ID: 1131180891

View in Genome Browser
Species Human (GRCh38)
Location 15:90239106-90239128
Sequence CTATATAAACAGTTGAAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131180889_1131180891 13 Left 1131180889 15:90239070-90239092 CCACATTGTGTATAATAGAATGA 0: 1
1: 0
2: 8
3: 22
4: 276
Right 1131180891 15:90239106-90239128 CTATATAAACAGTTGAAGATTGG 0: 1
1: 0
2: 1
3: 15
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131180891 Original CRISPR CTATATAAACAGTTGAAGAT TGG Intronic
900012150 1:124025-124047 CTATATAAAAAACTGAAGAAAGG - Intergenic
900042210 1:480015-480037 CTATATAAAAAACTGAAGAAAGG - Intergenic
900063650 1:715011-715033 CTATATAAAAAACTGAAGAAAGG - Intergenic
905901615 1:41585160-41585182 CTATGCAAACGGTTGAAGGTTGG + Exonic
905997976 1:42398565-42398587 CTATATAAACAGATACAAATTGG - Intronic
907625924 1:56029294-56029316 CTATAAAACAAGTTGAAAATTGG - Intergenic
907756596 1:57316658-57316680 CTACCTCAAAAGTTGAAGATTGG + Intronic
908205442 1:61843437-61843459 CTAAATAAAAAGATGAATATAGG + Intronic
908872084 1:68624836-68624858 CAAAATATCCAGTTGAAGATTGG - Intergenic
909481091 1:76129537-76129559 CTAAATCAACAGTTAAAGAAGGG - Intronic
912350914 1:109012174-109012196 GTTTATAAACAATTGAACATTGG - Intronic
912422379 1:109552442-109552464 CTATTTAAACAATTAGAGATGGG + Intronic
912780174 1:112539130-112539152 CTATATATACATTTAAAGCTTGG - Intronic
913560815 1:120017572-120017594 CTATAAATACACTTGAAGTTTGG + Intronic
913637312 1:120776030-120776052 CTATAAATACACTTGAAGTTTGG - Intergenic
914045508 1:144088354-144088376 TTATATAAAAATTTGGAGATGGG - Intergenic
914132602 1:144872331-144872353 TTATATAAAAATTTGGAGATGGG + Intergenic
914281398 1:146176985-146177007 CTATAAATACACTTGAAGTTTGG + Intronic
914542443 1:148627920-148627942 CTATAAATACACTTGAAGTTTGG + Intronic
914624190 1:149443323-149443345 CTATAAATACACTTGAAGTTTGG - Intergenic
919256074 1:195127146-195127168 ATATTTAAACAGTTGTAAATTGG + Intergenic
919687544 1:200498250-200498272 CTAAATAAGCATTTGAAGATTGG - Intergenic
919979307 1:202632465-202632487 CTCTATAACCAGTGGAAGAAAGG + Intronic
920536531 1:206740826-206740848 CTATATAAATAGTAGAAAAAGGG - Intergenic
921168855 1:212527702-212527724 TTATATTAACACTTGAAGGTAGG + Intergenic
921699061 1:218246526-218246548 CTATACAAACAATTGCATATTGG + Intergenic
922260578 1:223940501-223940523 CTATATAAAAAACTGAAGAAAGG - Intergenic
922736494 1:227985229-227985251 CTATATAAAAAACTGAAGAAAGG + Intergenic
924388298 1:243522189-243522211 CTATAAAATCAGCTGAAGAAGGG - Intronic
924721825 1:246630290-246630312 CTAAAGAAATGGTTGAAGATTGG + Intronic
1064567985 10:16662715-16662737 ATATCTAACCAGTTGAAGTTTGG - Intronic
1066734726 10:38462852-38462874 CTATATAAAAAACTGAAGAAAGG + Intergenic
