ID: 1131173167

View in Genome Browser
Species Human (GRCh38)
Location 15:90192448-90192470
Sequence AGATGTAGCCTGGACACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131173160_1131173167 16 Left 1131173160 15:90192409-90192431 CCCATGGATGATTAATGGGTATT 0: 1
1: 0
2: 0
3: 15
4: 251
Right 1131173167 15:90192448-90192470 AGATGTAGCCTGGACACTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 133
1131173161_1131173167 15 Left 1131173161 15:90192410-90192432 CCATGGATGATTAATGGGTATTG 0: 1
1: 0
2: 1
3: 5
4: 110
Right 1131173167 15:90192448-90192470 AGATGTAGCCTGGACACTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131173167 Original CRISPR AGATGTAGCCTGGACACTGC TGG Intronic
906205417 1:43983995-43984017 GGTTCTAGCCTGGAGACTGCAGG + Intronic
908415853 1:63912655-63912677 AGTTGTATCCTTGACACTGTTGG + Intronic
916657378 1:166888103-166888125 ACATGGTGGCTGGACACTGCAGG + Intergenic
917198950 1:172495675-172495697 AGATGTGGCTTGGATTCTGCTGG - Intergenic
919872125 1:201829622-201829644 AGATGGAGCCTAGAATCTGCAGG + Intronic
1065822963 10:29543337-29543359 AGATGTAATCTGACCACTGCAGG + Intronic
1068873410 10:61970328-61970350 AGATATAGCCAGGGCACTGGAGG + Intronic
1070324979 10:75382974-75382996 GGATGCAGGCTGGACAGTGCTGG - Intergenic
1071359496 10:84831928-84831950 AGATGTAGCCTGAATGCTGTGGG - Intergenic
1073324062 10:102632408-102632430 AGATGGAGCCTGGCCCCTGCAGG - Exonic
1074870035 10:117569181-117569203 AAAAGCAGCCTGGAGACTGCTGG + Intergenic
1076514237 10:131034070-131034092 AGCTGTGTCCTGGAGACTGCAGG - Intergenic
1077509760 11:2952050-2952072 GGGTGTACCCTGGACACAGCTGG + Intronic
1080561902 11:33471782-33471804 AGATCTGGCATGGACTCTGCAGG + Intergenic
1082258597 11:50059984-50060006 AGGTGTAGAGTGGAGACTGCAGG - Intergenic
1083194635 11:61078168-61078190 AGATGGTGCCTGCACAGTGCTGG + Intergenic
1084196244 11:67524698-67524720 AGATGCAGGCAGAACACTGCGGG - Intergenic
1085127223 11:74010209-74010231 GGCTTTAGCATGGACACTGCTGG + Intergenic
1086364024 11:86089850-86089872 AGATCTACCCTGGACACAGTAGG + Intergenic
1086798592 11:91141932-91141954 AGATGTAGCCTTTTCACTGGTGG + Intergenic
1087171525 11:95054164-95054186 AGAAGTAGGGTGGAAACTGCTGG - Intergenic
1088713080 11:112525656-112525678 AGATGTGGCATGGACACTGAAGG - Intergenic
1089697566 11:120225555-120225577 ACAGGATGCCTGGACACTGCCGG - Intronic
1090343231 11:126044359-126044381 AGATCTAGCAATGACACTGCTGG + Intronic
1091744239 12:2981149-2981171 AGAGGTGCCCTGGACACTGAGGG - Intronic
1095730284 12:45498930-45498952 ATATGTAGGCTGGGCACAGCAGG - Intergenic
1096502668 12:52074363-52074385 AGATGTAGAAGGGACACGGCCGG + Intronic
1096811785 12:54175237-54175259 AAATGCAGCCTGGCCACAGCTGG - Intronic
