ID: 1131188538

View in Genome Browser
Species Human (GRCh38)
Location 15:90294812-90294834
Sequence GGCCCCCTGCAGGGCCCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 6, 1: 4, 2: 4, 3: 33, 4: 274}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131188538_1131188545 1 Left 1131188538 15:90294812-90294834 CCCACCGGGCCCTGCAGGGGGCC 0: 6
1: 4
2: 4
3: 33
4: 274
Right 1131188545 15:90294836-90294858 AGGAGAAGTTGTAGATGAGTAGG 0: 1
1: 0
2: 2
3: 21
4: 253
1131188538_1131188546 7 Left 1131188538 15:90294812-90294834 CCCACCGGGCCCTGCAGGGGGCC 0: 6
1: 4
2: 4
3: 33
4: 274
Right 1131188546 15:90294842-90294864 AGTTGTAGATGAGTAGGTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 94
1131188538_1131188554 29 Left 1131188538 15:90294812-90294834 CCCACCGGGCCCTGCAGGGGGCC 0: 6
1: 4
2: 4
3: 33
4: 274
Right 1131188554 15:90294864-90294886 GCATAGGCCAAGAAGGGTGGGGG 0: 1
1: 0
2: 6
3: 34
4: 269
1131188538_1131188548 22 Left 1131188538 15:90294812-90294834 CCCACCGGGCCCTGCAGGGGGCC 0: 6
1: 4
2: 4
3: 33
4: 274
Right 1131188548 15:90294857-90294879 GGTCCTGGCATAGGCCAAGAAGG 0: 1
1: 0
2: 5
3: 14
4: 139
1131188538_1131188551 26 Left 1131188538 15:90294812-90294834 CCCACCGGGCCCTGCAGGGGGCC 0: 6
1: 4
2: 4
3: 33
4: 274
Right 1131188551 15:90294861-90294883 CTGGCATAGGCCAAGAAGGGTGG 0: 1
1: 0
2: 9
3: 27
4: 331
1131188538_1131188547 13 Left 1131188538 15:90294812-90294834 CCCACCGGGCCCTGCAGGGGGCC 0: 6
1: 4
2: 4
3: 33
4: 274
Right 1131188547 15:90294848-90294870 AGATGAGTAGGTCCTGGCATAGG 0: 1
1: 4
2: 1
3: 14
4: 159
1131188538_1131188552 27 Left 1131188538 15:90294812-90294834 CCCACCGGGCCCTGCAGGGGGCC 0: 6
1: 4
2: 4
3: 33
4: 274
Right 1131188552 15:90294862-90294884 TGGCATAGGCCAAGAAGGGTGGG 0: 1
1: 1
2: 6
3: 29
4: 192
1131188538_1131188553 28 Left 1131188538 15:90294812-90294834 CCCACCGGGCCCTGCAGGGGGCC 0: 6
1: 4
2: 4
3: 33
4: 274
Right 1131188553 15:90294863-90294885 GGCATAGGCCAAGAAGGGTGGGG 0: 1
1: 0
2: 7
3: 23
4: 334
1131188538_1131188549 23 Left 1131188538 15:90294812-90294834 CCCACCGGGCCCTGCAGGGGGCC 0: 6
1: 4
2: 4
3: 33
4: 274
Right 1131188549 15:90294858-90294880 GTCCTGGCATAGGCCAAGAAGGG 0: 1
1: 1
2: 11
3: 8
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131188538 Original CRISPR GGCCCCCTGCAGGGCCCGGT GGG (reversed) Intronic