809 GGGCGCGGTGGGGGTGGGGCGGG + Intronic
1102419069 12:112789801-112789823 TGCCTCAGTGGTGGTGGTGGTGG - Intronic
1103565683 12:121814295-121814317 GGCTGCGGTGGGGGTGGTGGTGG - Exonic
1103927995 12:124434229-124434251 CTCCCCAGTGGGGGTGAGGCAGG + Intronic
1103928696 12:124437725-124437747 GGCCCCAGGGTGGGTGGGGGTGG - Intronic
1104467100 12:128999545-128999567 GGCCCCACTGGGGCTGGGACCGG - Intergenic
1104958729 12:132478220-132478242 GGCCCCTGTGGGCATCGTGCGGG - Intergenic
1105072428 12:133242858-133242880 GGCTCAGGTGGGGGTGCTGCAGG - Intergenic
1106130764 13:26937481-26937503 GGCCCCTGTGGTGGTGGTGGGGG - Intergenic
1106353406 13:28956417-28956439 ACCTCCAGTGGGGGTGGAGCAGG - Intronic
1106556194 13:30810524-30810546 GGGCTCAGGGAGGGTGGTGCCGG - Intergenic
1106566906 13:30893593-30893615 GGAGCCATTGGGGGTGGTGTAGG - Intergenic
1107172847 13:37363422-37363444 GTCCCCAGTGGGGATGGTCATGG + Intergenic
1109215295 13:59583061-59583083 GCCCTCAGTGGGGGTGGTCCTGG - Intergenic
1112210538 13:97373010-97373032 GGCCCCAGTGTGGGAGGAGTAGG + Intronic
1113412153 13:110100084-110100106 ATCCACAGTGGGGGTGGTGGTGG - Intergenic
1113848917 13:113407096-113407118 GGTCCCAGTGGGGATGATGCAGG + Intergenic
1115747189 14:36449731-36449753 GGCACAGGTGGGAGTGGTGCTGG + Intergenic
1118558880 14:67056797-67056819 GCCCACAGTGGGGGTGGGGGGGG + Intronic
1119264092 14:73253973-73253995 GGCCCGCATGGGGCTGGTGCTGG + Intronic
1119438497 14:74612698-74612720 GGCCGGAGCGGGGGTGGCGCGGG + Intergenic
1119748582 14:77061849-77061871 GGCGGGAGTGGGGGTGGGGCTGG + Intergenic
1121321643 14:92995055-92995077 GCTCCCAGTGGTGGTGGTGGTGG - Intronic
1121338251 14:93090126-93090148 GGCCCAAGTGGTGGGGGTGAGGG - Intronic
1121558541 14:94857014-94857036 GGCCAGAGTGGGAGTGGTGAGGG + Intergenic
1122306914 14:100772265-100772287 GGGCGCAGAGTGGGTGGTGCAGG + Intergenic
1122552527 14:102557586-102557608 GGCCCTAGTGAGAGTGGGGCTGG - Intergenic
1122632370 14:103112793-103112815 GGTGCCGGTGGGGGTGGGGCTGG + Intergenic
1122920912 14:104879756-104879778 GGCCCCTGTGGGGGGCGTGAGGG + Intronic
1123714091 15:23013878-23013900 AGCCCCAGTGGCTGGGGTGCAGG - Intronic
1123849748 15:24342862-24342884 GGGCGGAGTGGGGGTGGTGGTGG - Intergenic
1124045961 15:26149825-26149847 GGGGCCTGTGGGGGTGGGGCGGG - Intergenic
1124223402 15:27869257-27869279 GGCCGCTGTGGGGGTGCTGAGGG - Intronic
1124566910 15:30824477-30824499 GGCCCGACTGGGGGTGGTAGTGG + Intergenic
1124954036 15:34348187-34348209 TGCCTCAGTGGGGCTGGGGCTGG + Exonic
1125476990 15:40054382-40054404 GGCCTCAGTGGGGGCTGAGCAGG - Intergenic
1126744985 15:51817364-51817386 AGCCCCAGTGGGCGTGTTGCAGG + Intergenic
1127047559 15:55043187-55043209 GGTACCAGTGGTGGTGGTGGTGG + Intergenic
1128849914 15:70943928-70943950 GGCTCCAGTGGGGCTGGAGAGGG - Intronic
1129129859 15:73483958-73483980 GGCCCCAGGGGAGTTGGTGGGGG - Intronic
1129157721 15:73729088-73729110 GGCCCCAGTGTGTGCGGTGAGGG + Intergenic
1130604857 15:85306857-85306879 GGCCCCTGTGGGAGTTGTGGAGG - Intergenic
1131172926 15:90191196-90191218 GGCCCCAGTGGGGGTGGTGCTGG + Intronic
1131559773 15:93429529-93429551 AGCCCCTGTGGGGCTGGTGGTGG + Intergenic
1132255709 15:100373933-100373955 GACCCCAGTGGGGTGGGGGCGGG + Intergenic
1132484001 16:180908-180930 GGCCCCGGCGGGGTGGGTGCGGG + Intronic
1132613451 16:828938-828960 GGCCCCAGTGGGCGGGATGTCGG - Intergenic
1132613459 16:828959-828981 GGCCCCAGTGGGCGGGATGTGGG - Intergenic
1132613468 16:828980-829002 GGCCCCAGTGGGCGGGATGTGGG - Intergenic
1132777558 16:1604141-1604163 GGCAAAAGTGGGGTTGGTGCTGG + Intronic
1132889639 16:2197249-2197271 TCCCTCAGTGGGGGTGGTGGGGG - Intergenic
1133040582 16:3058266-3058288 CGCCCAGGTGAGGGTGGTGCAGG + Exonic
1133521713 16:6564718-6564740 TTCCCCAGTGTGGGTGGTGATGG + Intronic
1134062269 16:11206287-11206309 GGCCCCAGTGGGGCTGCTATGGG + Intergenic
1134521058 16:14919432-14919454 GGCCCCTCGGGGGGTGGGGCAGG - Intronic
1134708734 16:16318083-16318105 GGCCCCTCGGGGGGTGGGGCAGG - Intergenic