1068520189 10:58069060-58069082 GAAAATAAACAGTTGGAGATGGG - Intergenic
1071000962 10:80830003-80830025 CTATTTAAAAAATTTAAGATAGG + Intergenic
1071768226 10:88693488-88693510 TCATATATAAAGTTGAAGATGGG - Intergenic
1071893433 10:90038090-90038112 CTAAATAAACAGTTGTTGATAGG + Intergenic
1072498248 10:95985195-95985217 CTATATTTACAGTTTAATATGGG - Intronic
1073056242 10:100704562-100704584 CTATAGCAACAGTAGAAGACTGG + Intergenic
1073551234 10:104403618-104403640 TTATATAAAAAGTTGGAGTTAGG - Intronic
1076968481 11:116231-116253 CTATATAAAAAACTGAAGAAAGG - Intergenic
1077999564 11:7482758-7482780 TTATCTAAAGAGATGAAGATAGG + Intergenic
1079290053 11:19179869-19179891 CTATATACATATTTGAAGAAAGG - Intergenic
1082729582 11:56778936-56778958 ATATCTAAACAGTTGAAGTATGG + Intergenic
1090901957 11:131039864-131039886 GTAGAGAAACACTTGAAGATTGG + Intergenic
1093163174 12:15773191-15773213 CTATATACACACTTGGACATAGG + Intronic
1093222816 12:16444619-16444641 CTATATAACCAGCTGAAGGAGGG - Intronic
1093244943 12:16724660-16724682 GTATGTAAGCAGTAGAAGATAGG + Intergenic
1093318417 12:17680629-17680651 CTGGATAAAAATTTGAAGATTGG - Intergenic
1093950455 12:25160198-25160220 AAATATAAACACTTCAAGATAGG + Intronic
1094388802 12:29926098-29926120 ATATATAAAGAGTAGAATATTGG - Intergenic
1094733289 12:33202623-33202645 ATATATAAACATGTGAAGCTTGG - Intergenic
1097347284 12:58507214-58507236 CTATATAGACACATGATGATTGG - Intergenic
1097580259 12:61447193-61447215 CCAAATAAATATTTGAAGATGGG + Intergenic
1099260649 12:80377030-80377052 ATATATTTACAGTTGAAAATTGG - Intronic
1099421789 12:82470889-82470911 CTACATGAACAGTTAAAGCTGGG + Intronic
1102790625 12:115642172-115642194 CTATGGAAACAGTAAAAGATCGG + Intergenic
1106759471 13:32853907-32853929 CTATATCAGCAGTTGCAGAATGG - Intergenic
1108005166 13:45938967-45938989 CTATGAAAACAGTTTCAGATTGG + Intergenic
1109155544 13:58905461-58905483 TTAGAAAAACAATTGAAGATAGG - Intergenic
1110071153 13:71179585-71179607 TTAAATAAAAAGTTGAAAATAGG + Intergenic
1110502721 13:76247867-76247889 ATATATAAACACTTGAAGAAGGG - Intergenic
1111381865 13:87465383-87465405 CTATATGACAAGTTAAAGATTGG + Intergenic
1112977406 13:105337781-105337803 ACAAATAAACAGTTGATGATTGG - Intergenic
1114729842 14:24980836-24980858 CTAGAAAAATAGTTGAAGATAGG + Intronic
1115475410 14:33808647-33808669 CTATGTACACAGAGGAAGATGGG - Intergenic
1119967550 14:78933956-78933978 ATTTACAAACAGCTGAAGATGGG - Intronic
1120511287 14:85418278-85418300 TTATATAAATAGATGCAGATAGG + Intergenic
1124494905 15:30180421-30180443 CTCTATAACCAGTGGAAGAAAGG + Intergenic
1124748662 15:32358224-32358246 CTCTATAACCAGTGGAAGAAAGG - Intergenic
1125571422 15:40721835-40721857 CTATATAAAGAATTGAAAACAGG + Intronic
