ID: 1131190250

View in Genome Browser
Species Human (GRCh38)
Location 15:90309445-90309467
Sequence GCATGTGCACGTGTGTGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 634
Summary {0: 1, 1: 3, 2: 15, 3: 108, 4: 507}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131190250_1131190251 6 Left 1131190250 15:90309445-90309467 CCAACGCACACACGTGCACATGC 0: 1
1: 3
2: 15
3: 108
4: 507
Right 1131190251 15:90309474-90309496 ATACACACACATACACCTACAGG 0: 1
1: 0
2: 26
3: 352
4: 3301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131190250 Original CRISPR GCATGTGCACGTGTGTGCGT TGG (reversed) Intronic
900137411 1:1123940-1123962 GTGTGTGCAGGTGTGTGCGCAGG - Intergenic
900293346 1:1934957-1934979 GTAGGTACACGTGTGTACGTGGG + Intronic
900295253 1:1945861-1945883 GTGTGTGCACGTGTGTGTGTGGG + Intronic
900358752 1:2277844-2277866 GTGTGTGCACGTATGTCCGTCGG - Intronic
900392021 1:2437834-2437856 GTGTGTGCACGTGTGTGGTTTGG - Intronic
900526030 1:3129114-3129136 GAGTGTGCACGTGCGTGTGTGGG + Intronic
900554602 1:3273511-3273533 ACATGTCCATGTGTGTACGTGGG + Intronic
900563694 1:3321663-3321685 GTGGGTGCACGTGTGTGTGTGGG + Intronic
900563724 1:3322217-3322239 GCATGTGCACGTGTGTGTGTGGG + Intronic
900593678 1:3470934-3470956 GCATGGGCAGGGGTGTGCGTGGG + Intronic
900593691 1:3470984-3471006 GCGTGGGCAGGGGTGTGCGTGGG + Intronic
901205492 1:7492858-7492880 GCATGTGCGCGTGTGTTTGTAGG - Intronic
901205493 1:7492892-7492914 GTGTGTGCACGTGTGTATGTAGG - Intronic
901297790 1:8173903-8173925 GTATGTGCACGTATGTGTGCAGG - Intergenic
901815429 1:11790912-11790934 GCATGTGTGCGTGTGTGCGGGGG - Intronic
902291083 1:15435404-15435426 GTGTGTGCATGTGTGCGCGTGGG + Intergenic
902987565 1:20164420-20164442 GCGTGTGCATGTGTGTGTTTAGG + Intronic
903372468 1:22845721-22845743 GTCTGTGTACGTGTGTGTGTGGG - Intronic
903634746 1:24804372-24804394 GTGTGTGCATGTGTGTGGGTGGG + Intronic
903668089 1:25020242-25020264 GCATGTGCATGTGTATGTGCAGG - Intergenic
904339536 1:29825255-29825277 GAATGTGTATGAGTGTGCGTGGG - Intergenic
905016850 1:34783700-34783722 GCCTGTCCACGTGTGTGTGTGGG - Intronic
905037687 1:34928710-34928732 GCGTGTGCGCGCGCGTGCGTTGG - Intronic
905347270 1:37319536-37319558 GTGTGTGCGCGTGTGTGCCTGGG + Intergenic
905446794 1:38032864-38032886 GCCTCTGCATGTGTGTGCATGGG + Intergenic
906693699 1:47810162-47810184 GCGCGCGCACGTGTGTGTGTTGG + Intronic
907552610 1:55317050-55317072 GCATGTGTGTGTGTGTGTGTGGG + Intergenic
910944416 1:92574140-92574162 ACAAGTGAATGTGTGTGCGTAGG - Intronic
913244374 1:116858938-116858960 GTGTGCGCACGTGTGTGTGTAGG - Intergenic
914914623 1:151811548-151811570 GCGCGTGCATGTGTGTGCCTTGG + Intronic
916945491 1:169722145-169722167 GCGTGTGTGCGTGTGTGTGTTGG + Intronic
917229631 1:172822242-172822264 GCATGTACAGTTGTGGGCGTAGG - Intergenic
920868247 1:209771054-209771076 GCATGTGGAGGTGTGTGTGCAGG + Intronic
920868288 1:209771493-209771515 GCATGTGAAGGTGTGTGTGAAGG + Intronic
921254536 1:213327597-213327619 GCATGTGTATGTGTGTGTTTTGG + Intergenic
922085615 1:222344216-222344238 GTATGTGTACGTGTGTGTGATGG + Intergenic
922720728 1:227899054-227899076 GCATGAGAACGTGTGTGTGCAGG - Intergenic
923016388 1:230129734-230129756 GCATGTGCAGGTTTGTTCATGGG + Intronic
923280137 1:232435964-232435986 GAATGTGCGTGTGTGTGCCTGGG + Intronic
923968343 1:239169847-239169869 GTATGTGCATGTCTGTGTGTTGG - Intergenic
924202428 1:241674035-241674057 GCACATGCACGTGTGTGTGTAGG + Intronic
1062934519 10:1375885-1375907 GTATGTGCACGTGTGTGGTGTGG - Intronic
1063033376 10:2258945-2258967 GCATGTGTGCCTGTGTGTGTTGG - Intergenic
1064120673 10:12615438-12615460 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1064120692 10:12615896-12615918 GCATGTGCTGGTGTGTGTATAGG + Intronic
1066528955 10:36315317-36315339 GCGTGTGCGTGTGTGTGTGTTGG + Intergenic