1134950871 16:18350562-18350584 GGCCCCTCGGGGGGTGGGGCAGG + Intergenic
1136070249 16:27783103-27783125 GGGCCCAGTGGGCGTGGAGCTGG + Intergenic
1136577701 16:31134163-31134185 GGCCTCAATGGGGGTGGGGCTGG - Intronic
1136716630 16:32287772-32287794 GGCCACGGTGAGGGTGATGCAGG + Intergenic
1136835010 16:33494017-33494039 GGCCACGGTGAGGGTGATGCAGG + Intergenic
1137323684 16:47411694-47411716 GGCTCCAGTGGGGGTCCTGGCGG - Intronic
1137582902 16:49644884-49644906 GGCACCAGTGGGAGTCATGCTGG + Intronic
1137585144 16:49659812-49659834 GGCACCCCTGTGGGTGGTGCTGG + Intronic
1137697009 16:50468288-50468310 GGCCCGGGTGGGGGTGGGGCGGG + Intergenic
1137785135 16:51132218-51132240 GGCCACATTGGGGTTGGTGGGGG + Intergenic
1138582866 16:57952963-57952985 GCCCCCAGGAGGCGTGGTGCAGG + Intronic
1139170916 16:64628231-64628253 AGCCCCAGTGGGGGTGTTACAGG - Intergenic
1140004561 16:71062280-71062302 GACCCCGCTGGGGGTGGGGCTGG + Exonic
1141311802 16:82920621-82920643 GGCCCCACTGTGGATGGTGCTGG + Intronic
1142006449 16:87691600-87691622 GACCCCTCTGGGGGTGGGGCTGG - Intronic
1142010569 16:87711838-87711860 GGCCCAAGGGGGGCTGGTGCAGG - Intronic
1142033013 16:87847715-87847737 GGTCACAGTGGGGGTGGGGAGGG + Intronic
1142146872 16:88496459-88496481 GGAGTCAGTGGGGGTGGGGCGGG - Intronic
1142193059 16:88726676-88726698 GGCCCCAGGGCGGTGGGTGCGGG + Intronic
1142267348 16:89070725-89070747 GGCGGCAGCGGGGGTGGTGAGGG - Intergenic
1142401485 16:89860948-89860970 GGCACCAGTGGTGGAGCTGCTGG + Intronic
1142416596 16:89946734-89946756 GGCCCCGGTGGGGGTGGGCCTGG + Intergenic
1203009793 16_KI270728v1_random:230015-230037 GGCCACGGTGAGGGTGATGCAGG - Intergenic
1203145180 16_KI270728v1_random:1794338-1794360 GGCCACGGTGAGGGTGATGCAGG + Intergenic
1142670561 17:1485807-1485829 GGCCCGGGTGGGGGCGGTGCGGG - Intronic
1143089344 17:4439804-4439826 GGACCCAGTGGGGCTGGAGCTGG - Intronic
1143624706 17:8103260-8103282 GCCACCAGTAGGGGTGGTGGTGG - Intronic
1144208563 17:12996101-12996123 AGCCGCAGTGGGGGTGGCACAGG + Intronic
1144639939 17:16931596-16931618 GGCCCCAGGAGTGGTGGTGCTGG - Intronic
1144780837 17:17807646-17807668 TGCCCCATGTGGGGTGGTGCTGG + Intronic
1144825818 17:18105170-18105192 GGCCCCAGGGGAGGTGGTCTGGG + Intronic
1145799564 17:27674188-27674210 GGCTACAGTGTGGGCGGTGCTGG - Intergenic
1146300462 17:31685357-31685379 GGGTCCAGTGTGGGTAGTGCCGG - Intergenic
1146576826 17:34001444-34001466 GGGTCCAGTGGGGCTGGTGCTGG + Intronic
1146627473 17:34445369-34445391 GGCTCCAGTGGGGGTGGGGACGG - Intergenic
1147120432 17:38332263-38332285 GGCCCCAGTAGAGGTGGAGGGGG + Intronic
1147499661 17:40950634-40950656 GGACCCTGTGGGGGTGGGGGGGG + Intergenic
1147670576 17:42174662-42174684 GGCCCCCTTGGGTGTGGGGCGGG - Intronic
1147786263 17:42980696-42980718 GGCCCCAGTGGGGGCGGTGGCGG + Exonic
1148740467 17:49889887-49889909 GGTTCCAGTGGGGGTGGGGCAGG + Intergenic
1148773271 17:50079078-50079100 GGGCCCAATGGGGGAGGGGCTGG + Exonic
1150001477 17:61443420-61443442 GGACTCAGGGGGGGTGGTCCTGG + Intergenic
1150001492 17:61443473-61443495 AGCCTCAGTGGGGGTTGTCCCGG - Intergenic
1151979527 17:77500241-77500263 CTCACCAGTGGGGGTGGTGAGGG - Exonic
1152093477 17:78259163-78259185 GGTCCCAGTTGGGGAAGTGCAGG - Intergenic
1152298551 17:79482493-79482515 GGCCCCAGTGGGGCTCCTTCTGG + Exonic
1152557016 17:81058494-81058516 GGCCCACGTGGTGGTGCTGCAGG + Intronic
1152590304 17:81208445-81208467 GGCCCCAGTGGGGGTGTTGTGGG - Intronic
1152610540 17:81313136-81313158 GGCCCCGGTGGGGCTGGGGCTGG + Exonic
1152612743 17:81323553-81323575 GGCCCCAGGAGGGGTGGGGGCGG + Intronic
1152855352 17:82662503-82662525 AGCCCCAGTGGGTGTGGGGAGGG + Intronic
1153863046 18:9233790-9233812 GGCCCCAGTGGTGGCAGTGGTGG + Intronic
1154012066 18:10582783-10582805 GGCCACAGTGTGGGTGATGAGGG - Intergenic
1154293482 18:13130643-13130665 GCACCCAGTGGGGATGGGGCTGG - Intergenic
1156060138 18:33063800-33063822 GGCACAAGTGGTGGTGGTGGTGG - Intronic
1157855111 18:51098346-51098368 GGCCCCAGTGTTGGCGGTGCAGG - Intergenic