1125864093 15:43028026-43028048 ATATATAAACTGTTTAAGAAAGG + Intronic
1127237307 15:57068498-57068520 AGAAATAAACAGTTGAAGAGGGG - Intronic
1131180891 15:90239106-90239128 CTATATAAACAGTTGAAGATTGG + Intronic
1131619037 15:94047491-94047513 CTATAAAATCTGTTGGAGATGGG + Intergenic
1131788842 15:95942025-95942047 CTATATAAATTGTTCAAAATAGG - Intergenic
1135877940 16:26221853-26221875 CTTTATAAACTTTTGAAGAAAGG + Intergenic
1137070288 16:35898965-35898987 CTATGGAAAGAGTTGAAGATCGG + Intergenic
1137963003 16:52903590-52903612 ATATATGAACAGATGAGGATAGG - Intergenic
1138067551 16:53957931-53957953 CTATTTAAACAATAGAAGATAGG - Intronic
1138159436 16:54739609-54739631 ATATATAAACAGATACAGATAGG - Intergenic
1138834099 16:60412335-60412357 CTATAAAAAGAGTTGAAGACGGG - Intergenic
1140754295 16:78053694-78053716 TTATATAAATATTTGCAGATGGG + Intronic
1140825848 16:78705655-78705677 CTAAATAAACAGTTTTACATGGG - Intronic
1142452195 16:90182889-90182911 CTATATAAAAAACTGAAGAAAGG + Intergenic
1147047093 17:37760885-37760907 CTTAATAGACAGTTGAAGCTGGG - Intergenic
1147566611 17:41540346-41540368 CTATATAAACTGCTGGAGGTAGG - Intergenic
1149118232 17:53126356-53126378 ATACGTAAACAGATGAAGATTGG - Intergenic
1149391776 17:56198682-56198704 CGTTATAAATAGTTGAATATTGG - Intronic
1149900011 17:60467102-60467124 CTATATAGACTGTACAAGATAGG + Intronic
1150600218 17:66644626-66644648 GTATTTAAATATTTGAAGATAGG + Intronic
1150983872 17:70173432-70173454 TTGTATGAAAAGTTGAAGATGGG + Intronic
1152168219 17:78724652-78724674 CTAGATAAACAATGGAAGAGGGG + Intronic
1153033655 18:738344-738366 GTATATATACAGTTTAAAATGGG - Intronic
1154516301 18:15169639-15169661 ATATACAAATAGATGAAGATGGG + Intergenic
1155023038 18:21913946-21913968 CTATATGACTAGTTAAAGATAGG + Intergenic
1155181002 18:23346414-23346436 CTATAAAAATAGTTGAAGGCAGG - Intronic
1155927427 18:31671932-31671954 TTTCATAAACTGTTGAAGATAGG - Intronic
1156783314 18:40878619-40878641 CTGCATAAACAGGTGAAGACAGG + Intergenic
1156879186 18:42055586-42055608 ATATATAAAAAATTGAAGAGTGG + Intronic
1157843383 18:50980040-50980062 TTAAATAAACAGTTGGAGTTGGG + Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1160645290 19:186156-186178 CTATATAAAAAACTGAAGAAAGG - Intergenic
1161291703 19:3497185-3497207 CTATATAAAGCCTTGAATATTGG - Intronic
1161291709 19:3497218-3497240 CTATATAAAGCCTTGAATATTGG - Intronic
1161903108 19:7134468-7134490 TTATAAAAACAGTTGAAGCCCGG + Intronic
1165272923 19:34725801-34725823 CTATGGAAAGGGTTGAAGATCGG - Intergenic
1202685067 1_KI270712v1_random:41762-41784 TTATATAAAAATTTGGAGATGGG - Intergenic
925012003 2:493042-493064 CTAAATAAACATTTGCTGATTGG + Intergenic
926811071 2:16755873-16755895 CTATGCAAACAGCTGAAGATGGG + Intergenic