1067094026 10:43286545-43286567 GTCTGTGCACGTGTCTGCGAGGG + Intergenic
1070676172 10:78413144-78413166 GCGCGTGCACATGTGTGTGTTGG + Intergenic
1070775823 10:79109248-79109270 GCAAGTGCGCCTGTGTGCATGGG + Intronic
1071649143 10:87378717-87378739 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
1073007238 10:100333990-100334012 GCAGGTGCATGTGTGTGGGATGG + Intergenic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1073070284 10:100788895-100788917 GGGTGTGCATGTGTGTGTGTCGG - Intronic
1074869078 10:117562906-117562928 GCATGTGTATGAGTGTGCATAGG + Intergenic
1074869095 10:117563102-117563124 GGGTGTGCATGTGTGTCCGTGGG + Intergenic
1074869137 10:117563422-117563444 GGGTGTGCATGTGTGTTCGTGGG + Intergenic
1075098657 10:119490377-119490399 TCGTGTGCATGTGTGTGCGGGGG + Intergenic
1075654889 10:124154709-124154731 GAGTGTGCATGTGTGTGAGTGGG - Intergenic
1075655000 10:124155534-124155556 GTATATGCATGTGTGTGAGTGGG - Intergenic
1076054709 10:127362862-127362884 GGATGTGTATGTGTGTGTGTGGG - Intronic
1076139326 10:128067041-128067063 GCATGTGCATGCATGTGTGTGGG - Intronic
1076407313 10:130221237-130221259 GCATATGTATGTGTGTGAGTGGG + Intergenic
1076461134 10:130648464-130648486 GCATGTGCACATGTGTGTGCAGG + Intergenic
1076612091 10:131732560-131732582 GCATGTGTGTGTGTGTGCCTGGG - Intergenic
1076729313 10:132430391-132430413 ACATGTGCCAGTGTGTGTGTTGG + Intergenic
1076778815 10:132712726-132712748 GCATGTGTAGGTGTGTGTGTAGG + Intronic
1076778870 10:132713144-132713166 GCATGTGTATGTGTGTGTGCGGG + Intronic
1076874497 10:133209198-133209220 GCGTGTACACGTGTGTGGTTGGG + Intronic
1077090099 11:774497-774519 GCTTCTGCACGTGTGTGAGGAGG - Intronic
1077305580 11:1867350-1867372 GTGTGTGCATGTGTGTGTGTGGG - Intronic
1077721854 11:4637809-4637831 GTATGTGCACGTGTGTGTTGTGG + Intergenic
1078498571 11:11844797-11844819 GCATGTGTGCGTGCGTGTGTTGG + Intronic
1078800682 11:14642090-14642112 GCATGTGCGTGTATGTGTGTGGG - Intronic
1079004438 11:16782172-16782194 GGATGAGAACGTGTGTGTGTGGG - Intronic
1079296574 11:19240658-19240680 GCCTGTGCACGTGTGTGTAAGGG - Intronic
1080641446 11:34160771-34160793 GCGTGTGAGTGTGTGTGCGTTGG + Intronic
1080813801 11:35733801-35733823 GGATGTGCACATGTGTGTTTTGG - Intronic
1081707259 11:45190118-45190140 GTGTGTGCACGTGTGTGTGTAGG - Intronic
1081837305 11:46166471-46166493 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1081994729 11:47355888-47355910 GTGTGAGCACGTGTGTGAGTGGG - Intronic
1081994783 11:47356423-47356445 GTGTGTGCATGTGTGTGAGTGGG - Intronic
1082713040 11:56577927-56577949 GAATGTGCCTGTGTGTGTGTGGG - Intergenic
1083257176 11:61503805-61503827 GCATGTGTATGTGTGTGTGTTGG - Intergenic
1084009944 11:66342029-66342051 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1084477933 11:69399386-69399408 GCATGTGTGCATGTGTGTGTAGG + Intergenic
1084523479 11:69680849-69680871 GTGTGTGCATGTGTGTGTGTTGG - Intergenic
1084523480 11:69680903-69680925 GTGTGTGCATGTGTGTGGGTCGG - Intergenic
1085972540 11:81611120-81611142 GTGTGTGCATGTGTGTGTGTAGG + Intergenic
1087032463 11:93719206-93719228 AGATGTGTACGTGTGTGTGTGGG + Intronic
1090071490 11:123548160-123548182 GCTTGTGCCCGTGGGTGAGTCGG + Intronic
1090081168 11:123613721-123613743 GAGTGTGCATGTGTGTGCCTTGG - Intronic
1090401338 11:126450317-126450339 ACGTGTGCATGTGTGAGCGTGGG + Intronic
1090635282 11:128687106-128687128 GCATGTGGGCGTGTGTATGTGGG + Intronic
1090670466 11:128941902-128941924 TCATATTCACGTCTGTGCGTGGG - Intronic
1090763218 11:129855102-129855124 GAATATGCACGTGTGTGAGCAGG - Intronic
1091299620 11:134498993-134499015 GGCTGTGCACGTGTGAGAGTGGG + Intergenic
1091303398 11:134522056-134522078 GTCTGTGCATGTGTGTCCGTGGG - Intergenic
1091463542 12:664235-664257 GCTTGTGCAGGTGTGGGTGTGGG + Intergenic