1160257268 18:77258557-77258579 GGTCATAGTGGGGGTGGTGGTGG + Intronic
1160257321 18:77258808-77258830 GGTCATAGTGGTGGTGGTGCTGG + Intronic
1160257362 18:77258999-77259021 GGTCACAGTGGTGGTGGTGTTGG + Intronic
1160257385 18:77259111-77259133 GGTCACAGTGGTGGTGGTGTTGG + Intronic
1160257413 18:77259247-77259269 GGTCACAGTGGTGGTGGTGTTGG + Intronic
1160257438 18:77259365-77259387 GGTCACAGTGGTGGTGGTGTTGG + Intronic
1160412262 18:78683166-78683188 GGCGGGAGTGGGGGTGTTGCGGG + Intergenic
1160441815 18:78898925-78898947 GACCATCGTGGGGGTGGTGCAGG + Intergenic
1160730677 19:640421-640443 GGCTCCAGAGGGGCTGGGGCAGG + Intronic
1160793888 19:935041-935063 GGCCCCAGTAGGGGCCGGGCGGG - Intronic
1160838010 19:1133484-1133506 GGCCCCAGTGGGGCTGGCACAGG - Intronic
1160859909 19:1233376-1233398 GGCCCCTGTGGGCTGGGTGCTGG - Intronic
1160865931 19:1255918-1255940 GCCCCGGGTGGGGGTGGGGCAGG - Intronic
1160933570 19:1582452-1582474 GGACCCAGTGGGGTTGGGGATGG - Intronic
1160987866 19:1848040-1848062 GGTCCCAGGGTGGGTGGTTCCGG + Intronic
1160992232 19:1864499-1864521 CGCCCCACTGGGGGTGGGGAGGG + Intergenic
1161312034 19:3600163-3600185 GGCCACCGTGGGGCTGGTGTGGG - Exonic
1161399762 19:4062062-4062084 GGCGAGAGTGGGGGTGGGGCAGG - Intronic
1161469292 19:4448250-4448272 AGCCCCAGTGGGAGGGGTGCTGG + Intronic
1161696437 19:5771209-5771231 GGGGCCAGTGGGGCTGGGGCAGG - Intronic
1161746707 19:6064590-6064612 GTGCCCAGTGGGCGTGCTGCCGG - Intronic
1161812236 19:6477377-6477399 GGCCTCAGTGGGGCTTGAGCTGG - Exonic
1162012881 19:7829027-7829049 GGCCCTGGAGGGGGTGGGGCAGG - Intergenic
1162490282 19:10987451-10987473 GGCCCCAGTGGAGGGTGTGAAGG + Intronic
1162787136 19:13042723-13042745 GGCCTCAGTGGGGGTGGGGGTGG - Intronic
1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG + Exonic
1162934182 19:13972935-13972957 AGCCCCAGTGCTGGTGGAGCTGG + Exonic
1162934728 19:13976197-13976219 GACCCCAGTGGGCCTGGTCCAGG - Intronic
1163026687 19:14517010-14517032 GGCCCCAGTGGCGGTAGCGGCGG - Exonic
1163262951 19:16202152-16202174 GGCGAGACTGGGGGTGGTGCGGG - Intronic
1163696866 19:18768617-18768639 GGCGCCTGTGGGGGTGGCGGGGG - Exonic
1163775163 19:19213115-19213137 GGCCCCAGCGGGGGACGTGGGGG + Intronic
1165015236 19:32875676-32875698 GTCCCCAGTGTGGGTGGCTCAGG - Intergenic
1165065026 19:33223973-33223995 GGCCCTGGTGGTGGTGGTGGTGG - Intronic
1165283803 19:34820372-34820394 GGACACAGTGGTGGTGGTGCAGG + Intergenic
1165295797 19:34925169-34925191 AGCCCCAGTGGGCGTGTTACAGG + Intergenic
1166123548 19:40700254-40700276 GGCCCCAGGGCGGGTGGGCCAGG - Intronic
1166139133 19:40796582-40796604 GGCCCCAGCAGGGCTGGTCCTGG - Exonic
1166718978 19:44986739-44986761 GTCCCCAGGGGTGGTGGTGTGGG - Intronic
1167613351 19:50517779-50517801 GTGGCCAGTGGGGGTGGTGTGGG - Exonic
1167973095 19:53201212-53201234 GGCCCCACTGGGCATGGTCCTGG + Intergenic
1168059570 19:53883368-53883390 GGCCACCGCGGAGGTGGTGCTGG + Intronic
1168280818 19:55304647-55304669 GGCCCCAGGGGTGGGGGCGCCGG + Exonic
1168297434 19:55384263-55384285 GGCGCCAGCGGCGGCGGTGCAGG - Exonic
1168311245 19:55461847-55461869 CGCCCCAGGGGGGGCGGTGCCGG + Intronic
1168469272 19:56627652-56627674 GAGCCCAGTTGGGGAGGTGCTGG + Intergenic
927217191 2:20674459-20674481 GGCCCAACGGGGGCTGGTGCTGG + Intergenic
927442094 2:23126288-23126310 GGCTGCAGTGGGGGTGGGGTGGG - Intergenic
927492869 2:23532109-23532131 GGCCCCAGTGGAGCGGGTTCTGG - Intronic
927786940 2:25981070-25981092 GGAGGCAGTGGTGGTGGTGCTGG - Exonic
928042320 2:27890697-27890719 GGCCGCAGAGGGGGCGGGGCGGG + Exonic
928174310 2:29023633-29023655 TGCTCCAGTGGGGGTGGGGTGGG + Intronic
929596195 2:43177903-43177925 GTCCACAATGGGGGTGGTGTGGG - Intergenic
929857707 2:45650698-45650720 GGCCCGAGTGGGGGTGGGCAAGG + Intergenic
930534559 2:52630146-52630168 GGCCCAGCTGGGGGTGGGGCGGG - Intergenic
930763676 2:55062365-55062387 AGCCCCAGTGGGCGTGTTACGGG - Intronic
931551434 2:63450610-63450632 GGCCCCAGTGGTAGTAGTGGTGG - Intronic
932170511 2:69551231-69551253 GGGGCCGGTGGGGGTGGTGGAGG + Intronic
