ID: 1131184990

View in Genome Browser
Species Human (GRCh38)
Location 15:90266251-90266273
Sequence CCACGCATGGCTTCTGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131184986_1131184990 7 Left 1131184986 15:90266221-90266243 CCTGAGGCTCTTCAAACATCCAT 0: 3
1: 0
2: 0
3: 15
4: 135
Right 1131184990 15:90266251-90266273 CCACGCATGGCTTCTGCCATTGG 0: 1
1: 1
2: 2
3: 17
4: 125
1131184985_1131184990 18 Left 1131184985 15:90266210-90266232 CCATGATTTAGCCTGAGGCTCTT 0: 2
1: 0
2: 0
3: 10
4: 135
Right 1131184990 15:90266251-90266273 CCACGCATGGCTTCTGCCATTGG 0: 1
1: 1
2: 2
3: 17
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131184990 Original CRISPR CCACGCATGGCTTCTGCCAT TGG Intronic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
900618216 1:3574931-3574953 CCACGCCTGGCTTGAGCCAAAGG + Intronic
905297272 1:36962146-36962168 CGAGGCATGGCTTCTGCCCCTGG + Intronic
907616713 1:55933836-55933858 CCCCTCCTGGCTTCTGCCACAGG + Intergenic
910763958 1:90762096-90762118 CCCTGCATGGCTGCTGCCAGTGG + Intergenic
912102981 1:106234317-106234339 GCCCCCATGGCTGCTGCCATGGG - Intergenic
921360985 1:214330989-214331011 TCTCGGATGGCTTCTGCCTTTGG - Exonic
1066196520 10:33105798-33105820 CCAGGAATGCCTTCTTCCATAGG + Intergenic
1070762833 10:79035398-79035420 CCTAGCATGGCATCTGGCATGGG + Intergenic
1074701294 10:116095016-116095038 CAATGCATTGCCTCTGCCATTGG + Intronic
1075212325 10:120501879-120501901 CCACCCAGGGCCTCTGCAATGGG - Intronic
1076916879 10:133427394-133427416 CCAAGGGTGGCTCCTGCCATCGG + Intergenic
1079535991 11:21516025-21516047 CCACACATGGCTTCTGCCCTCGG - Intronic
1080661965 11:34303931-34303953 CCACGCCTGGCCTCAGCTATGGG + Intronic
1081044028 11:38250011-38250033 CCACAAGTGGCTTCTGCTATGGG + Intergenic
1083735173 11:64676095-64676117 CCCCGCATGGCCTCTGACAGGGG - Intronic
1084217070 11:67653778-67653800 ATCCGCATGGCTTCTGCCACTGG - Intergenic
1084220260 11:67673621-67673643 CCAGGCATGGCCACTGCCAAGGG - Intronic
1085223325 11:74895209-74895231 CACCACATGGCTTCTGCCAGGGG - Intronic
1085841437 11:80015926-80015948 CAGCGTATGGCTTCTCCCATTGG + Intergenic
1086268143 11:85027702-85027724 CCACACATGGCTTCAGCTATAGG + Intronic
1086946973 11:92853301-92853323 CCACACATGGCTTCTGCTGCAGG + Intronic
1089528850 11:119113698-119113720 CCACTCACGGCTGCTGCTATGGG - Exonic
1092862980 12:12735530-12735552 GCACTCATTCCTTCTGCCATTGG - Intronic
1094454535 12:30617682-30617704 CCTGGCATGCCTTCTGCCCTTGG - Intergenic
1099214648 12:79839016-79839038 CCACTCCTGGCTTCTTTCATGGG - Intronic
1100820116 12:98422342-98422364 CCACCAAGGGCTTCTGCCCTGGG - Intergenic
1101902028 12:108798032-108798054 CCACACCTGGATGCTGCCATGGG + Intronic
1103173786 12:118844320-118844342 CCACGCATGGCTTCCACTGTGGG - Intergenic
