ID: 1131179556

View in Genome Browser
Species Human (GRCh38)
Location 15:90230641-90230663
Sequence AGCTCCCTCTGGATGTCTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131179556_1131179562 -3 Left 1131179556 15:90230641-90230663 CCCCGAGACATCCAGAGGGAGCT 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1131179562 15:90230661-90230683 GCTTTCTGGACCCACACACTGGG 0: 1
1: 0
2: 1
3: 16
4: 136
1131179556_1131179561 -4 Left 1131179556 15:90230641-90230663 CCCCGAGACATCCAGAGGGAGCT 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1131179561 15:90230660-90230682 AGCTTTCTGGACCCACACACTGG 0: 1
1: 0
2: 0
3: 14
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131179556 Original CRISPR AGCTCCCTCTGGATGTCTCG GGG (reversed) Intronic
900616778 1:3569073-3569095 AGCTCCCTCTGGGAGTGTCTGGG - Intronic
901409524 1:9072413-9072435 AGTTCCATCTGGATGTCCAGAGG + Intronic
902464558 1:16608021-16608043 AGTGCCCTCTGGATGTGTCCAGG - Intronic
902743085 1:18453760-18453782 AGCTCCCTCTGGGTTTGTAGTGG - Intergenic
903156248 1:21445684-21445706 AGTGCCCTCTGGATGTGTCTAGG + Intronic
905463908 1:38138818-38138840 AGCTTCCTCTGACTGTCTCTTGG + Intergenic
906677142 1:47701333-47701355 TGCTCCCTCTAGATGTCTGCAGG + Intergenic
907266574 1:53265327-53265349 AGCTCCCCTTGGATGTCCCATGG + Intronic
912880756 1:113410987-113411009 AGATCCATCTGGCTGTCTAGAGG - Intronic
914977076 1:152375878-152375900 AGCTCCATCTGGATATTTCATGG + Intergenic
915118547 1:153614861-153614883 AACTCCCTCTGGAATTCTTGGGG - Exonic
915477745 1:156162922-156162944 TGTTCCCTCTGGCTGTCTCCAGG + Exonic
917094030 1:171382075-171382097 AGCTCCCTCTGCTTGTGTGGAGG - Intergenic
918422865 1:184381795-184381817 AGCTCCTTCTGGATGGTTCCAGG - Intergenic
919153150 1:193725482-193725504 AGATGCCTCTGGATGTCTTATGG - Intergenic
922893118 1:229076940-229076962 AGCTCCTTCTGGATGGCTGTGGG - Intergenic
923525612 1:234770264-234770286 AGCTCCCTCTGCAGGGCTAGGGG - Intergenic
923851742 1:237803627-237803649 AGCTCCATCTGAATGTCCCATGG + Intronic
1062944629 10:1450980-1451002 AGCTCCCTCTGCTTTTCTCAAGG - Intronic
1068037691 10:51781769-51781791 AACTCCCTCTGGATTTCTCAAGG - Intronic
1071016490 10:81002847-81002869 ATCTCTATCTGGATGTCTAGTGG - Intergenic
1072780599 10:98248730-98248752 TGCTCCCTCAGGATGGCTCTGGG - Exonic
1076138593 10:128062456-128062478 AGCTCCCTGTGGGTGTCTGCTGG - Intronic
1077376459 11:2207399-2207421 TGCTCACTCAGGGTGTCTCGTGG + Intergenic
1081291222 11:41328053-41328075 AGTTCCCTGTGAATGTCTCTGGG + Intronic
1084039098 11:66531255-66531277 AGCACCTTCTGTATGGCTCGTGG - Intronic
1085340209 11:75726382-75726404 AGTCCCCAATGGATGTCTCGGGG - Intronic
1086766206 11:90698516-90698538 AGCTTTCTCTGGTTGTCTGGTGG + Intergenic
1091770182 12:3146288-3146310 AGCTTCCCCTGGGTGTCTCAAGG + Intronic
1096628419 12:52909624-52909646 AGGTCCCTCTCCATGTCTCCAGG - Intronic
1101928062 12:108989651-108989673 AGCTCCCTCTGGATTGCCCCTGG - Intronic
1102950631 12:117028434-117028456 AGCTCCCTCAGGACGCCTCAGGG + Exonic
