ID: 1131184707

View in Genome Browser
Species Human (GRCh38)
Location 15:90264815-90264837
Sequence GAGTCAGATGCCACTCTTTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131184707_1131184709 6 Left 1131184707 15:90264815-90264837 CCGGAAAGAGTGGCATCTGACTC 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1131184709 15:90264844-90264866 TGAATGCACCTTGCCCTCCATGG 0: 1
1: 0
2: 3
3: 22
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131184707 Original CRISPR GAGTCAGATGCCACTCTTTC CGG (reversed) Exonic
900543658 1:3216669-3216691 GAGTCAGGAGCCACACTGTCCGG + Intronic
900872173 1:5311955-5311977 GAGTCAGAAGCAGCTCTTGCAGG + Intergenic
902633191 1:17718096-17718118 GAGGCTGAGGCCACTCTCTCTGG - Intergenic
902810537 1:18885568-18885590 GCTTCAGGTCCCACTCTTTCCGG + Exonic
905249529 1:36638979-36639001 GTGTCAGAGGCCTCTCTGTCGGG - Intergenic
909516324 1:76511348-76511370 GAGGCGGAATCCACTCTTTCTGG - Intronic
916396065 1:164388858-164388880 AAGGCAGATACCACACTTTCAGG + Intergenic
921076109 1:211701334-211701356 CTGTCAGATCCCACACTTTCAGG - Intergenic
921199606 1:212792294-212792316 GGCTGAGATGCCACTCTTTGTGG + Intronic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
1068220553 10:54039789-54039811 GACTCTGTTGCCTCTCTTTCTGG + Intronic
1068770196 10:60812139-60812161 CATTCAGATACCATTCTTTCTGG + Intergenic
1069581741 10:69571377-69571399 GAGAGGGATGACACTCTTTCTGG - Intergenic
1070594274 10:77821365-77821387 GAGTCAGAAGCCACTCTGGTGGG - Exonic
1073824066 10:107300169-107300191 GAGTCAGAAACCACCATTTCAGG - Intergenic
1077369268 11:2173956-2173978 GAGGCAAATGAGACTCTTTCTGG - Intergenic
1080865149 11:36187619-36187641 AAGTCAGATGAAACTCTTTTGGG - Intronic
1083660651 11:64250504-64250526 GAGCCAGCTGCATCTCTTTCTGG + Intergenic
1084744906 11:71163631-71163653 GTGTGAGCTGCCTCTCTTTCTGG - Intronic
1094352369 12:29541331-29541353 GAGTGAGACGCCAGTCCTTCTGG - Intronic
1094487880 12:30939256-30939278 GAGGCAGGTGCCACTCCTTCTGG - Intronic
1094752497 12:33428285-33428307 GATTCAGATCCCACTATTTAAGG - Intronic
1095086734 12:38064611-38064633 ATGTCAGAAGCCACTGTTTCAGG + Intergenic
1097179963 12:57166188-57166210 GAGTCCAATGCCACTTGTTCAGG + Exonic
1103897444 12:124282641-124282663 GAGTTAGAGACCACTCTTTCTGG + Intronic
1103969059 12:124658412-124658434 GAGTAATATTCCATTCTTTCTGG + Intergenic
1106996983 13:35496264-35496286 GAGTCACATGCCACTGTGCCTGG + Intronic
1107185261 13:37510585-37510607 GAGCCAGTTGCCACATTTTCAGG - Intergenic
1108093975 13:46881007-46881029 AAGTCAGCTGCCACTCTGGCAGG + Intronic
1111551118 13:89814147-89814169 GAGTCATAGGCCACCATTTCTGG + Intergenic
1115396029 14:32909513-32909535 GAGTCTGATTCCATTTTTTCAGG + Intergenic
1129466501 15:75727195-75727217 GTACCAGATGCCACTCTTGCTGG + Exonic
1131184707 15:90264815-90264837 GAGTCAGATGCCACTCTTTCCGG - Exonic
1134148133 16:11784132-11784154 GAGTAAAATGGCACTATTTCTGG + Intronic
1134206881 16:12245716-12245738 GAAACAGATGCCACTCCTGCAGG - Intronic