1098052005 12:66463995-66464017 AGATGTAGACTGACCACTACGGG + Intronic
1106778509 13:33032073-33032095 AGATGTAACCTGTGCAATGCGGG - Intronic
1111501244 13:89122966-89122988 AGCGGTAGCCTGCAGACTGCTGG - Intergenic
1113262976 13:108586543-108586565 AGATGAAGGCAGGTCACTGCAGG + Intergenic
1113267871 13:108639502-108639524 AGATTCAGTCTGGACAGTGCAGG - Intronic
1114540148 14:23449371-23449393 AGATGAAGCCTGGACTCCTCTGG + Intergenic
1117641094 14:57800001-57800023 AGAAGCAGTCTGGCCACTGCTGG - Intronic
1117959267 14:61147147-61147169 AGCTGTAGACTGGAAACTGGAGG - Intergenic
1118023759 14:61746932-61746954 AGATTTAGCATGTAGACTGCTGG + Exonic
1120972128 14:90216223-90216245 AGATATACCCTGCACCCTGCAGG - Intergenic
1121724275 14:96135191-96135213 GGAAGTAGCCTGGCCACTCCAGG + Intergenic
1128801975 15:70502670-70502692 AGATGCAGCATGGCTACTGCAGG - Intergenic
1131173167 15:90192448-90192470 AGATGTAGCCTGGACACTGCTGG + Intronic
1131430199 15:92381317-92381339 AGCTTTAGCCTGAAAACTGCTGG - Intergenic
1131521351 15:93118361-93118383 AGATGAAGCCTGGCCACCGTGGG + Intergenic
1132403809 15:101530261-101530283 ACATGTGGCTAGGACACTGCTGG - Intergenic
1139350333 16:66331057-66331079 AGATTTGGGCTGGGCACTGCAGG + Intergenic
1139675083 16:68518018-68518040 AGATGTAATCTGGTCATTGCAGG + Intergenic
1139745900 16:69074069-69074091 AGATGCTGCCTGGTCCCTGCTGG - Intronic
1140472825 16:75224737-75224759 GGATGGAGCCTGGACCCTGGTGG + Exonic
1140473639 16:75228017-75228039 GGATGGAGCCTGGACTCTGGAGG + Intergenic
1142204292 16:88775389-88775411 AGATGAAGCCCGGACACTCTTGG - Intronic
1142756654 17:2020388-2020410 AGATGTAGCCTGCCCACATCTGG + Intronic
1146287357 17:31582807-31582829 GGATGTAGGCTGGGAACTGCTGG + Intergenic
1147608780 17:41789157-41789179 AGCTGTAGCCAGGCCACAGCTGG + Intergenic
1150318602 17:64190733-64190755 ACCTGCAGCCTGGGCACTGCTGG + Intronic
1151886721 17:76926982-76927004 AGATGTAGCCTTCACCCTCCAGG + Intronic
1152299785 17:79488419-79488441 AGATGCAGCCTTGCCAGTGCAGG + Intronic
1157885403 18:51361595-51361617 AGATGTGGCCTGGTCATTGTCGG - Intergenic
1163613395 19:18312237-18312259 GGATGTTGCCTGCACTCTGCGGG - Intronic
1164589102 19:29496359-29496381 AGCTGCAGCCAGGACAGTGCTGG + Intergenic
928179789 2:29060659-29060681 GGAAGGACCCTGGACACTGCAGG - Exonic
929143853 2:38689252-38689274 AGATGCAGCCTGGCCTTTGCAGG - Intronic
929219232 2:39446274-39446296 TGATGTAGCCTGTACCCTCCAGG - Intergenic
929859751 2:45666622-45666644 AGCTGTAGCCTGGAGAATTCTGG - Intronic
929989772 2:46776922-46776944 AGATGTAGCCTGGGGACTCCAGG - Intergenic
932113369 2:69022187-69022209 AGAGGATGCCTGTACACTGCAGG + Intronic
936142015 2:109948638-109948660 AGATGCAGCATGGACCCTGAGGG - Intergenic