932314139 2:70768346-70768368 GGCGGTAGTGGGGGTGCTGCGGG - Intergenic
932715788 2:74100178-74100200 ACCCCCAGTGGGGCTGGGGCTGG + Intronic
933773557 2:85758654-85758676 GGCCGCAGGTGGGGAGGTGCAGG + Intronic
934659897 2:96137857-96137879 GGCACCAGTTGGGGTTGAGCAGG - Intronic
935112155 2:100104281-100104303 GGCCGCCGTGGGGGTGGGGTGGG - Intronic
935220865 2:101011274-101011296 GCTCCTAGTGGGGGTGTTGCTGG - Intronic
936122820 2:109760870-109760892 GGCCGCCGTGGGGGTGGGGTGGG + Intergenic
936221869 2:110610594-110610616 GGCCGCCGTGGGGGTGGGGTGGG - Intergenic
937310156 2:120897109-120897131 CGTGTCAGTGGGGGTGGTGCTGG - Intronic
938086413 2:128405036-128405058 GGCCCCCGTGGTGGCTGTGCTGG + Intergenic
938152867 2:128901948-128901970 GGCCAGGGTGGGGGTGGCGCTGG - Intergenic
938169975 2:129066855-129066877 GGCACCACTGGGGCTGGTCCAGG + Intergenic
938296594 2:130182799-130182821 TGCCCCAGTGGCGGGGGTGGCGG + Intronic
938460154 2:131491830-131491852 TGCCCCAGTGGCGGGGGTGGCGG - Intronic
939162397 2:138605772-138605794 GGGGCCTGTCGGGGTGGTGCTGG + Intergenic
940618636 2:156083519-156083541 TGCTCCAGTGGAGGTGGTGGAGG + Intergenic
941328226 2:164143741-164143763 GGCCTCAGTCGCGGGGGTGCGGG + Intergenic
941891154 2:170583068-170583090 GGCTGCAGTGGGGGGTGTGCGGG - Intronic
941934748 2:170973926-170973948 GCGCCCAGTGCGGGAGGTGCGGG + Intergenic
942084056 2:172427984-172428006 CGCCCCAGTGGGGGTGGGAAGGG - Intronic
943314117 2:186364643-186364665 AGTTCCAGTGGGGGTGGTGGGGG - Intergenic
943786320 2:191881958-191881980 GGCCCCAGTGGCGGTAGCGGCGG - Intergenic
945997088 2:216446932-216446954 TGCCCCAGTGAGGGAGGAGCTGG - Intronic
946199725 2:218064690-218064712 GGCACCAGTGGGGAAGGTGTAGG - Intronic
946563229 2:220936497-220936519 GGCCATAGTGGAGGTGGTGGTGG - Intergenic
947384886 2:229580997-229581019 ACCCCCAGTGGGGATGGGGCCGG + Intronic
947520095 2:230838889-230838911 GACTCCAGTGGAGGTGGGGCAGG - Intergenic
947984363 2:234436426-234436448 GGCCCCAGTGAGCTTGGTGTGGG + Intergenic
948050285 2:234974840-234974862 GCCCACACTGGGGGTGCTGCAGG + Intronic
948107706 2:235428379-235428401 GGGACCAGTGGGAGTGCTGCTGG - Intergenic
948653652 2:239464066-239464088 GGCCCCTGGAGGGGTGGAGCTGG + Intergenic
948756598 2:240163041-240163063 GCCCCCAGTGGGTGGGGTGGGGG + Intergenic
948837714 2:240634150-240634172 TGCCCCAGTGGGGATTGTGTGGG - Intergenic
949056759 2:241932118-241932140 AGCCCCTGTGGGAGTGGTCCTGG + Intergenic
1169265008 20:4162161-4162183 GGCCCGGGTGGGGCTGGGGCAGG + Intronic
1169318778 20:4613984-4614006 CCCCCCAGTGGTGGTGGTGGTGG - Intergenic
1169340884 20:4795433-4795455 GGTCCCAGTGGGGAGGGTGCTGG + Intronic
1169859053 20:10132609-10132631 GGCGCCTGTGGGGGTGGTGTGGG - Intergenic
1170111580 20:12809181-12809203 AGCCCCAGTGGTGGTGATGGTGG - Intergenic
1171060660 20:21956481-21956503 GGCCCCAGTAGTGGTAGTGGTGG + Intergenic
1172110007 20:32539014-32539036 GGCTCCAGTGGGGGTGGGGTGGG + Intronic
1172117416 20:32581265-32581287 GGCCCAAGTGGGGGTGGGGCAGG - Intronic
1172281687 20:33712307-33712329 GACCTCAGTGGTGCTGGTGCAGG - Intronic
1172317461 20:33967298-33967320 GGCCCCAGTGGCGGGGGAGCTGG - Intergenic
1173177770 20:40777455-40777477 GGCTGCAGTGGGGGTGGGGTGGG - Intergenic
1173270528 20:41530266-41530288 GGCAACAGTGGTGGTGGTGGTGG - Intronic
1173752351 20:45487391-45487413 GCCACCAGCGGGGGTGGTGAGGG - Intergenic
1173922536 20:46757171-46757193 GCCCCCAGTGGGGGTGGACAAGG - Intergenic
1174294977 20:49539533-49539555 GGCCCCAGTGGGTGGGGGGGAGG - Intronic
1174338949 20:49884077-49884099 TGCGCCTGTGGGGGTGGGGCAGG + Intronic
1175373370 20:58508020-58508042 GTCACCCATGGGGGTGGTGCTGG + Intronic
1175552668 20:59827309-59827331 AGCCCCAGTGGTGGTGGGGAGGG - Intronic
1175926565 20:62474273-62474295 GCGCCGAGTGGGGGTGGGGCAGG + Intronic
1176359378 21:5982461-5982483 GGCCCCAGTGGTGGCAGTGGTGG + Intergenic
1176384915 21:6134504-6134526 GGGCCCTGCTGGGGTGGTGCAGG + Intergenic
1176407858 21:6431223-6431245 GGCCCCAGGAAGGCTGGTGCAGG - Intergenic
