ID: 1131190250 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:90309445-90309467 |
| Sequence | GCATGTGCACGTGTGTGCGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 634 | |||
| Summary | {0: 1, 1: 3, 2: 15, 3: 108, 4: 507} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1131190250_1131190251 | 6 | Left | 1131190250 | 15:90309445-90309467 | CCAACGCACACACGTGCACATGC | 0: 1 1: 3 2: 15 3: 108 4: 507 |
||
| Right | 1131190251 | 15:90309474-90309496 | ATACACACACATACACCTACAGG | 0: 1 1: 0 2: 26 3: 352 4: 3301 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1131190250 | Original CRISPR | GCATGTGCACGTGTGTGCGT TGG (reversed) | Intronic | ||