1091705517 12:2690755-2690777 GCACGTGTACGTGTGTGTGTTGG - Intronic
1091770970 12:3151176-3151198 GTGTGTGCATGTGTGTGAGTGGG + Intronic
1092524055 12:9298704-9298726 GCAGGTCCACGTGTGTTGGTAGG + Intergenic
1092543215 12:9433110-9433132 GCAGGTCCACGTGTGTTGGTAGG - Intergenic
1092940507 12:13403193-13403215 GCATGTGCATATGTGTGTGGGGG + Intergenic
1093159694 12:15731851-15731873 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1094509804 12:31089327-31089349 GCAGGTCCACGTGTGTTGGTAGG + Intronic
1095293201 12:40499805-40499827 GCATGTGTATGTGTGTGCATGGG + Intronic
1095618772 12:44224145-44224167 GGTTGTGCATGTGTGTGTGTGGG - Intronic
1095662620 12:44755357-44755379 GCATGTGCGTGTGTGTATGTAGG - Intronic
1095827742 12:46547836-46547858 GCATGTGCTTGTGTGTGAGGAGG + Intergenic
1096341033 12:50799381-50799403 GCATGTGCATGTGTGTATTTGGG - Intronic
1096476283 12:51911122-51911144 GCATGTGCAGGTGTGTGTCTGGG - Intronic
1096568348 12:52500289-52500311 GCATGTGTGTGTGTGGGCGTGGG - Intergenic
1096997389 12:55847309-55847331 AGATGTGGACGTGTGTGCGAAGG + Intergenic
1097823388 12:64150138-64150160 GCATGTGCACGTGTGTGGGTGGG + Exonic
1099043463 12:77685458-77685480 GTGTGTGCATGTGTATGCGTTGG - Intergenic
1099407100 12:82277853-82277875 GAATGTGTATGTGTGTGTGTAGG + Intronic
1100700506 12:97142752-97142774 ATATGTGTACGTGTGTGTGTGGG + Intergenic
1100727601 12:97425431-97425453 GTATGTGCATGTATGTGTGTGGG - Intergenic
1101845998 12:108363499-108363521 GCATGTGCATGTGTGTGGTATGG + Intergenic
1102746413 12:115252877-115252899 GCATTTGCGTGTGTGTGTGTTGG + Intergenic
1102902031 12:116646422-116646444 GTGTGTGCACGTGTATGTGTGGG - Intergenic
1103197907 12:119061317-119061339 GCGTGTGCACTTGGGTGTGTTGG + Intronic
1103636309 12:122309242-122309264 ACATGTACACTTGTGTGCATTGG - Intronic
1103730596 12:123025229-123025251 GCATGTGCATCTGTGTGCCTAGG - Intronic
1104470356 12:129025097-129025119 GGATGTGGAGGTGTGTGTGTGGG - Intergenic
1104820849 12:131676687-131676709 GCATGTGCACACGGGTACGTGGG + Intergenic
1104944942 12:132411378-132411400 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1104944969 12:132411589-132411611 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1105014763 12:132779726-132779748 GTGTGCGCACGTGTGTGCCTGGG - Intronic
1105014807 12:132779996-132780018 GTGTGCGCACGTGTGTGCCTGGG - Intronic
1105474438 13:20718524-20718546 GCATGGGCGGGTGTGTGGGTGGG - Intronic
1105474528 13:20718983-20719005 GCATGTGTGGGTGTGTGAGTGGG - Intronic
1105474545 13:20719086-20719108 GCATGGGCAGGTGTGAGCATGGG - Intronic
1105962217 13:25352535-25352557 GTATGTGCACATGTGTGAGGGGG + Intergenic
1106138741 13:26993379-26993401 GCAGGTGCAGGTGTGTGATTGGG + Intergenic
1106333601 13:28763052-28763074 GCATGTGCACGTGTGTGTAGGGG + Intergenic
1106468306 13:30032517-30032539 GCATGTGTTTGTGTGTGCATGGG + Intergenic
1106876446 13:34079041-34079063 GCATGTGTATGTGAGTGTGTGGG + Intergenic
1106902602 13:34369698-34369720 GCATGAGCACGTGCGTGCATGGG + Intergenic
1107022133 13:35763035-35763057 GCATGTGTAGGTGTGTGTGTAGG - Intergenic
1107279455 13:38716825-38716847 GCCTGTGCACATGTGTGTTTTGG - Intronic
1107567726 13:41623172-41623194 GTATGTGTATGTGTGTGTGTTGG - Intronic
1108476367 13:50822023-50822045 ACATGTGCATGAGTGTGTGTAGG - Intronic
1108918381 13:55644351-55644373 GCATGTGCACGTGGGGGAGACGG - Intergenic
1109147615 13:58800150-58800172 GCATGTGTGTTTGTGTGCGTGGG + Intergenic
1110408615 13:75179109-75179131 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1111123422 13:83881975-83881997 GCCTGTGCATGGCTGTGCGTCGG + Exonic
1112380642 13:98885912-98885934 ACAAGTGCACGTTTATGCGTTGG - Intronic
1112439329 13:99414440-99414462 GTGTGTGCACGTGTGTGAGTGGG - Intergenic
1112439389 13:99415172-99415194 GCATGTGCATGGGTGTGAGTGGG - Intergenic