1104152052 12:126093230-126093252 CCATGCATGGCCTCTGCTCTGGG - Intergenic
1106651463 13:31694864-31694886 CCATGGCTGGCTTCTGCCAGTGG - Intergenic
1109158045 13:58935947-58935969 CCACAAGTGGCTTCTGCCTTGGG + Intergenic
1109572121 13:64206714-64206736 CCACAAATGGCTTCTGCCTTGGG + Intergenic
1110260061 13:73474920-73474942 CCACACATGGCCTCTGGCACTGG - Intergenic
1120492771 14:85197577-85197599 CCACGCATAGCTACTACCTTTGG + Intergenic
1121527933 14:94632492-94632514 CCACACGTGGCTTCTGTTATGGG + Intergenic
1121666555 14:95676849-95676871 CCACCCATAGGTGCTGCCATGGG + Intergenic
1129700309 15:77763857-77763879 AAACACAGGGCTTCTGCCATGGG + Intronic
1129779832 15:78263473-78263495 CCTCCCTTGGCTTCTGCCAGGGG - Intergenic
1131184990 15:90266251-90266273 CCACGCATGGCTTCTGCCATTGG + Intronic
1135397649 16:22143454-22143476 CCAGGGATGGCATCTGCCATCGG - Intronic
1136070305 16:27783380-27783402 CCACTCACAGCTTCTGCCACAGG + Intergenic
1137657120 16:50169862-50169884 CCAGGTATGGCTTCTGACAAAGG - Intronic
1137815728 16:51395866-51395888 CCCCACATGGATGCTGCCATGGG + Intergenic
1139613405 16:68074845-68074867 CCACCCTTGGCTTATGGCATTGG + Intronic
1143272691 17:5687528-5687550 GCACGCATGCATTCTGACATGGG - Intergenic
1148838169 17:50477500-50477522 CCGCGCCCGGCTTCTGCCCTGGG + Intergenic
1151389819 17:73778646-73778668 CCATGCATGGCTTCTGTAATGGG - Intergenic
1153157520 18:2166521-2166543 CTGCGCATTGCTTCTACCATTGG - Intergenic
1156651616 18:39233211-39233233 CCACACCTGGATGCTGCCATGGG - Intergenic
1161619037 19:5288862-5288884 CCCAACATGGCTTCTGCCGTGGG - Intronic
1164549769 19:29199726-29199748 CCATGCCTGGCCTCTGCTATAGG + Intergenic
1164936800 19:32221058-32221080 CCTGGCTTGCCTTCTGCCATGGG - Intergenic
931474494 2:62573325-62573347 CCAGGCATGACTTCTGCTAGGGG - Intergenic
932672257 2:73748454-73748476 TCAGGCATAGCTTCTGCCCTGGG - Intergenic
932826015 2:74940913-74940935 CCAGGGATGGCTGCTTCCATGGG + Intergenic
933725708 2:85425950-85425972 CCTCACCTGGCTTCTGCAATTGG + Intronic
933850086 2:86359016-86359038 CCAGCCATGGGTTCTGCCAGAGG + Intergenic
936445814 2:112594308-112594330 CCAGCCCTGGCTTCTGCCTTGGG + Intergenic
937516622 2:122662695-122662717 CCATGCTGGTCTTCTGCCATTGG + Intergenic
940667636 2:156628127-156628149 GCAAGCATGGCTACTGCCTTGGG - Intergenic
943320376 2:186436538-186436560 CCACCCAGGGCTTTTGCCCTGGG - Intergenic
943928399 2:193819048-193819070 CCACACGTGGCTTCTGCTACAGG + Intergenic
946542753 2:220703423-220703445 CCACACATACCTTCTGCCATTGG + Intergenic
1169128664 20:3150450-3150472 TCTCTCATGGTTTCTGCCATGGG - Intronic
1169740830 20:8892529-8892551 CTAGGCATTGATTCTGCCATAGG + Intronic
1169980988 20:11383713-11383735 CCACACATGGCTTCTTCACTTGG + Intergenic
1172021312 20:31916250-31916272 TCACACATCACTTCTGCCATAGG + Intronic