1103027792 12:117587860-117587882 AGCTCCCTCTGGCGGTCGAGGGG + Intronic
1103783837 12:123417367-123417389 AGCTCACTCTGGTTGCCTTGTGG - Intronic
1104798824 12:131539174-131539196 AGGTCCCTATTGATGTCTGGTGG + Intergenic
1106730650 13:32538387-32538409 CGCTCACTCTGGAAGTCTGGAGG - Intronic
1107023172 13:35772995-35773017 ATCCCTCTCTGGTTGTCTCGTGG + Exonic
1107730892 13:43347559-43347581 AACTCCCTCTGGATGGCTACAGG + Intronic
1113494894 13:110719222-110719244 AGCTCCTTCAGGATCTCTGGGGG - Exonic
1120652494 14:87151297-87151319 ATCTCACTCTGGATCTCTCCAGG - Intergenic
1121784908 14:96650034-96650056 AGCTCCCTATGGGAGTCTCAAGG + Intergenic
1122267564 14:100553842-100553864 CGCGCCCTCTGGCTGTCTTGTGG - Intronic
1123804332 15:23855483-23855505 TGCTCCCTCAGGATTTCTGGGGG - Intergenic
1124211551 15:27768946-27768968 ATCTCCCTCTGGCTGCCTCCCGG - Intronic
1125600011 15:40910339-40910361 AACTCCCTCTGGTTTTCTAGTGG + Intergenic
1131179556 15:90230641-90230663 AGCTCCCTCTGGATGTCTCGGGG - Intronic
1132253116 15:100349660-100349682 CGTTACCTCTGGATGCCTCGGGG - Intergenic
1133383931 16:5353770-5353792 TGCTCCCTTAGGACGTCTCGGGG + Intergenic
1137622333 16:49884086-49884108 AGGTCCCTCTGGCTGTTTTGTGG - Intergenic
1137955537 16:52825285-52825307 AGATCACTCTGGATGTTTTGTGG - Intergenic
1138047073 16:53736418-53736440 AGTTCTCTCTGGAAATCTCGGGG + Intronic
1138567014 16:57840965-57840987 AGGTCCCTCTGGCTGCCTGGTGG - Intronic
1141667268 16:85472301-85472323 TGCTCCCTCTGGAGGCCTGGGGG + Intergenic
1153153392 18:2121618-2121640 AGCTCCCTAAGGGTGTCTCTTGG - Intergenic
1153502895 18:5767165-5767187 AGCTCACTCAGGCTGCCTCGAGG - Intergenic
1160700902 19:506863-506885 AGCTCCCTCTGGCGGTCAGGGGG + Intergenic
1163389576 19:17022144-17022166 AGCTCCCTCTGTTTTTCGCGCGG - Exonic
1165340827 19:35211023-35211045 AGCTGCCTCTGCATGTCTTAAGG - Intergenic
1165939062 19:39406375-39406397 ATCTCTCTCTGTATGTCTCTTGG + Intergenic
1165940228 19:39411222-39411244 GGCTTCCTTTGGTTGTCTCGTGG - Intergenic
1166234858 19:41448149-41448171 AGCTCCCTCTGGCTGCCGCGTGG + Intergenic
1168714512 19:58519102-58519124 AGCTCCCTCTGGCTGCCGTGTGG - Intronic
927964837 2:27262392-27262414 AGCTCCCTCTGTAGGCCCCGGGG - Intronic
931441581 2:62294015-62294037 AGCTCCTCCTGGATTTCTCAGGG + Intergenic
941244023 2:163074219-163074241 AACTGCCTCTGGATGTCACTTGG - Intergenic
943980153 2:194539454-194539476 AGCTCCCTATGTAAGTCTCAGGG - Intergenic
947295830 2:228628933-228628955 TGCTCCCTCTGGATGGCTTAGGG - Intergenic
1173945079 20:46944097-46944119 TGCTCCCCCTGGATGGCTCTGGG + Intronic
1173970338 20:47147646-47147668 AGCTGCCTCTGGCTGCCTGGTGG + Intronic
1179979371 21:44888361-44888383 ATCTCCCGCTGGATGCCTCATGG - Intronic
1181764251 22:25079853-25079875 AGGTCCCTCTGGCTGTCATGTGG + Intronic
1183373339 22:37448160-37448182 AGCCCCCTCAGGCTGTCTCTGGG + Intergenic
1184266387 22:43349107-43349129 AGCTCCCGCTGGAAGACTCCGGG - Intergenic