1112877785 13:104066692-104066714 GCATGTGCACGGGTGCGCTTAGG - Intergenic
1113465594 13:110510573-110510595 ACTTATGCACGTGTGTGCATAGG + Intronic
1113592601 13:111511871-111511893 GCATGTGCGGGTGAGTGCGAGGG - Intergenic
1113613810 13:111666543-111666565 GTATGTGCATGTGTGTGCATTGG + Intronic
1113752502 13:112785986-112786008 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752519 13:112786109-112786131 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752535 13:112786232-112786254 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752551 13:112786355-112786377 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752601 13:112786724-112786746 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113874126 13:113584196-113584218 GCATGTGCACGTGAGGGAGCGGG - Intergenic
1114431089 14:22661366-22661388 GCATGTGTGTGTGTGTGTGTGGG - Intergenic
1115026466 14:28752674-28752696 GCATGTGTGTGTGTGTGCATGGG + Intergenic
1115041617 14:28937533-28937555 GTATGTGAATGTGTGTGTGTGGG + Intergenic
1116768798 14:49103270-49103292 GTATGTGCAAATGTGTGCCTTGG - Intergenic
1118806574 14:69242514-69242536 GGATGTGCACGTGGGTTCATGGG - Exonic
1119408645 14:74414240-74414262 GCACGCACACGTGTGTGTGTAGG + Intronic
1120120388 14:80672512-80672534 GCATGTGTGCATGTGTGTGTAGG + Intronic
1121656584 14:95601511-95601533 GCATGTGTGCATGTGTGTGTGGG + Intergenic
1121795228 14:96728981-96729003 TGATGTGCACCTGTGTGTGTGGG - Intergenic
1122063543 14:99155902-99155924 TTATGTGCATGTGTGTGTGTGGG + Intergenic
1122088177 14:99321127-99321149 GCATGGGCACATGTGTGATTTGG - Intergenic
1122209986 14:100167585-100167607 GCATGTGTGTGTGTGTGTGTGGG - Intergenic
1122544375 14:102514127-102514149 GTGTGTGCATGCGTGTGCGTGGG + Intergenic
1123447175 15:20339738-20339760 GCCTGTGTGCGTGAGTGCGTGGG + Intergenic
1123984325 15:25631606-25631628 GCATGTGCAGGTATGTGCGTGGG + Intergenic
1124200184 15:27672731-27672753 GCATGTGCATGTGTGTGTATGGG - Intergenic
1124200186 15:27672757-27672779 GCATGTGCATGTGTGTGTGTGGG - Intergenic
1124631686 15:31341350-31341372 GTGTGTGTACGTGTGTGTGTCGG + Intronic
1124678753 15:31711008-31711030 GCATGTGCAGGTGTGTATTTCGG + Intronic
1125486269 15:40113021-40113043 GTGTGTGCACGCGTGTGCGTGGG + Intergenic
1126110680 15:45172966-45172988 GCACGTGCGCATGTGTGCCTGGG - Intronic
1126408332 15:48345906-48345928 GGCTGTGCACGTGTGTGAGGAGG - Intergenic
1126528426 15:49684961-49684983 GCATGTGCGTGTGTGTATGTGGG - Intergenic
1127390003 15:58497723-58497745 GCATGTGAAGGTGTCTGCGATGG - Intronic
1127867044 15:63041897-63041919 GCATGTGTGCGTGTGTGTGCGGG - Intergenic
1128241023 15:66101001-66101023 GGATGGGCACGTGGGTGGGTGGG + Intronic
1128722877 15:69965170-69965192 GCATGTTCAGGTGTGGGAGTTGG + Intergenic
1130836663 15:87656475-87656497 GCATGGGCATGTGTGTGTGGAGG + Intergenic
1130995955 15:88904338-88904360 ACGTGTGCATGTGTGTGGGTGGG - Intronic
1131107877 15:89747029-89747051 GCATGCGCATGTGTGTGTGGTGG - Intergenic
1131190250 15:90309445-90309467 GCATGTGCACGTGTGTGCGTTGG - Intronic
1132261971 15:100433708-100433730 GTGTGTGCACATGTGTGCATGGG - Intronic
1132613032 16:827126-827148 ACCTGTGCACGTGTGTGAGGTGG + Intergenic
1133216788 16:4297411-4297433 GTGTTTGCATGTGTGTGCGTGGG - Intergenic
1133542924 16:6773601-6773623 GTATGTGCATGTGTGGGCATGGG + Intronic
1134004240 16:10807223-10807245 GTGTGTGCATGTCTGTGCGTGGG + Intronic
1134203658 16:12219915-12219937 GTGTGTACACGTGTGTGCGCTGG - Intronic
1134853263 16:17499219-17499241 GCATGTGCACATGTGTGTATCGG - Intergenic
1136107366 16:28039703-28039725 GGATGTGCATGTGTGTGCACAGG - Intronic
1137400190 16:48146966-48146988 GTGTGTGCATGTGTGTGCGTGGG - Intronic
1137592326 16:49701248-49701270 GCATGCGCACGTGTGTGTGTAGG + Intronic
1137788570 16:51155519-51155541 GTGTGTGCATGTGTGTGTGTTGG + Intergenic