1135382463 16:22006625-22006647 GAGACAGATGTCACTCTTCTAGG + Intergenic
1140299947 16:73747434-73747456 GAGACAGATGCAAATGTTTCTGG - Intergenic
1140770258 16:78197237-78197259 GAGTCAGATGGCCCTCAATCTGG - Intronic
1144172472 17:12671640-12671662 AAGACAAATGCCACTCTTCCTGG - Intronic
1151229959 17:72677396-72677418 TGGTCAGATGCCACTCCTTTCGG + Intronic
1151479917 17:74364010-74364032 GAGTCAGAGGTGACTCTTCCGGG - Intergenic
1151992098 17:77582044-77582066 CAGACAGATGCCATTCTTCCCGG + Intergenic
1153580276 18:6566204-6566226 ACTTCAGAAGCCACTCTTTCTGG + Intronic
1155700994 18:28743457-28743479 GAGCCAGATGTCACTATTGCAGG + Intergenic
1163157470 19:15447326-15447348 CATTCAAATGCCACTCTATCAGG + Intronic
1163402999 19:17105647-17105669 GGGTCAGACCCCACCCTTTCTGG + Intronic
925888727 2:8415830-8415852 GAGTAAGATGACACTCATTTGGG - Intergenic
926674444 2:15608819-15608841 CAGGCACATGCCACTGTTTCAGG + Intronic
937987647 2:127645700-127645722 GAGTGAGAGGCGACTCTTTGAGG - Intronic
938809249 2:134837050-134837072 GAGTCTGAAGCCACATTTTCTGG + Intergenic
939986951 2:148838893-148838915 AAGTCAGATGCTAGTCTTTCTGG + Intergenic
940976211 2:159947888-159947910 CAGTCAGCTGCCACTCTCTCTGG - Intronic
943401693 2:187419925-187419947 GAGTCATATGCTAATCTTTGTGG + Intronic
1169502740 20:6176869-6176891 GATTCAGATGCCATACTTTTTGG + Intergenic
1169514889 20:6304875-6304897 GAGTCAGATGGCATCTTTTCTGG + Intergenic
1172241585 20:33416442-33416464 GAGGCAAGTGCCACCCTTTCTGG + Intronic
1172307025 20:33888124-33888146 GTGCCAGCTGCCTCTCTTTCAGG + Intergenic
1172390144 20:34560241-34560263 GAGCCAGGGGCCAGTCTTTCAGG - Exonic
1173703186 20:45091304-45091326 GAGTCATATGCCTCTCTCTTGGG - Intergenic
1181059385 22:20274588-20274610 GAGGCAGAGGACCCTCTTTCTGG - Intronic
956761743 3:72449789-72449811 GAGTCAAATGGGACTATTTCTGG + Intergenic
959688615 3:109174852-109174874 GAGTCAAGTGCCACTTTTTGTGG + Intergenic
962384630 3:134922908-134922930 GATTCAGTTGCCCCTGTTTCAGG + Intronic
962432095 3:135329266-135329288 GGGCCAGAGGCCACTCTTCCTGG - Intergenic
962499836 3:135980101-135980123 GTGCCTGAGGCCACTCTTTCGGG - Intronic
962986033 3:140536845-140536867 GTCCCAGATTCCACTCTTTCTGG - Intronic
965246130 3:166272076-166272098 GAGTCAGATATTATTCTTTCAGG - Intergenic
965882730 3:173406633-173406655 CAGTCAGATGCTACTATTTGTGG + Intronic
966062331 3:175773249-175773271 GAGGCAAATGACACTCTTTGAGG - Intronic
966351390 3:179035842-179035864 GAGTCAGTTGCCCCCTTTTCAGG - Intronic
974343591 4:60648052-60648074 GAGTCAGCCGCCACCCCTTCTGG + Intergenic
974725172 4:65789507-65789529 CAGTCATATGCCACTCTCTAGGG + Intergenic
983717522 4:170803087-170803109 GAGTCAGCTACCACTGTTGCTGG - Intergenic
983840102 4:172447332-172447354 GAATCAAATGTCACTCTTCCTGG + Intronic
988492752 5:31718402-31718424 GACTAAGATGCCTTTCTTTCAGG - Intronic
990829247 5:59938395-59938417 AAGTCAGATCCAGCTCTTTCTGG + Intronic