928960559 2:36921642-36921664 TTATATAAAAATTTGGAGATGGG - Intronic
930222311 2:48756988-48757010 ATCTATAAGCAGTTGAAGAGAGG - Intronic
930423645 2:51185523-51185545 TTATATCAACAGCTTAAGATAGG + Intergenic
930813804 2:55570999-55571021 CAATATAAACATTTAAATATTGG + Intronic
931082795 2:58794424-58794446 TTAGAAAAACACTTGAAGATAGG - Intergenic
931951384 2:67366751-67366773 CTATTTAAACATTTAAAGTTAGG - Intergenic
932145789 2:69315216-69315238 CAATAAAAACAGTTTAAGACTGG - Intergenic
933279613 2:80318491-80318513 CTATATAAAGAGTGGGAGTTGGG + Intronic
934246652 2:90313095-90313117 TTATATAAAAATTTGGAGATGGG + Intergenic
937490516 2:122362506-122362528 CTACATAGACAGTAGAAGAAAGG - Intergenic
939741652 2:145915532-145915554 CTAAATAAACATTTGATGATTGG - Intergenic
942779573 2:179625518-179625540 ATATATAAACAGATGAATAAAGG + Intronic
943055770 2:182976941-182976963 CTATTACTACAGTTGAAGATGGG - Exonic
944562782 2:200957691-200957713 CTATATAAACTGTGGAAGAGTGG - Intronic
945628774 2:212244521-212244543 AAATATAAACAGGTTAAGATGGG - Intronic
946120632 2:217510865-217510887 TTAAATATACAGTTGTAGATAGG + Intronic
949083637 2:242127532-242127554 CTATATAAAAAACTGAAGAAAGG + Intergenic
1169621021 20:7506666-7506688 CAAAATAAACCCTTGAAGATAGG - Intergenic
1173368236 20:42408836-42408858 CTAGATAAACAGTGGCAGATTGG + Intronic
1178259051 21:31082071-31082093 CTATAATAATAGTGGAAGATAGG + Intergenic
1178490031 21:33044034-33044056 CTACTGAAATAGTTGAAGATAGG + Intergenic
1182031953 22:27166154-27166176 CTATATAATAAAATGAAGATGGG + Intergenic
953678261 3:45020195-45020217 CTGGATACACAGTTGTAGATAGG - Intronic
955217328 3:56995180-56995202 CTTTACAAAGAGTTGAAAATTGG - Intronic
957124519 3:76141703-76141725 CTAAATAAGTATTTGAAGATTGG + Intronic
957995984 3:87690812-87690834 CTTTATAAACAGGAGAAGTTTGG + Intergenic
958767942 3:98393525-98393547 CTATATACACATTTGGTGATAGG - Intergenic
962699889 3:137987389-137987411 CTAAATAAACAGTGGGAGAAAGG + Intergenic
963519202 3:146344350-146344372 CTATATGACCAGGTGAAAATAGG - Intergenic
963699276 3:148603950-148603972 CTATGTAGACAGATAAAGATGGG + Intergenic
964099092 3:152967025-152967047 CTATATTAACATTTTAAGTTAGG + Intergenic
964285601 3:155114431-155114453 CTATATAAACAAATGCAAATTGG + Intronic
968372393 3:198233370-198233392 CTATATAAAAAACTGAAGAAAGG + Intergenic
969335657 4:6508282-6508304 CAATAGAAACAGCTGAAGCTGGG + Intronic
971906776 4:32736311-32736333 CTTTATAACAAGTTGAAGTTAGG - Intergenic
972491163 4:39588412-39588434 CTAAATACACAGTTCAAAATTGG + Intronic
972836886 4:42882043-42882065 GTACAGAAACAGTTAAAGATAGG - Intergenic
973171671 4:47152717-47152739 CGATAAGAAGAGTTGAAGATTGG - Intronic
974569115 4:63621143-63621165 ATATTTAAACATTTGAAGAGTGG - Intergenic