1137793570 16:51195914-51195936 GTGTGTGCATGTGTGTGTGTTGG - Intergenic
1139505904 16:67397992-67398014 GCCTGGGCAGGTGTGTACGTGGG + Intronic
1140245861 16:73248665-73248687 GCACGTGCACGTGTGTGTTGTGG + Intergenic
1140263825 16:73403424-73403446 GCATCTGCACGGGTGTGTGAAGG + Intergenic
1140513581 16:75526223-75526245 GAGTGTGCATGTGTGTGTGTGGG + Intergenic
1140529883 16:75655976-75655998 GTGTGTGCACGTGTGTGTGAGGG - Intronic
1140958578 16:79890859-79890881 GCATGTGCTCATGTATGTGTGGG - Intergenic
1141481541 16:84309835-84309857 GCGTGTGTACATGTGTGTGTGGG + Intronic
1141688080 16:85581620-85581642 GCATGTGCATATGTGTGCAGGGG + Intergenic
1141928971 16:87188132-87188154 GTGTGTGTACATGTGTGCGTGGG + Intronic
1141983472 16:87564544-87564566 GCACATGCATGTGTGTGTGTGGG + Intergenic
1142410599 16:89914223-89914245 GCATGTGTGCCTGTGTGTGTGGG + Intronic
1142561604 17:812573-812595 GTGTGTGCACGTGTGTGTGATGG + Intronic
1142562020 17:815855-815877 GTGTGTGCACGTGTGTGCACAGG - Intronic
1142736997 17:1907518-1907540 GCATGTGCACGTGTGTGCCCTGG + Intergenic
1142744074 17:1946434-1946456 GCATGTGTACGTGTGTGCACAGG + Intronic
1143452544 17:7044111-7044133 GCAGGTGCATGCGTGTGAGTAGG - Intergenic
1143461999 17:7109771-7109793 GCATATGCACATGTGAGAGTGGG - Intronic
1143835267 17:9686951-9686973 GCATGTGCATGCGTGTGTGTGGG + Intronic
1144754085 17:17668999-17669021 GCGTGTGCGTGTGTGTGCGCAGG - Intergenic
1146795120 17:35775132-35775154 GTATGTGCATGTGTGTGTTTGGG + Intronic
1146913303 17:36661741-36661763 GCAGGTGCATGTGTGTGTCTGGG - Intergenic
1146913322 17:36662017-36662039 GCATGTGCATGTGTGTGTCTGGG - Intergenic
1147055846 17:37834304-37834326 GGATGTGGATGTGTGTGGGTGGG - Intergenic
1147055863 17:37834484-37834506 GCATGTGCACATATGTGGGTGGG - Intergenic
1147985946 17:44308093-44308115 GCATCTGCATGTCTGTGCCTGGG - Intergenic
1148210154 17:45803790-45803812 GTGTGTGCATGTGTGTGTGTTGG + Intronic
1148784447 17:50139178-50139200 GCATGTGCAGGTGTGAGGGTAGG + Intronic
1150134961 17:62690481-62690503 ACATGTGCAAGTGTGTGGGGGGG - Intronic
1150215655 17:63467521-63467543 GCATGTGCACGTCGGGGCTTGGG - Intergenic
1150288383 17:63966811-63966833 GAACGTGTACGTGTGTGCATGGG + Intronic
1151227005 17:72655212-72655234 GCGTGTGCACGGGTGTGTGGAGG - Intronic
1151512394 17:74569254-74569276 GTGTGTGCATGTGTGGGCGTGGG + Intergenic
1151883615 17:76910415-76910437 GGATATGCACGTGTATGCATGGG - Intronic
1151883625 17:76910527-76910549 GCATATTCAAGTGTGTGAGTGGG - Intronic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1152191881 17:78893081-78893103 GCGTGTGCAGGGGTGTGTGTGGG + Intronic
1152205579 17:78972874-78972896 GTATGTGCAGGTGTGTGTGTGGG + Intronic
1152286955 17:79418313-79418335 GTGTGTGCACGCGTGTGCATGGG - Intronic
1152521593 17:80859710-80859732 CTGTGTGCACGTGTGTGCGGGGG + Intronic
1152526854 17:80893216-80893238 GCCTGTGCCTGTGTGTGCGCCGG + Intronic
1152582009 17:81169978-81170000 GTGTGTGCATGTGTGTGTGTTGG + Intergenic
1152733475 17:81985057-81985079 GTGTGTACAGGTGTGTGCGTGGG - Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1153367856 18:4278656-4278678 GTATGTGTATGTGTGTGTGTGGG + Intronic
1153667745 18:7381583-7381605 GCCTGTGCATGTGTGTGCGCCGG - Intergenic
1155446146 18:25914902-25914924 GTATGTGTATGTGTGTGCTTTGG - Intergenic
1155618736 18:27751310-27751332 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1157113759 18:44844326-44844348 GTGTGTGCACGTGTGTGTGTGGG - Intronic
1157688450 18:49661746-49661768 CCCTGTGCACGTGTGTGTGCTGG + Intergenic
1158098488 18:53802895-53802917 GGAGCTGCATGTGTGTGCGTTGG - Intergenic
1158109124 18:53920420-53920442 GTGTGTGCACGTGTGTGTATGGG + Intergenic
1158120006 18:54038436-54038458 GCGTGTGCATGTGTGTGTGTGGG - Intergenic
1158491636 18:57915590-57915612 GCATATGAACTTGTGTGCTTGGG + Intergenic
