ID: 1131185835

View in Genome Browser
Species Human (GRCh38)
Location 15:90273515-90273537
Sequence ATGCCATACCCTTTTCGCAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131185834_1131185835 -6 Left 1131185834 15:90273498-90273520 CCTGCAAATATCTGATCATGCCA 0: 1
1: 0
2: 0
3: 14
4: 132
Right 1131185835 15:90273515-90273537 ATGCCATACCCTTTTCGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131185835 Original CRISPR ATGCCATACCCTTTTCGCAG TGG Exonic