974799240 4:66794574-66794596 CTTTATAGACTGTTGCAGATGGG + Intergenic
975102735 4:70533022-70533044 GAATATAAACACTTGAGGATAGG - Intergenic
975408350 4:74018228-74018250 AGATATAAACAGTTGGATATAGG + Intergenic
975876512 4:78844565-78844587 TTATAAAAACAGTTTTAGATAGG + Intronic
975996115 4:80317967-80317989 TTATATAAAATGTTCAAGATAGG + Intronic
976637401 4:87300708-87300730 CTTTGCATACAGTTGAAGATTGG + Intergenic
977245686 4:94628640-94628662 TTGTATAAATAGTTGAAAATTGG + Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
979041151 4:115797277-115797299 CTATAAAAATAGTTGTATATTGG - Intergenic
979048853 4:115904106-115904128 CTTTAAAAGTAGTTGAAGATTGG + Intergenic
979261080 4:118645829-118645851 CTATATAAAAAACTGAAGAAAGG + Intergenic
979391577 4:120134841-120134863 CTATATACACACATGTAGATAGG - Intergenic
980393360 4:132174780-132174802 CTACATGAACATTTGAAGGTAGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982034666 4:151333979-151334001 CTATATAAACAGGTGAAATTTGG - Intergenic
982672586 4:158339280-158339302 TTTTATTAAAAGTTGAAGATAGG - Intronic
983042314 4:162944199-162944221 CTATGTATACAGTTTAAAATGGG + Intergenic
983150763 4:164277487-164277509 CTATATAAAAAACTGAAGAAAGG - Intronic
988167474 5:27613179-27613201 CAATATAAACAGCTCAAGAAAGG + Intergenic
988197161 5:28018902-28018924 CTTTATAAACATGTGAAGACAGG - Intergenic
988369157 5:30345464-30345486 CTTTTTAAACATTAGAAGATTGG - Intergenic
989178232 5:38551127-38551149 CCATAGAAACAGTTAAAGTTAGG - Intronic
989539532 5:42602814-42602836 CAATATAAACAGATGTACATTGG - Intronic
990763573 5:59157683-59157705 CTAGTTAAACAGTTGAAGAGAGG + Intronic
991135685 5:63179436-63179458 CTATATTGAAAGTTGAAGTTGGG + Intergenic
993161215 5:84293965-84293987 TTATATAAACATTTGCAAATGGG - Intronic
994319668 5:98378464-98378486 GTATGTATACAGTTGAAGTTTGG + Intergenic
994650927 5:102526871-102526893 CTTATTCAACAGTTGAAGATTGG + Intergenic
994981378 5:106878381-106878403 TTATATAAACATTTAAATATAGG - Intergenic
996015534 5:118530064-118530086 TTATCTAAACAGTAGAAGACAGG - Intergenic
996957218 5:129198129-129198151 CTATACAAACACTTGAAGTTTGG + Intergenic
998702666 5:144721648-144721670 CCTTATAAAGAGTTGTAGATGGG + Intergenic
998840299 5:146246379-146246401 CTATATGAACAATTTAAGATGGG + Intronic
999353564 5:150902618-150902640 TTATAAAAACAGTTGGAGAATGG + Intronic
1002731633 5:181338914-181338936 CTATATAAAAAACTGAAGAAAGG + Intergenic
1004443161 6:15672657-15672679 CTATATTAAAAGATGAAGACAGG - Intergenic
1007994809 6:46295523-46295545 CTGTATCAAAAGTTGAAGAGGGG + Intronic
1012053673 6:94377032-94377054 TCATAAAATCAGTTGAAGATGGG - Intergenic
1014879839 6:126710114-126710136 CTATAAAATCAGGTGAATATAGG + Intergenic
1015157766 6:130116105-130116127 CTATTTTAATAGTTGAAGAAAGG + Intronic