936178705 2:110246598-110246620 AGATGCAGCATGGACCCTGAGGG - Intergenic
936202673 2:110422834-110422856 AGATGCAGCATGGACCCTGAGGG + Intronic
937322622 2:120970128-120970150 AGCTGGAGCCTGGTCCCTGCTGG + Intronic
943157186 2:184197567-184197589 ACAGGCAGCCTGGACACTGGAGG - Intergenic
943416279 2:187610026-187610048 AGAGTTAGCCTGGACTCTGAAGG - Intergenic
943717932 2:191172799-191172821 TGAGGGAGCCAGGACACTGCTGG - Intergenic
945364287 2:208931719-208931741 AGCTATTGCCTGGACACTTCAGG + Intergenic
947235986 2:227941352-227941374 AGATGTCTCCTGGATCCTGCAGG + Intergenic
948750282 2:240128214-240128236 AGATATAGTGTGGAGACTGCTGG + Intronic
1172584306 20:36071744-36071766 AGAAGCTGCCTGGAGACTGCAGG - Intergenic
1172646056 20:36470311-36470333 TGAGGAAGCCTGGACACTGTGGG - Intronic
1173247175 20:41344858-41344880 AACTATAGCCTGGACACCGCTGG + Intronic
1177997661 21:28121433-28121455 ACATTTAGGCTGGACTCTGCTGG - Intergenic
1178814424 21:35914936-35914958 AGCTGTAGCCTGAACACTTTGGG - Intronic
1180637211 22:17270641-17270663 AGACATAGCCTGGACTCCGCAGG + Intergenic
1181537781 22:23555661-23555683 AGAAGCAGCCAGGACGCTGCTGG + Intergenic
1181748157 22:24970293-24970315 TGATGTCACCTGGACACTGCAGG + Intronic
1184684048 22:46088035-46088057 AGATGTGGCCTGTACAGGGCCGG - Intronic
1184928444 22:47661110-47661132 ACATGAAGCCTGGGTACTGCAGG - Intergenic
1185136914 22:49078570-49078592 AGATGTAGGGAGGACAGTGCTGG - Intergenic
1185275089 22:49947303-49947325 AGCTGTGGCCAGGAAACTGCAGG - Intergenic
950080655 3:10219795-10219817 AGAGGTGGGCTGGACCCTGCTGG + Intronic
950586707 3:13897341-13897363 AGATGTGACCTGGTCTCTGCTGG + Intergenic
952569949 3:34702008-34702030 AGTTGTAGGCTGCACACAGCAGG + Intergenic
955988026 3:64595421-64595443 AGATCTGGCCTTGACACAGCAGG - Intronic
962752130 3:138441278-138441300 AAAGGTTGCCTGGACACTCCTGG - Intronic
968633302 4:1663992-1664014 GCATGCAGCCTGGACACTCCGGG + Intronic
968635032 4:1673807-1673829 AGCTGCTGCCTTGACACTGCTGG - Intronic
972009430 4:34158411-34158433 TCATGTAGCATGGCCACTGCTGG - Intergenic
974962308 4:68719281-68719303 AGAGGGAGACTGGACACTTCTGG + Intergenic
975410446 4:74042870-74042892 AGATGTCACCTGGAAACTCCTGG + Intergenic
979690975 4:123558071-123558093 AGATGCAGCCAGTACTCTGCTGG + Intergenic
983274771 4:165603630-165603652 AAATGTAGCCTTGGAACTGCTGG + Intergenic
984704052 4:182835019-182835041 AGAGGAAGCCTGGATTCTGCAGG - Intergenic
986124445 5:4872119-4872141 AGATTTAGCCTGGAGACAGGTGG + Intergenic
986262590 5:6161382-6161404 AGATGTCGACAGGACACAGCAGG - Intergenic
987060402 5:14237612-14237634 AGTTGTAGCCTTGACACAGATGG + Intronic
989815508 5:45732391-45732413 AAATGTAGATTGGACAATGCAGG - Intergenic