1177322350 21:19539285-19539307 GGCAAGAGTGGGGGTGGGGCTGG + Intergenic
1178734446 21:35136490-35136512 AGCCCAAGTGGGGGTGGGGGAGG - Intronic
1178792676 21:35714458-35714480 TGCCCCAGTGGAGGCTGTGCTGG - Intronic
1179051432 21:37891856-37891878 GGCGGCAGTTGTGGTGGTGCTGG + Intronic
1179269624 21:39840632-39840654 GGCCCCAGGGGGAAGGGTGCAGG + Intergenic
1179683349 21:43039554-43039576 GGCCCCAGGAAGGCTGGTGCAGG - Intergenic
1179730759 21:43366019-43366041 GGCCCCTGGGGGAGTGGGGCGGG - Intergenic
1179738557 21:43403748-43403770 GGGCCCTGCTGGGGTGGTGCAGG - Intergenic
1179764140 21:43556089-43556111 GGCCCCAGTGGTGGCAGTGGTGG - Intronic
1179881340 21:44294443-44294465 AGCCCCTGTGGAGGGGGTGCTGG + Exonic
1179979557 21:44889023-44889045 GGCCCAAGTGGGGCAGATGCGGG + Intronic
1180143869 21:45909106-45909128 TGCCGCAGTGGGGTTGGGGCGGG - Intronic
1180647042 22:17347835-17347857 GGTCCCAGTGGACGTGGTGCGGG - Intergenic
1180707240 22:17817357-17817379 GGCCCCGCTGGAGGGGGTGCTGG + Exonic
1181174895 22:21029806-21029828 AACCCCAGTGTGGGAGGTGCAGG + Exonic
1181436815 22:22915941-22915963 GGCCCCTGTGGGTGGGGTGAGGG - Intergenic
1181437656 22:22919867-22919889 GGCCCCTGTGGGTGGGGTGAGGG - Intergenic
1181438304 22:22922922-22922944 GGCCCCTGTGGGTGGGGTGAGGG - Intergenic
1181550893 22:23638594-23638616 GGCCCCTGTGGGTGGGGTGGGGG + Intergenic
1181797393 22:25320095-25320117 GGCCCCTGTGGGTGGGGTGGGGG - Intergenic
1182257866 22:29050922-29050944 AGCCTCAGTGGCAGTGGTGCTGG - Exonic
1183315669 22:37135696-37135718 GGCTGCTGTGGGGGTGGTGGGGG - Intronic
1183377998 22:37476252-37476274 GGCCGCAGTGTGGGTGGGGGTGG - Intronic
1183746224 22:39693633-39693655 GTCCCCAGCGGTGGTGTTGCTGG + Intergenic
1183880059 22:40819454-40819476 GGCCCCTGTGGGCGCGGGGCGGG + Intergenic
1184679419 22:46062079-46062101 GGCCCCGGGGCGGGAGGTGCGGG - Intronic
1184782515 22:46656286-46656308 ACCCCCAGTGGGAGTGGGGCTGG + Intronic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
1184953838 22:47866499-47866521 GGCCTCAGTAGGGGCAGTGCAGG - Intergenic
1185229537 22:49672273-49672295 TGCCCCAGCGGGGGTGGGGGCGG + Intergenic
1185242750 22:49755323-49755345 GGCTGCAGCGGGGGTGGGGCAGG - Intergenic
1185284354 22:49993771-49993793 GGCCACCGTGGAGGTGGGGCTGG - Intergenic
949105517 3:197199-197221 GTCCGCAGTGGGGGTGGTCCGGG + Intronic
949519117 3:4833691-4833713 GGCTCCAGTGTGGCTGGAGCTGG - Intronic
950171566 3:10842380-10842402 GGACCCAGTGGGTCTGGTGGGGG + Intronic
950531029 3:13552479-13552501 TCCCCGAGTGTGGGTGGTGCAGG + Intronic
952088657 3:29857371-29857393 GGGCCCCGTGGGGGTGGGGGTGG - Intronic
952966559 3:38624576-38624598 GGCCACCTTGGGGGTGGTGGGGG - Intronic
954861593 3:53695168-53695190 GGTCCCCGTGGAGGAGGTGCTGG + Intronic
954913250 3:54126731-54126753 GGCCCCTGGAGGGATGGTGCTGG + Intronic
955405404 3:58622741-58622763 GGGCCCAGTGGGGAGGCTGCTGG + Intronic
955959079 3:64320505-64320527 GGGGCCAGTTGGGGAGGTGCTGG - Intronic
960809196 3:121612287-121612309 GGCCCCACTAAGAGTGGTGCTGG + Intronic
961354509 3:126327498-126327520 GGCCACAGTGGGTGAGGAGCAGG + Intergenic
961513553 3:127419279-127419301 GGCCCAGGTGGGGGTGGGGAGGG + Intergenic
961658514 3:128456276-128456298 GGTGGCAGTGGGGTTGGTGCAGG + Intergenic
963326768 3:143871714-143871736 GGCCTAAGCTGGGGTGGTGCAGG + Intergenic
964387252 3:156161220-156161242 GGGCCCAGTGGGGGTAGGCCTGG + Intronic
965147816 3:164928538-164928560 GACCCCAGAGGGTGTGGTACAGG - Intergenic
965181867 3:165414742-165414764 GGCACTGGTGGGGGTGGAGCTGG - Intergenic
965773085 3:172201257-172201279 AGCCCCAGTGGGGGAAGCGCAGG + Intronic
967158130 3:186712089-186712111 GGCCCTTGTAGGGGTGGGGCAGG - Intergenic
967627676 3:191704231-191704253 GGCCCCAGTGGTGGCAGTGGTGG - Intergenic
967859017 3:194137886-194137908 GGTCCCGGTGGGGGCGGTGGCGG - Exonic
968066516 3:195762329-195762351 GGGCGGGGTGGGGGTGGTGCGGG - Intronic
968648633 4:1751774-1751796 GTCCCCAGCAGGGATGGTGCGGG - Intergenic