1015553537 6:134437317-134437339 CCATATAAACACCTGAAGAGAGG + Intergenic
1015921485 6:138270363-138270385 CTATATAAACTCCTGAAAATTGG - Intronic
1016107620 6:140181997-140182019 ATATAGAAACAGTGAAAGATTGG - Intergenic
1016113552 6:140256156-140256178 CTATATAAAAAGGTGAAATTTGG + Intergenic
1016129529 6:140449226-140449248 CTAAAAAAATAGTTGAAGAGGGG + Intergenic
1019853277 7:3580666-3580688 CTATAAAAACTCTGGAAGATGGG + Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1021107102 7:16649874-16649896 CTATGTTAACAGTTGAAGATGGG + Intronic
1021684268 7:23167480-23167502 TTATATAAACATTTGAAGTATGG + Intronic
1023727142 7:43154965-43154987 CTAAATACAAAGTTCAAGATTGG - Intronic
1027948047 7:84776510-84776532 TTATAGAAACAGTAGAAGGTTGG - Intergenic
1028170923 7:87594813-87594835 CTATAAAAATAGTTGTAGGTAGG - Intronic
1028940022 7:96511341-96511363 CAATATAATCAGTTTAAGAGAGG + Intronic
1030794621 7:113772217-113772239 CTATTTAATCAGTAGAAAATGGG - Intergenic
1035511883 8:195365-195387 CTATATAAAAAACTGAAGAAAGG - Intronic
1043465531 8:80502825-80502847 CTATGTAAACAAATGAAGGTAGG + Intronic
1043785550 8:84394101-84394123 CTGTAGAAACAGTGGAAGACTGG - Intronic
1044649485 8:94479546-94479568 ATATGTAAACAGTTGAGGAGCGG + Intergenic
1045598114 8:103680611-103680633 ATATATACATAGTTGAACATAGG - Intronic
1047064922 8:121270809-121270831 CTATATAAAAATTTGAATAGAGG + Intergenic
1047312244 8:123701960-123701982 ATATATAGAAAGATGAAGATGGG - Intronic
1050695006 9:8268999-8269021 CTAAATAAATAGTTGAATAATGG - Intergenic
1051291489 9:15550189-15550211 GGATATAAAGAGTTGAATATTGG + Intergenic
1051848480 9:21479903-21479925 CTTTTTAAAAAGTTGAAAATAGG - Intergenic
1052088426 9:24296185-24296207 ATATATAAGCAGCTGAAGAGAGG + Intergenic
1057920859 9:99095450-99095472 CTCTATAATTAGATGAAGATGGG + Intergenic
1058619365 9:106866026-106866048 TTAGATGAACTGTTGAAGATAGG + Intronic
1062756039 9:138291424-138291446 CTATATAAAAAACTGAAGAAAGG + Intergenic
1186899646 X:14040086-14040108 CTCTACTAACAGATGAAGATAGG - Intergenic
1188667900 X:32847044-32847066 CTATATATACACAAGAAGATTGG - Intronic
1193186463 X:78519467-78519489 CTCTAGAAACAGTTTAAGAAGGG - Intergenic
1194458000 X:94128409-94128431 TTATATAATCTGTGGAAGATAGG - Intergenic
1195511200 X:105717246-105717268 CTAGAAAAAGAGTTGAAAATTGG + Intronic
1195941748 X:110173113-110173135 CTTTATAAACAGGTGGGGATTGG + Intronic
1196284394 X:113863190-113863212 CTAGATAAACTTATGAAGATGGG - Intergenic
1201374456 Y:13301522-13301544 ATATCTAAAAAGTTAAAGATTGG - Intronic
1202382544 Y:24288241-24288263 CTATATAAAAAACTGAAGAAAGG + Intergenic
1202488240 Y:25381884-25381906 CTATATAAAAAACTGAAGAAAGG - Intergenic
1202588532 Y:26457687-26457709 TTATATAAAAATTTGGAGATGGG + Intergenic