1184274142 22:43400585-43400607 TGCTCCCTCTGGCTGCCTTGGGG + Intergenic
953569909 3:44063118-44063140 AACTCCATCTGGCTGTCTCTTGG - Intergenic
954334136 3:49906357-49906379 AGATCCCTCTGAAAGTCTGGAGG - Intronic
955069904 3:55563664-55563686 AGCTCCCTTTAGATGGCTGGGGG - Intronic
955768384 3:62368070-62368092 AGCTTCCTCAGGCTGTCGCGGGG - Intergenic
956651776 3:71510646-71510668 AGCCCCCTCTGCAGGTCTGGTGG - Intronic
957409525 3:79820249-79820271 AGCTCTCTGTGGTTGTCTCCTGG - Intergenic
959805122 3:110541904-110541926 TGCTTTCTCTGGATGTCTGGAGG - Intergenic
961603062 3:128075780-128075802 AGCTCCCGCGGGGTGCCTCGCGG + Intronic
964016585 3:151954656-151954678 AGCTCCCTATGTATTTCTAGTGG - Intergenic
966560414 3:181313605-181313627 AGCTCCATCAGGAGGTCTCCTGG - Intergenic
977719700 4:100224695-100224717 AGCTCCCTATGTAAGTCTCAGGG + Intergenic
979178142 4:117691493-117691515 AGCTCCCTATGTCTGTCTGGAGG - Intergenic
979758864 4:124374620-124374642 AGCTCCCTGTGTCTGTCTGGAGG + Intergenic
986398839 5:7359211-7359233 AGCTGCTGCTGGATGACTCGGGG + Intergenic
990952377 5:61311071-61311093 AGCTCCCTCTGTTTGCCTAGGGG - Intergenic
991303345 5:65149918-65149940 AGCTCTCTCTGGAAGGCTCAGGG + Exonic
995809872 5:116093523-116093545 AGCTCCCTATGCCAGTCTCGGGG - Intronic
996567151 5:124892398-124892420 AGCTCCCTCTGGTTGCCGGGAGG + Intergenic
996624537 5:125554265-125554287 AGTTCCCTCTTCATGTCTCAGGG + Intergenic
998385501 5:141754922-141754944 AGCTCCCTCTGGATGGAACAAGG + Intergenic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1003720867 6:8700797-8700819 AGGTCACTCTGGATGTTTTGGGG - Intergenic
1006444012 6:34068828-34068850 AGCTCGCTCTGGTGGTCTCCAGG + Intronic
1012690114 6:102299911-102299933 AGCTCCCTCTGCTAGTCTCAGGG - Intergenic
1012941720 6:105422892-105422914 AGTTCCCTTTGGAGGTCTTGGGG + Intergenic
1017781379 6:157717984-157718006 ATTTCCCTCTGTATGTCTGGGGG + Intronic
1018089594 6:160334138-160334160 GGCTCCCTCTGGGTGTCCCTTGG + Intergenic
1019855786 7:3606056-3606078 AGCTCTGTGTGGATGTCTAGTGG + Intronic
1020560600 7:9726348-9726370 AGCTCCCTCTGTTTTTCGCGCGG + Intergenic
1023350662 7:39317318-39317340 AGCTCCCTCTGGGTGTGTGCTGG - Intronic
1023766621 7:43517612-43517634 AGATCCCACTGGGTGTCTCATGG + Intronic
1036648681 8:10628076-10628098 AGCTGCTTCTGGAGGTCTCCAGG + Intronic
1038149567 8:24930340-24930362 AGCTCCCTCTGGATGATCCTGGG - Intergenic
1042614498 8:70633513-70633535 ATCTCCCTTTGGATGTTTCCTGG + Intronic
1048191041 8:132289403-132289425 AGCTCCCTATGGAAGTCTAGGGG + Intronic
1049126602 8:140794887-140794909 ACCTCCCTCTGGATGTCTGAAGG + Intronic
1057834770 9:98435536-98435558 AGCTCCCTCTGGCTGTGGTGGGG - Intronic
1062288289 9:135783390-135783412 CGCTCCCTCTGGAGGCCTGGGGG - Intronic
1189056037 X:37700480-37700502 AGCTTCTCCTGGATGTCTCAAGG - Intronic
1189296842 X:39924496-39924518 GGCTCTCTCTGGCTGTCTCTCGG + Intergenic
1192980504 X:76334854-76334876 AGGTCCTTCTGGATGTCCCACGG + Intergenic
1201245252 Y:11997118-11997140 AGTTCCCTCTGGATGTTCCAGGG - Intergenic