1173008324 20:39157897-39157919 CCGGACATGGCTTTTGCCATTGG + Intergenic
1175277143 20:57779914-57779936 CCACGTATGGCCTCTCCCCTGGG + Intergenic
1176236317 20:64055414-64055436 CCACACATGGCTTTTGCCCTTGG + Intronic
1176236333 20:64055472-64055494 CCACACGTGGCTTTTGCCCTTGG + Intronic
1176410789 21:6448409-6448431 CCAAGCCTGGCCTCTGCCATGGG - Intergenic
1179686282 21:43056731-43056753 CCAAGCCTGGCCTCTGCCATGGG - Intronic
1181674946 22:24445287-24445309 CCCCGCATGGCTGCTGCTACGGG + Intergenic
1182398580 22:30056120-30056142 CAACTCATGGCTTCTTCCATGGG + Intergenic
1183502398 22:38188791-38188813 CCAGGCCTGGCTTTTGCCCTTGG - Intronic
1185255988 22:49831867-49831889 ACACGCATCACTTCTGCCATAGG + Intergenic
954689957 3:52390524-52390546 CCACGCCTGGCCTCTGCCTATGG - Intronic
960137298 3:114118875-114118897 CTAAGCATGCCTTCTGCCAGAGG + Intergenic
960467386 3:118013941-118013963 CCACTCTTGCCTTCTGTCATAGG - Intergenic
960704743 3:120471022-120471044 CCACGCCTGGGTTGTGCCAAAGG - Intergenic
961215418 3:125156152-125156174 CCACACATGGCCTCTCCCATTGG - Intronic
965077894 3:164002566-164002588 CCGTGCATGGCTTCTGCCATTGG - Intergenic
965441462 3:168720467-168720489 CCACTTCTGCCTTCTGCCATGGG - Intergenic
967763763 3:193254717-193254739 CCTAGCATGGCTTCTGGAATCGG + Intronic
968614824 4:1572704-1572726 CCCCACCTGGCTTCTGCCACAGG - Intergenic
969588898 4:8110091-8110113 CCACGCATGGCCCAGGCCATGGG + Intronic
970709298 4:18843084-18843106 CCACGAATGGCAGGTGCCATAGG - Intergenic
971052597 4:22877900-22877922 CCACTCATCTCTTTTGCCATCGG + Intergenic
971876743 4:32318279-32318301 CTGCACATGGCTTCTGCTATAGG + Intergenic
974067656 4:57094711-57094733 CCACACTTGGGTTCTGCCCTCGG + Intronic
974987165 4:69042246-69042268 CCACCCCTGGATGCTGCCATGGG + Intronic
978944034 4:114472665-114472687 CCGCAAATGGCTTCTGCCTTAGG - Intergenic
981348428 4:143700678-143700700 CCACGGATGGCTCCTGGCGTTGG + Intergenic
982442026 4:155447674-155447696 CCCCACTTGGCTTTTGCCATGGG - Intergenic
985969101 5:3361400-3361422 CTTCTCATGGCATCTGCCATAGG + Intergenic
986531422 5:8740497-8740519 CCACGCATTGCCTTTTCCATAGG + Intergenic
987830265 5:23086559-23086581 CCACCCATAGCTTCACCCATTGG + Intergenic
989259762 5:39405900-39405922 TCACTCATGGCTTCTTCCATAGG - Intronic
989425336 5:41290252-41290274 CCACACATGGCTTCTGCTCTGGG + Intergenic
991288276 5:65005249-65005271 CCACCCATAGCCACTGCCATGGG - Intronic
992714465 5:79496290-79496312 CCACTCCTGTCTTCTGCTATTGG - Intronic
994501945 5:100590189-100590211 CCAGGCATGGGTACTGGCATGGG - Intergenic
995848442 5:116519587-116519609 TCACCCATGGGTTCTGCCCTTGG + Intronic
997200691 5:132008424-132008446 CCACCCCTGGCCTCTGCCTTAGG - Intronic
997346189 5:133194118-133194140 CCCAGCATGACATCTGCCATAGG - Intergenic