995029766 5:107466799-107466821 GAGTCAAATGCCAATGCTTCTGG - Intronic
995501567 5:112812619-112812641 AATTCAGATGCCACTTTTTCAGG + Intronic
1000846682 5:166290593-166290615 GAGTGAGTTCCCACTCTTGCAGG - Intergenic
1003892280 6:10574179-10574201 CAGTCAGATGCCACCATTTATGG - Intronic
1004063963 6:12224909-12224931 GAGTCAGATGGCTCTTTTTCTGG + Intergenic
1004322546 6:14643852-14643874 GAATCAGAAACCATTCTTTCTGG - Intergenic
1008888307 6:56455519-56455541 AAATCAGATGAGACTCTTTCTGG - Intergenic
1010302555 6:74279139-74279161 AAGTCAGCTGCCATGCTTTCAGG - Intergenic
1014765913 6:125406560-125406582 GAGGAAGATCCCAATCTTTCTGG - Intergenic
1020247795 7:6443514-6443536 CAGGCACATGCCACTCTTGCTGG + Intronic
1021627102 7:22604054-22604076 GAGTCAGAGTCCACTCTATCAGG + Intronic
1022261010 7:28704917-28704939 GAGTCAGTAGACACTCTTGCTGG + Intronic
1023091458 7:36621326-36621348 GAGGGAGAGGCCACTATTTCTGG + Intronic
1023174522 7:37423050-37423072 GACTCAGGTCCCACTCCTTCAGG + Intronic
1024657357 7:51462584-51462606 GAATCAAATGCCACTAATTCAGG - Intergenic
1026018981 7:66693693-66693715 GACTCAGATGGCACCATTTCAGG + Intronic
1029049052 7:97664232-97664254 GAGGCATTTGCCATTCTTTCTGG - Intergenic
1031935614 7:127732575-127732597 GTTAAAGATGCCACTCTTTCTGG - Intronic
1034517235 7:151590458-151590480 CAGTCAGATGTCCCTCTGTCCGG - Intronic
1035530675 8:348475-348497 GAGTGAGATAACACTATTTCAGG + Intergenic
1037698966 8:21254925-21254947 GATTCAGATACTAGTCTTTCAGG + Intergenic
1039238317 8:35527304-35527326 GCGACAGATGCCCATCTTTCAGG - Intronic
1039893100 8:41697601-41697623 GCGTCCGAGTCCACTCTTTCTGG + Intronic
1041823072 8:62062039-62062061 GAGACAGAAGCCAGTCTCTCAGG - Intergenic
1042427317 8:68663077-68663099 TAGTCATATCCCTCTCTTTCTGG - Intronic
1046989213 8:120430572-120430594 GACTCAGATGTCACAGTTTCTGG - Intronic
1047988708 8:130263307-130263329 CAGTCAGATCCCACCCTCTCAGG + Intronic
1051428656 9:16960198-16960220 GAGTCAGAGCACACTCTTTGGGG + Intergenic
1058171391 9:101685410-101685432 TAGTCAGATACCACTGTTCCAGG + Intronic
1058696115 9:107560396-107560418 GAGTCATATTACCCTCTTTCTGG + Intergenic
1058813296 9:108661542-108661564 GAGTCAGTTGCCTCTCTTGGGGG - Intergenic
1059562935 9:115352746-115352768 GATTCAAATGTCACTTTTTCAGG + Intronic
1060886682 9:127159455-127159477 TGGTCAGAGGCCACGCTTTCTGG - Intronic
1061600417 9:131666183-131666205 GAGTCAGAGACAACTCATTCAGG + Intronic
1062333129 9:136053211-136053233 GAGCCAGATGGCCCTCTCTCTGG - Intronic
1186140676 X:6568633-6568655 GAGTCAGATGCGACTTTTTATGG + Intergenic
1190138479 X:47818998-47819020 GAGTCACTTGACACTCTTTGGGG - Intergenic
1191725167 X:64271709-64271731 GAGACAGAAGCCAGTCTTTCAGG - Intronic
1197126021 X:122947272-122947294 GATTCAGCAGCCACTATTTCTGG + Intergenic
1198109863 X:133493596-133493618 GAGACAAATGCCTCTCTTTGGGG - Intergenic
1199983404 X:152933529-152933551 GAGTCAGGGGCCACTTTCTCAGG + Intronic
1201148533 Y:11081260-11081282 GGGTGAGATGCCTCTCTTTCTGG - Intergenic