968902195 4:3437005-3437027 GGCCCCTCTGGAGGTGGTGCAGG + Intronic
969416156 4:7060870-7060892 CGCCCTGGTGGGGGTGGTGAAGG - Exonic
969477748 4:7431099-7431121 GGCCCCTATGGGGGTGGGGCAGG + Intronic
969799955 4:9556018-9556040 GGCAACAGTGGTGGTGGTGGTGG + Intergenic
969819496 4:9709477-9709499 GGGGACAGTGGGGGTGGTGGAGG - Intergenic
969841699 4:9887624-9887646 GGACCCAGGGGGCGTGGTCCTGG + Exonic
970608194 4:17702035-17702057 GGGCCCAGTGTGGGTGGTGTTGG + Intronic
977882224 4:102217995-102218017 GGACCCAGTGACTGTGGTGCAGG + Intergenic
978703428 4:111675850-111675872 AGCCCCAGTGGGCGTGTTACAGG - Intergenic
981401793 4:144322052-144322074 GGGCCCAGAGGGTTTGGTGCAGG + Intergenic
984029060 4:174580809-174580831 GGACACACTGTGGGTGGTGCAGG + Intergenic
985007997 4:185553745-185553767 GGCAGCAGTGGTGGTGGTGGTGG - Intergenic
985116322 4:186595196-186595218 GGCCGCAGTGGGGTTGGGGGAGG + Intronic
985255186 4:188063061-188063083 TGCCCTAGTGGGGGTGGAGGTGG + Intergenic
985431798 4:189888257-189888279 TGCCCCAGTGGGGATGGTGTGGG + Intergenic
985481083 5:111324-111346 GGCCCCAGTGGGAGTCATCCTGG + Intergenic
985641527 5:1065560-1065582 GTCCACAGGGGAGGTGGTGCGGG - Intronic
985661370 5:1158744-1158766 GACCCAAGTGAGGGTGGTTCTGG + Intergenic
986310092 5:6545126-6545148 GGACCCAGTGGGGATGGTGATGG - Intergenic
987149270 5:15022433-15022455 GGCTGCAGTTGGGGTGGTGAGGG + Intergenic
988336342 5:29913610-29913632 GGGCCCAGAGGGCTTGGTGCAGG + Intergenic
988466937 5:31500216-31500238 GGCCCCAACTGGGGAGGTGCTGG + Intronic
988470450 5:31532440-31532462 GCTCCCAGTGTGGGTGGTGGAGG + Exonic
989231100 5:39086881-39086903 GGCCCCAGTGGTGGCAGTGGTGG - Intergenic
989980251 5:50634969-50634991 GGAACAAGTGGGAGTGGTGCTGG + Intergenic
990149584 5:52800855-52800877 GGCCCGAGTGAGGGTCATGCTGG - Exonic
991134800 5:63168785-63168807 TTCCCCAGTGGTGGTGTTGCTGG - Intergenic
995186864 5:109281064-109281086 GGCCCCTGTGGGGGTTGAGAAGG - Intergenic
997454324 5:134005879-134005901 GGGCCCTGTGGAGGAGGTGCCGG + Intergenic
998250974 5:140552142-140552164 GGCCCCATTGGGGGAGGCCCAGG + Exonic
999322435 5:150623962-150623984 GCCCTCAATGGGAGTGGTGCTGG + Intronic
1001770946 5:174295399-174295421 GGCCTCAGTGTGGAAGGTGCCGG + Intergenic
1002056289 5:176599596-176599618 AGCCCCAGTGGGGCTGGGGAAGG - Exonic
1003158794 6:3618258-3618280 GGCCCCAGTGCCGGGGGTGGGGG + Intergenic
1005773053 6:29096953-29096975 GGCTCCAGTGGAGGTGGTTGTGG + Intergenic
1005775678 6:29129316-29129338 GGCTGCAGTGGGAGAGGTGCGGG + Intergenic
1005779030 6:29168962-29168984 GGCTCCAGTGGAGGTGGTTGTGG + Intergenic
1006003678 6:30986504-30986526 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003687 6:30986549-30986571 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003697 6:30986594-30986616 AGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003703 6:30986639-30986661 GGCCTCACTGGAGGTTGTGCTGG - Exonic
1006003712 6:30986684-30986706 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003728 6:30986774-30986796 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003746 6:30986864-30986886 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003755 6:30986909-30986931 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003766 6:30986954-30986976 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003781 6:30987044-30987066 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003791 6:30987089-30987111 GGCCCCACTGGAGGTCGTACTGG - Exonic
1006003800 6:30987134-30987156 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003809 6:30987179-30987201 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003818 6:30987224-30987246 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003828 6:30987269-30987291 GGTCCCACTGGAGGTCGTGCTGG - Exonic
1006003846 6:30987359-30987381 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003863 6:30987449-30987471 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006744037 6:36329212-36329234 GGCACCAGTGGGGTGGGAGCAGG + Intronic