990149804 5:52803580-52803602 AGCTGCAACCTGGACACTGAGGG - Exonic
995035470 5:107529475-107529497 AGAAGCTGCCTGGACACTCCAGG + Intronic
995223379 5:109676396-109676418 AGATGCAGTCTGCACACTGCAGG + Intergenic
995433588 5:112109922-112109944 TCAAGTAGCCTTGACACTGCAGG - Intergenic
995461713 5:112410568-112410590 AGAGGTAGACTGGACACTGATGG + Intronic
1001579383 5:172788633-172788655 GTGTGCAGCCTGGACACTGCAGG + Intergenic
1005822247 6:29607511-29607533 AGTTATAGCCTGAACACTTCTGG + Intronic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1007280561 6:40709341-40709363 AGGTGTAGACAGGACACTGTGGG - Intergenic
1007365431 6:41388592-41388614 AGAAGTAGTCTGTACTCTGCAGG + Intergenic
1010159770 6:72839471-72839493 AATTCTATCCTGGACACTGCAGG + Intronic
1011342746 6:86335744-86335766 AGCTGTACCCTGGAGTCTGCAGG + Intergenic
1011930180 6:92701510-92701532 ACATACAGCCTGGGCACTGCAGG - Intergenic
1012549315 6:100453264-100453286 AGAGGGAGCCTGGGCACTACAGG + Intronic
1016012018 6:139147059-139147081 AAATGTAGACTGCAGACTGCAGG - Intronic
1020249937 7:6459575-6459597 ATCTGTAGCCTGGAATCTGCTGG - Intronic
1020919066 7:14238512-14238534 AAATGTAGCCTGGAAATTCCTGG - Intronic
1022389234 7:29929008-29929030 AGAGGTAGCCTGGAGACAGCTGG - Intronic
1027204123 7:76083547-76083569 AGATGTATCCTTTACACCGCTGG + Intergenic
1028056584 7:86252661-86252683 AGATGTGGCCAGCACAGTGCTGG - Intergenic
1029087345 7:98021891-98021913 TGATGTGGCCTGGACACGGTGGG - Intergenic
1035731909 8:1859670-1859692 GGATGCAGCCTGGTCACTACAGG - Intronic
1036500837 8:9312383-9312405 ACATGCTGCCGGGACACTGCCGG + Intergenic
1043812858 8:84764188-84764210 AGATGTAGCCTTCACACTTTGGG - Intronic
1045079602 8:98610742-98610764 AGATGTAGCATGGCCCATGCAGG + Intronic
1047311675 8:123697484-123697506 ACCTGTAGCCTGGACCCTGGCGG + Intronic
1049758584 8:144321682-144321704 ACATGGAGCTTGGACACTCCAGG + Intronic
1049796141 8:144498108-144498130 AGATGCAGGCCAGACACTGCCGG - Intronic
1051360191 9:16275399-16275421 CAGTGTAGCCTGCACACTGCTGG - Intronic
1056185261 9:84128507-84128529 AGATGTAGACTGGACACTAAGGG + Intergenic
1059668298 9:116470236-116470258 AGATTTAGGCTGAACACTGAAGG + Intronic
1061814786 9:133188216-133188238 AGCAGAAGCCTGGACCCTGCAGG + Intergenic
1186223180 X:7371209-7371231 AGATGTTGGCTTAACACTGCAGG + Intergenic
1186243508 X:7595018-7595040 AGATGTAGCATGGACATTTTCGG - Intergenic
1190263738 X:48815568-48815590 AACTGAAGCCTGGGCACTGCAGG - Exonic
1193809502 X:86035085-86035107 ACATGTAGCCTGAAATCTGCTGG - Intronic
1199550798 X:149059105-149059127 AAATAAAGCCTGGACACTACAGG - Intergenic
1199742109 X:150745376-150745398 GGAAGCAGCCAGGACACTGCCGG + Intronic
1199877577 X:151946586-151946608 AGAGGTAGCCTGCACACTGGAGG - Intergenic