1159375601 18:67588551-67588573 GCATGTGCATGTATGTGTGCAGG + Intergenic
1159695379 18:71551279-71551301 GCATGTGCATATGTGTACATGGG + Intergenic
1160025186 18:75210452-75210474 GTATGTGTATGTGTGTGTGTTGG + Intergenic
1160656859 19:277264-277286 GCTTGTCCACGTGTGGGCGGGGG + Intergenic
1160962424 19:1729306-1729328 GTATGTGCATGTGTGTGTGCAGG + Intergenic
1162015300 19:7843061-7843083 GTATGTGCATGTGTGTGTATAGG + Intronic
1162015304 19:7843120-7843142 TCATGTGCATGTGTGTGTATAGG + Intronic
1162015308 19:7843177-7843199 GTATGTGCATGTGTGTGTATAGG + Intronic
1162327783 19:10009062-10009084 CCATGTGGATGTGTGAGCGTGGG + Intronic
1163699479 19:18780227-18780249 CCATGAGCACATGGGTGCGTGGG - Exonic
1164519482 19:28967634-28967656 GAGTGTGCATGTGTGTGGGTGGG + Intergenic
1166222953 19:41377239-41377261 GCATGTGTGCGTGTGTGCACAGG + Intronic
1166232403 19:41432616-41432638 GCATGTGTGTGTGTGTGTGTAGG + Intronic
1166411873 19:42560922-42560944 GCACGTGCACGTGCATGCATGGG + Intronic
924991855 2:319291-319313 GTGTGGGCACGTGTGTGCCTGGG + Intergenic
925126633 2:1461756-1461778 GTGTGTGCAGGTGTGTGTGTGGG - Intronic
925572160 2:5324284-5324306 GCATCTGCATGTGTGTGGTTGGG - Intergenic
925753347 2:7109693-7109715 GCATGTGTGTGTGTGTGTGTTGG + Intergenic
926125912 2:10271738-10271760 GCATGTGTGCATGTGTGCATGGG - Intergenic
926589985 2:14730265-14730287 ACATGTGCATGTGTGTGTGTTGG + Intergenic
927477141 2:23422811-23422833 GCATGTGCAGGTGGGTGGGAAGG + Intronic
927477424 2:23424278-23424300 ACGTGTGCATGTGTGTGCGTGGG + Intronic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
927848210 2:26482645-26482667 GCATGTGTGTGTGTGTGAGTGGG + Intronic
927848217 2:26482735-26482757 GCATGTGTGCGTGTGTGAGTGGG + Intronic
927848242 2:26483041-26483063 GCATGTGTGCATGTGTGAGTGGG + Intronic
928171307 2:29005288-29005310 GTGTGTGCATGTGTGTGTGTGGG + Intronic
929360185 2:41078797-41078819 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
929783956 2:44975843-44975865 GTGTGTGCGTGTGTGTGCGTAGG - Intergenic
929825939 2:45309823-45309845 GCATGTACACATGTGTGCATGGG + Intergenic
930474279 2:51860185-51860207 CCATGTGCCCGTGTTTGCTTTGG + Intergenic
931920934 2:67014884-67014906 GCATGTGCATGTGTATGTATTGG + Intergenic
932224060 2:70025190-70025212 GCATGTGAATGTGTGTGTGTTGG + Intergenic
932300673 2:70664729-70664751 GAGTGTGCAAGTGTGTGTGTGGG + Intronic
932825987 2:74940639-74940661 GCATGCGCACGTGTGTGTATGGG - Intergenic
933766623 2:85713543-85713565 GCTTGTGCATGTGTATGTGTGGG - Intergenic
935332526 2:101987597-101987619 GTAGGTGCACGTGTGTGTTTAGG - Intergenic
936631911 2:114212536-114212558 GCATGTGCATGAGTGTGTGTGGG + Intergenic
937250084 2:120518197-120518219 GCATGTGTGTGTGTGTGAGTGGG - Intergenic
937292782 2:120791615-120791637 GTATGTGCATGTGTTTGCCTGGG + Intronic
937512225 2:122608954-122608976 GTGTGTGCATGTGTGTGTGTAGG - Intergenic
938400330 2:130986177-130986199 GCACGTGCATGTGTGTGCATAGG + Intronic
938776892 2:134549755-134549777 GCATGTATACGTGTATGTGTGGG - Intronic
939449698 2:142357714-142357736 GCATGTGTATGTGTGTGTGTAGG - Intergenic
940567299 2:155383257-155383279 ATGTGTGCACTTGTGTGCGTAGG - Intergenic
941600110 2:167532541-167532563 GTATGTGTAAGTGTGTGTGTAGG - Intergenic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
942406667 2:175663246-175663268 CTATGTGCACGTGTGTGTGGAGG - Intergenic
943720055 2:191194529-191194551 GTATGTGTATGTGTGTGCGTAGG + Intergenic
944436554 2:199696144-199696166 GCATGTGCATGTGTGTGCCCTGG - Intergenic
945543725 2:211122951-211122973 GTATGTGCACGTGTGCCTGTGGG + Intergenic
945832146 2:214800319-214800341 GTATGTGCACTTGTGTGTATTGG + Intronic
946449459 2:219767355-219767377 GTGTGTGCATGTGTGTGGGTGGG + Intergenic
947099019 2:226598979-226599001 GCATGTGCATGTGTGTGTAGAGG + Intergenic
947342989 2:229159581-229159603 GCATATGCACTTGTGGGGGTTGG - Intronic