1007282466 6:40722627-40722649 GGCCCAGGTGGGGGTGTTGCAGG - Intergenic
1007361276 6:41358186-41358208 CACCCCAGTGGGGATGGTGAGGG - Intergenic
1007496616 6:42264356-42264378 GGCCCCAGTGGGCCTGGTCTTGG + Intronic
1009295514 6:61941528-61941550 GGCCCTAGTGGTGGAGGTGGTGG - Intronic
1009991364 6:70846612-70846634 GCCTGCAGTGGAGGTGGTGCTGG + Intronic
1010124660 6:72418241-72418263 GACACTAGTGGGGGTGGTACTGG - Intergenic
1010564939 6:77399406-77399428 AGCCTAAGTGGGGGTGGGGCGGG + Intergenic
1011192121 6:84740121-84740143 AGCCCCAGAGGGGATAGTGCAGG + Intronic
1011337335 6:86275813-86275835 GGGGCTAGTGGGGGTGGGGCTGG + Intergenic
1011443019 6:87407929-87407951 GGGCCAGGTGGGGGTGGGGCGGG - Intergenic
1011470200 6:87701356-87701378 GGCCCCTGGGGTGGGGGTGCCGG - Intronic
1011714944 6:90095780-90095802 GGCGGCAGTGGTGGTGGTGGTGG - Intronic
1012616480 6:101284443-101284465 GAGCCCAGTGGGTTTGGTGCAGG + Intergenic
1012869894 6:104659964-104659986 TGCTCCAGTGGGGGTGGTAGGGG - Intergenic
1012965331 6:105667609-105667631 GGCCTGAGTGGGGGTTGAGCAGG - Intergenic
1013112246 6:107073399-107073421 GACCCCAGAGGGAGTGGGGCAGG - Intronic
1015731393 6:136351935-136351957 TGCCCCAGTGGGGGTGCTGGGGG - Intronic
1017121724 6:151030304-151030326 GGCCACACTGGGGTAGGTGCAGG + Intronic
1018349796 6:162944089-162944111 GGCCCCAGTGGTGGCAGTGACGG - Intronic
1018898648 6:168039422-168039444 TGCCCCAGTGGGGGTGCAGCTGG + Intronic
1018910511 6:168098664-168098686 GGCCCCAGGTGGAATGGTGCTGG - Intergenic
1019418200 7:936940-936962 AGGCCCAGTGGGGCTGGGGCTGG + Intronic
1019644702 7:2122856-2122878 GGCGTCAGTGTGGGTGGTGACGG + Intronic
1019789876 7:3004224-3004246 GGCCCCACTCTGGGTGGTCCTGG - Intronic
1019912724 7:4110504-4110526 GGCACAAGAGGGGGTTGTGCAGG + Intronic
1021847416 7:24776251-24776273 GGCCACAGTGGACGTGGTGGCGG + Intergenic
1022472756 7:30691837-30691859 GCCCCTAGTGGTGGTGGTGATGG + Intronic
1023754685 7:43405593-43405615 GGGGACAGTGGGGGTGGTGCTGG + Intronic
1023856659 7:44188333-44188355 GCCCCCAGCTGGGGTGATGCAGG + Intronic
1024036118 7:45509053-45509075 GGCCCACATGGGGGTGGGGCGGG - Intergenic
1024294263 7:47830245-47830267 GCCTGCTGTGGGGGTGGTGCTGG + Intronic
1024453709 7:49579536-49579558 AGCCACAGTTGGGGAGGTGCAGG + Intergenic
1024559107 7:50628556-50628578 TGCCCAGGTGGGGGTGGTGGGGG + Intronic
1025018626 7:55463648-55463670 GGCCCCAGTGGTGGTAGTTGTGG + Intronic
1025129309 7:56367450-56367472 GGCCGCAGTGGGGGGAGAGCTGG - Intergenic
1025129335 7:56367518-56367540 GGCCCCCGTGAGGGAGGAGCAGG - Intergenic
1026015816 7:66669843-66669865 GGCCCGGGTGTGGGTGGTGAGGG - Intronic
1026973975 7:74485201-74485223 GGCAGCAGTGGGGCTGCTGCAGG + Intronic
1027013724 7:74766600-74766622 GGCTCCCGCGGGGGTGGGGCTGG + Intergenic
1027074314 7:75179432-75179454 GGCTCCCGCGGGGGTGGGGCTGG - Intergenic
1033252096 7:139769207-139769229 GGCTGCTGTTGGGGTGGTGCAGG - Intronic
1033288588 7:140062646-140062668 GGCCCCGGAGCGCGTGGTGCTGG - Exonic
1035493019 7:159296299-159296321 GGCTCAGGTGGGGGTGCTGCAGG - Intergenic
1035567056 8:648388-648410 GGTCGCAGTAGGGGAGGTGCTGG + Intronic
1038718021 8:30009281-30009303 AGCCCCAGTGGCGGTGGCACTGG - Intergenic
1039600915 8:38836431-38836453 GCCCCCTGTGGCAGTGGTGCTGG + Intronic
1041185080 8:55290579-55290601 GGGCCTGTTGGGGGTGGTGCAGG - Intronic
1041327626 8:56685760-56685782 GGCCCCAGTAGGGGAGGGGCTGG + Intergenic
1041935373 8:63326568-63326590 AGCCCCAGTGGGCCTGGAGCAGG - Intergenic
1042649455 8:71023800-71023822 GGCACCAGTGGTGGTGGTGGTGG + Intergenic
1042795824 8:72662366-72662388 GGCCTCAGTGGGGCTGGGGAGGG + Intronic
1043552056 8:81386094-81386116 GGCCCCAGTGGTGGAGGTAGTGG + Intergenic
1043815382 8:84794701-84794723 GGCAGCAGTGAGGATGGTGCTGG - Intronic
1045484734 8:102622169-102622191 AGCCCCAGTGTGGGCAGTGCTGG + Intergenic
1046216311 8:111152311-111152333 TGCTCCAGTGGGGATGGTGATGG + Intergenic
1047255469 8:123210348-123210370 GGCCGCAGTGAGGGAGGTACAGG - Intergenic
1047697309 8:127416207-127416229 GGCACCAGGGGGGACGGTGCAGG - Exonic
