ID: 1131179057

View in Genome Browser
Species Human (GRCh38)
Location 15:90227985-90228007
Sequence CCCGTTGCGTAGCCAGAGTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 41}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131179057_1131179068 21 Left 1131179057 15:90227985-90228007 CCCGACTCTGGCTACGCAACGGG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1131179068 15:90228029-90228051 TCCTGCCACGTGCTACCCACTGG 0: 1
1: 0
2: 1
3: 13
4: 128
1131179057_1131179061 -4 Left 1131179057 15:90227985-90228007 CCCGACTCTGGCTACGCAACGGG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1131179061 15:90228004-90228026 CGGGGCCCCCGTCAATGCCTCGG 0: 1
1: 0
2: 0
3: 7
4: 145
1131179057_1131179071 23 Left 1131179057 15:90227985-90228007 CCCGACTCTGGCTACGCAACGGG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1131179071 15:90228031-90228053 CTGCCACGTGCTACCCACTGGGG 0: 1
1: 0
2: 0
3: 16
4: 170
1131179057_1131179070 22 Left 1131179057 15:90227985-90228007 CCCGACTCTGGCTACGCAACGGG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1131179070 15:90228030-90228052 CCTGCCACGTGCTACCCACTGGG 0: 1
1: 0
2: 1
3: 6
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131179057 Original CRISPR CCCGTTGCGTAGCCAGAGTC GGG (reversed) Exonic
900927375 1:5714042-5714064 ACCGTGGCCTACCCAGAGTCAGG - Intergenic
902336963 1:15759290-15759312 CCCTTTTCCTAGCCAGGGTCAGG + Intronic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
910203307 1:84722564-84722586 CCCTTTTCCTAGCAAGAGTCAGG + Intergenic
912428338 1:109613879-109613901 ACCTTTGAGAAGCCAGAGTCTGG - Exonic
923081857 1:230665226-230665248 CCAGCTGGGTAGCCTGAGTCAGG + Intronic
1064536880 10:16366416-16366438 CCCTTTCCTTAGCCAGGGTCTGG - Intergenic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1098273049 12:68787739-68787761 CCCGTGCGGTGGCCAGAGTCCGG + Intronic
1102552587 12:113702411-113702433 CCCATTGCATCTCCAGAGTCAGG - Intergenic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1120294507 14:82622909-82622931 CCGGTAGTGAAGCCAGAGTCAGG + Intergenic
1126101611 15:45121334-45121356 CCCGTTAACTAGCCAGGGTCTGG + Intronic
1131179057 15:90227985-90228007 CCCGTTGCGTAGCCAGAGTCGGG - Exonic
1132501172 16:285368-285390 CCCGGTGCGCAGCCAGCGTCTGG - Exonic
1140469846 16:75207850-75207872 CCCATGGTGTAGCCAGAGGCTGG + Intergenic
1142321449 16:89385809-89385831 GCCGCTGCGCAGCCAGAGGCCGG + Intronic
1143939572 17:10526030-10526052 ACTGCTGCGTAGCCAGTGTCTGG - Intronic
1151546370 17:74795750-74795772 CCCAGTGCTTAGCCAGAGTGTGG - Intronic
1152644059 17:81460776-81460798 CCCGTGGGGTAGGCAGGGTCCGG + Intronic
1154136354 18:11782993-11783015 TCTTTTGCGTAGTCAGAGTCTGG - Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1173917839 20:46722622-46722644 CCTGTTGCATGGCCAGAGTGAGG - Intronic
1177769706 21:25500752-25500774 CTCGTTGAGTAGCCATAGTAAGG + Intergenic
1179628306 21:42660904-42660926 CCCGTTGCGTGACCAGCTTCGGG - Intronic
962807326 3:138936872-138936894 CCAGTTGAGTGGCCACAGTCGGG - Intergenic
976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG + Intronic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
987369658 5:17181552-17181574 CTCATTGCGTAGTCAGCGTCTGG + Intronic
988517333 5:31916367-31916389 GCCCTTGCGTACCCACAGTCAGG + Intronic
991426269 5:66495287-66495309 CCAGTTGAGTTGCCACAGTCTGG - Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1013159896 6:107532863-107532885 CCCTTTCCGTTGCCAGAATCTGG + Intronic
1029207951 7:98880109-98880131 CCCGTCACGTAACCACAGTCTGG + Intronic
1029892459 7:103944810-103944832 CCCAAAGCGTAGCCAGTGTCAGG - Intronic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1058899307 9:109428356-109428378 GCCATTGTGGAGCCAGAGTCTGG - Intronic
1061116721 9:128618105-128618127 CCCGGTGAGTAGTCAGAGGCAGG + Exonic
1185455262 X:307293-307315 CCCGTTTCAGAGCCAGAGACAGG + Intronic
1191863922 X:65688784-65688806 CCAGTTGCAAAACCAGAGTCAGG - Intronic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1196073599 X:111549892-111549914 CCTGTTGCATAGCAAGAGTAAGG - Intergenic