947386623 2:229596974-229596996 GCGTGTGCATGTGTGTGCGCAGG - Intronic
947746964 2:232512831-232512853 GCATGCGCACGTGTGTGCAGGGG + Intergenic
948183680 2:236002417-236002439 GCATGTGCACATGTGTGAGTAGG + Intronic
948271033 2:236673427-236673449 GCATGTGTGTGTGTGTGAGTGGG + Intergenic
948569104 2:238906237-238906259 GTGTGTGCATCTGTGTGCGTGGG - Intronic
948758546 2:240174419-240174441 GCATGTGTGTGTGTGTGTGTAGG + Intergenic
1169000130 20:2162584-2162606 GCGCGTGCACGTGTGTCAGTTGG + Intronic
1169644048 20:7789558-7789580 GCCTGTGCATGTGTGGGAGTAGG + Intergenic
1169688798 20:8307212-8307234 GCATGGGCACGTGTGGGTGCAGG + Intronic
1170045629 20:12082423-12082445 GTGTGTGCACGTGTGTGTCTGGG - Intergenic
1170815792 20:19713218-19713240 GCATGTCCACGTGTGCTTGTGGG - Intronic
1171295594 20:24014211-24014233 GTGTGTGCAGGTGTCTGCGTTGG + Intergenic
1171435422 20:25118355-25118377 GGATGTGCACGTGAGTGTGGTGG - Intergenic
1172445011 20:34988438-34988460 GAAAGGGCACGTGTGTGAGTGGG + Intronic
1173658163 20:44715293-44715315 GCGTGTGCCTGTGTGTGCCTGGG + Intronic
1173742037 20:45407906-45407928 GCGTGTGTACGTGTTTGTGTGGG + Intronic
1173850953 20:46217607-46217629 GCATGGGCAGGTATGTGTGTGGG - Intronic
1175314938 20:58040545-58040567 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175793856 20:61758915-61758937 GTGTGTGCACCTGTGTGCATGGG + Intronic
1175928758 20:62483659-62483681 GCATATGCATGTGTGTGCACAGG - Intergenic
1176020018 20:62957857-62957879 GCGTGTGCAAGTGTGTGTATGGG + Intronic
1176020472 20:62960157-62960179 GCAGGCGCATGTGTGTGTGTTGG + Intronic
1176106063 20:63388071-63388093 GCATGTGCATATGTGTGTGTGGG - Intergenic
1176110661 20:63409313-63409335 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1176386486 21:6140689-6140711 GCGTGTGCCCGTGTGTGCTTGGG + Intergenic
1176430484 21:6572462-6572484 CCCTGTGAACGTGTGTGAGTGGG + Intergenic
1176974267 21:15301075-15301097 GCATGAGCAAGTGTGAGCCTGGG + Intergenic
1178200681 21:30400490-30400512 GCATGTTCACGTGTGTTCCCAGG - Intronic
1178573132 21:33759679-33759701 ACATGAGCACGTGTGTGTTTTGG - Intronic
1178907553 21:36649241-36649263 GCATGTGTGCGTGTGTGTGGGGG - Intergenic
1179022515 21:37653044-37653066 TCATCTGCCCGTGTGTGTGTGGG + Intronic
1179144883 21:38759250-38759272 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1179393251 21:41013182-41013204 GCATGTGCCTGAGTGTGTGTGGG - Intergenic
1179705878 21:43179924-43179946 CCCTGTGAACGTGTGTGAGTGGG + Intergenic
1179736987 21:43397563-43397585 GCGTGTGCCCGTGTGTGCTTGGG - Intergenic
1179827517 21:43975094-43975116 GCATGTGCCAGTGTGTGCACTGG + Intronic
1179966692 21:44810981-44811003 GCATGTGTGGGTGTGTGCATGGG - Intronic
1180195871 21:46193966-46193988 GCATGCGTACGTGTGTGCATAGG + Intronic
1181991960 22:26843868-26843890 GCATGTGAGTGTGTGTGTGTGGG + Intergenic
1182012653 22:27013562-27013584 GCATATGCATGTGTGTGAGAGGG + Intergenic
1182090819 22:27593590-27593612 GCATGTGCACATGCATGTGTAGG + Intergenic
1183233021 22:36594844-36594866 GCATGTGTGTGTGTGTGCATGGG + Intronic
1183359931 22:37378195-37378217 GCATGTGCTTGTGTGTGCAGGGG + Intronic
1183465041 22:37975513-37975535 GTATGTACACGTGTGTGGGAGGG + Intronic
1183614847 22:38937641-38937663 GTGGGTGCACGTGTGTGCATGGG + Intergenic
1184073697 22:42162830-42162852 GCATGTGCATGTACGTGCTTGGG - Intronic
1184320431 22:43738666-43738688 GTATGTGCAAGTGTGTGTGATGG - Intronic
1184678358 22:46055410-46055432 GTATGTGCACGTGGGTGTGCAGG + Intronic
1184924686 22:47629105-47629127 GCATGTGCATGTGTGTGATGTGG + Intergenic
1184934209 22:47707161-47707183 GCATGTGCATGTGTGTCCGATGG + Intergenic
1185100402 22:48837638-48837660 GTGTGCGCACGTGTGTGCATGGG - Intronic
1185125151 22:49006397-49006419 TTATGTGCATGTGTGTGCGTGGG + Intergenic
1185285604 22:49998446-49998468 GGCTGTGCACGTGTGTGCATGGG + Intronic