1047807271 8:128373522-128373544 GGTGCCAGTGGTGCTGGTGCTGG + Intergenic
1048580975 8:135729553-135729575 GGCCTCCGTGGGGTTGCTGCAGG - Intergenic
1049164608 8:141118184-141118206 GGCCCCAGTGGTGTAGGTGCCGG - Intronic
1049398768 8:142415424-142415446 GGCACCAGTGGCAGTGGTGGGGG + Intergenic
1049807493 8:144547550-144547572 GCCCTCAGTGGGGGTGGCGCTGG + Exonic
1051330528 9:16020739-16020761 GGTCCCAGGTGGGATGGTGCCGG + Intronic
1051604230 9:18905014-18905036 GGTTCCACTGGGGGTGGTGCTGG - Intronic
1053055408 9:34990664-34990686 GCCTGCAGTGGGGGTGCTGCTGG - Exonic
1053280317 9:36816328-36816350 GGCCCCAGTGTTGGGGGTGAAGG + Intergenic
1053452141 9:38202292-38202314 GGCCTCAGCGGGGGTGGGGGTGG + Intergenic
1053739999 9:41127681-41127703 GGCCTGGGTGGGGGTTGTGCAGG + Exonic
1054442963 9:65283675-65283697 GGCCTGGGTGGGGGTTGTGCAGG + Exonic
1054487317 9:65737826-65737848 GGCCTGGGTGGGGGTTGTGCAGG - Exonic
1056176942 9:84044964-84044986 GGCCTCAGTGGTGGTAGTGATGG + Intergenic
1056259420 9:84833085-84833107 GGCCTCATTGGTGGTGGTGGTGG + Intronic
1056275679 9:84992027-84992049 GACCCCAGTGAGGGAGGTGCTGG + Intronic
1056716782 9:89037966-89037988 GCACCCAGTGGGGGTGGGGCCGG - Intronic
1057266551 9:93621473-93621495 GGCCCAGGGGTGGGTGGTGCTGG + Intronic
1057379039 9:94552982-94553004 GGCCTCAGTGGCAGTGGTGGAGG - Intergenic
1057386047 9:94606784-94606806 GGGCCCGGGGAGGGTGGTGCAGG - Intronic
1058887360 9:109331470-109331492 GGGGTCAGTGGGGGTGGTGATGG + Intergenic
1060367577 9:123034060-123034082 GGTGCCAGTAGGGGTGGAGCGGG + Intronic
1061203142 9:129148563-129148585 GGGCCCAGTGGGGGCTGGGCAGG + Exonic
1061293629 9:129665928-129665950 GGCCCCAGCGCGGGTGGAGGCGG - Exonic
1061406670 9:130396138-130396160 GGGCACAGAGGGAGTGGTGCTGG - Intronic
1061669820 9:132182459-132182481 GGCCCAAGTGGGTGGGGGGCTGG + Intronic
1061670808 9:132187153-132187175 GGCCCCCCTGGGGGAGGAGCAGG + Intronic
1062004393 9:134231976-134231998 GGCCTCAGTGGAGGTGGTGGAGG + Intergenic
1062009834 9:134261045-134261067 GGACCCAGATGGGGTGGCGCCGG - Intergenic
1062136437 9:134930850-134930872 TGCTCCAGTGGGGGCCGTGCTGG + Intergenic
1062287858 9:135781080-135781102 AGCCCCAGTGGAGGTGAAGCCGG - Intronic
1062341168 9:136094620-136094642 GGCCCGAGTGGGGGAGGCGCGGG + Intronic
1062402229 9:136377770-136377792 AGCCTCACTGGGGCTGGTGCGGG - Exonic
1062506594 9:136880727-136880749 GGCCCCACTGGGGAGGGTGGCGG + Intronic
1062599522 9:137313617-137313639 GGCCCCATGGGGGGTGTGGCAGG + Intronic
1062615440 9:137393984-137394006 GGCCCCAGTGGGAGCTGTCCGGG - Intronic
1062624024 9:137434949-137434971 GGCCCTGGTGGCGGTGGTGGGGG - Exonic
1062628743 9:137454280-137454302 GGCCCGATTGGGGTTGGGGCGGG + Intronic
1062636541 9:137494533-137494555 GGCGCGGGTGAGGGTGGTGCGGG - Intronic
1185593187 X:1291963-1291985 GGTCCAGGTGGAGGTGGTGCAGG - Intronic
1185593211 X:1292088-1292110 GGTCCAGGTGGAGGTGGTGCAGG - Intronic
1188328415 X:28836774-28836796 GGCAGCAGTGGTGGTGGTGGTGG - Intronic
1190117646 X:47636794-47636816 GACCCCAGAAGGGGTGGTGGTGG + Exonic
1190735055 X:53250594-53250616 GGCCCTGGTGGGGCTGGGGCTGG + Exonic
1191033193 X:55997318-55997340 GACCCCAGAGGGTTTGGTGCAGG - Intergenic
1191252208 X:58265085-58265107 GACCCCAGCGGGCCTGGTGCAGG - Intergenic
1191861085 X:65667372-65667394 GCCCTGAGTGGGGGTGGGGCTGG + Intronic
1194807563 X:98348063-98348085 GGCCTCTGTGTGGGTGGTGGTGG + Intergenic
1197594624 X:128450919-128450941 GGCACCAGTAGTGGTGGTGGTGG + Intergenic
1198567410 X:137918476-137918498 GGCCCCAGTGGGGTGTGAGCTGG + Intergenic
1199242896 X:145568963-145568985 GGTGCCAGTGGTGGTGGTGGTGG - Intergenic
1199724652 X:150568591-150568613 GACCCCAGAGGGGGCGGAGCAGG + Intergenic
1200137096 X:153880468-153880490 GGCCAGAGTGGGGGTGGGGCTGG + Intronic
1200233535 X:154457969-154457991 GGCCCGAGGGGGTGTGGCGCGGG + Intergenic
1200413783 Y:2887402-2887424 GGCCAGTGTGGGGGTGGTGGTGG + Intronic
1201178210 Y:11322477-11322499 GTCCGCGGTGGGGCTGGTGCCGG + Intergenic