1001192266 5:169642038-169642060 CCACCCATGGCTCCTGCTAGAGG - Intronic
1001882069 5:175253095-175253117 GCACACGTGGCTTCTGCCATGGG - Intergenic
1002441447 5:179266492-179266514 CCAGGAATGGATTCTGCCCTGGG + Intronic
1004116204 6:12770495-12770517 CCACACATGGCTTCATCCCTGGG - Intronic
1004469504 6:15916733-15916755 CCACTCCTGGATGCTGCCATGGG - Intergenic
1006996672 6:38267575-38267597 CCACGCATGGCTAATGACCTTGG + Intronic
1010054697 6:71551682-71551704 CCACACATGGCTTCTGCCATTGG - Intergenic
1013287844 6:108696261-108696283 CTACACATGGTTTCTGCCATGGG + Intergenic
1013451553 6:110286598-110286620 CCATTCATGGCTTCTGCCCAGGG + Intronic
1018811846 6:167304153-167304175 CCACGCATGGCCTGAGCCACCGG - Intronic
1019857901 7:3627613-3627635 CCACGTTTGGCATCTGGCATTGG + Intronic
1020118877 7:5491832-5491854 CCACACATGGCCCCTGCCCTTGG + Intronic
1020128514 7:5546477-5546499 CCACTGATGGCATCTGCCCTGGG + Intronic
1021698937 7:23299335-23299357 CGACGCAAGGCTGCTGCTATGGG + Exonic
1027171541 7:75876384-75876406 TCAGACATGGCTTCTGCCCTTGG + Intronic
1027409574 7:77900999-77901021 TCCCGCTTGCCTTCTGCCATGGG - Intronic
1034517258 7:151590606-151590628 CCACGCTAGGCGTCTGCCCTAGG - Intronic
1036995667 8:13653293-13653315 CCACTCAATGCTTCTGCCAAAGG - Intergenic
1039018997 8:33184829-33184851 CCAAACTTGGGTTCTGCCATTGG - Intergenic
1039894067 8:41703980-41704002 TCACACAGGGCTGCTGCCATGGG + Intronic
1045439277 8:102193668-102193690 GCACTCCTGGGTTCTGCCATTGG - Intergenic
1047761978 8:127961237-127961259 GAAAGCATGGCCTCTGCCATAGG + Intergenic
1048339008 8:133524743-133524765 CCACACATGGCTTCTGCTGCAGG + Intronic
1049684263 8:143933041-143933063 CCACGCCTGCCTTCAGCCGTAGG + Exonic
1052747209 9:32452395-32452417 CCCCTCATTTCTTCTGCCATGGG + Exonic
1056690668 9:88806285-88806307 CCAGGCATGGCAGCTCCCATGGG - Intergenic
1057493293 9:95539756-95539778 GCACCCATAGCATCTGCCATAGG - Intergenic
1058593373 9:106588720-106588742 CCACGCAGGGCTCCTGACAGAGG - Intergenic
1058868135 9:109180253-109180275 CCCAGCATGGTTTCTGCCATTGG + Intronic
1059487814 9:114640577-114640599 GCAGGGCTGGCTTCTGCCATGGG - Intronic
1061725774 9:132581190-132581212 CCACTTATGGCCTCTCCCATGGG - Intergenic
1187707825 X:22025178-22025200 CCACCCATAGATGCTGCCATGGG - Intergenic
1193816153 X:86107204-86107226 CCACTCCTGGCTTCTTTCATGGG + Intergenic
1194217428 X:91148133-91148155 CCCCGCAACCCTTCTGCCATTGG - Intergenic
1194891394 X:99384121-99384143 CCACACATGGCTTCTGCTGTGGG + Intergenic
1198853874 X:140995588-140995610 CCACCCCTGGATGCTGCCATGGG - Intergenic
1198878140 X:141249518-141249540 CCACCCCTGGATGCTGCCATGGG + Intergenic
1200553941 Y:4611925-4611947 CCCCGCAACCCTTCTGCCATTGG - Intergenic
1201334117 Y:12861415-12861437 CCTGGCAGGGCTACTGCCATTGG + Intergenic