1185285621 22:49998587-49998609 GTATGTGTACGTGTTTGCATGGG + Intronic
949240588 3:1866451-1866473 GCACGTGCATGTGTGTGAGAGGG - Intergenic
949742879 3:7256612-7256634 GCATGTGTGTGTGTGTGCATAGG - Intronic
950425856 3:12924417-12924439 GCATCTGCATGTGTGTGTCTAGG + Intronic
950534210 3:13569970-13569992 GGCTGTGCATGTGTGTGTGTGGG + Intronic
951078696 3:18425793-18425815 GCAGGGGCAGGTGTGTGAGTGGG + Intronic
951603777 3:24408523-24408545 GCATGAGCATGTGTGTGAGCTGG + Intronic
953173792 3:40530873-40530895 GTGTATGCATGTGTGTGCGTAGG - Intronic
953229471 3:41051873-41051895 ACACGTGCACATGTGTGTGTTGG + Intergenic
953553200 3:43921133-43921155 GCATATGCACATTTGTGCGGTGG + Intergenic
953847016 3:46435766-46435788 GCACGTGCATGTATGTGCCTGGG - Exonic
953881621 3:46693952-46693974 GAGTGTGCGCGTGGGTGCGTAGG - Intergenic
953914290 3:46908802-46908824 GGATGTGCACGTGTGTGTGCAGG + Intergenic
954745545 3:52785607-52785629 GTATGTGCACCTGTGTGTGGTGG + Intronic
956456512 3:69426336-69426358 GTGTGTGCATGTGTGTGTGTTGG + Intronic
957363875 3:79196353-79196375 GCGTGTGCATGTGTGTGTGATGG - Intronic
957605819 3:82397920-82397942 GTATGCGCACGTGTGTGTTTTGG - Intergenic
958109335 3:89119761-89119783 GTATGTGCACATGTGTGTTTGGG + Intronic
959204686 3:103291080-103291102 GGATGTGTATGTGTGTGTGTTGG - Intergenic
959440821 3:106373349-106373371 GTATGTGCACGTGTGCACTTTGG + Intergenic
960050467 3:113234373-113234395 GCATGTGCACACATGTGTGTAGG + Intronic
960485525 3:118248272-118248294 GCATGTTCACGTATGCACGTAGG - Intergenic
962385328 3:134928147-134928169 GAGAATGCACGTGTGTGCGTGGG - Intronic
962924212 3:139976840-139976862 GCATGTGCACACATGTGTGTTGG + Intronic
965892878 3:173536765-173536787 GCGTGTGTGTGTGTGTGCGTAGG + Intronic
966357763 3:179100001-179100023 GTATGTGTGCGTGTGTGTGTAGG - Intergenic
968490415 4:887980-888002 GCGTCTGCACATGTGAGCGTGGG - Intronic
968522725 4:1041331-1041353 GTGTGTGCATGTGTGTGTGTCGG + Intergenic
968522948 4:1042484-1042506 GTATGTGGAGGTGTGTGTGTCGG - Intergenic
968544739 4:1193019-1193041 GCATGTCCACATATGTGTGTGGG - Intronic
968580950 4:1394796-1394818 ACATGGGCACGTGTGTGAGCAGG - Exonic
968581091 4:1395598-1395620 ACATGGGCACGTGTGTGAGCAGG - Exonic
968581102 4:1395662-1395684 ACATGGGCACGTGTGTGAGCAGG - Exonic
969584031 4:8081599-8081621 GCATGTGCATCTGTGTGCATAGG + Intronic
969609310 4:8218130-8218152 GTGTGTGCACGTGTGTGTGTTGG + Intronic
969613451 4:8239389-8239411 GCATGTGCCTGTGTGTACATGGG - Intronic
970050875 4:11913543-11913565 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
971632879 4:29017586-29017608 GCATGTGTATGTGTGTGTGTGGG - Intergenic
973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG + Intronic
974622705 4:64381877-64381899 GCAAGTGCACGTGTGTGTGGGGG + Intronic
975725795 4:77290598-77290620 CCATGTGGACGTGTCTGCATGGG + Intronic
976349945 4:84049829-84049851 GCGTGTGTATGTGTGTGTGTGGG + Intergenic
977973330 4:103235555-103235577 GCATGTGCATGTATGCGTGTGGG + Intergenic
978277429 4:106968448-106968470 TCATGTGAACGTGTGTGTGTAGG + Intronic
978471545 4:109073129-109073151 GCATGTGTATGTGTGTGTGGGGG + Intronic
978856390 4:113399313-113399335 GTATGTGTACGTGTATGTGTGGG - Intergenic
979882578 4:125980260-125980282 GCATGTGCATGTGTGTGGGGAGG + Intergenic
980113595 4:128658317-128658339 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
980249254 4:130292884-130292906 GTGTGTGCGCGTGTGTGTGTGGG + Intergenic
981107665 4:140899570-140899592 GCATGTGTATGTGTGTGCACAGG + Intronic
983271673 4:165569422-165569444 GCATACGCAGGTGTGTGTGTAGG + Intergenic
984582868 4:181530809-181530831 GCATGTGCATGTATGTACGTGGG + Intergenic
984587830 4:181583001-181583023 GCATGCACATGTGTGTGGGTAGG - Intergenic
985074700 4:186202607-186202629 GTGTGTGCATGTGTGTGCATGGG - Intronic
985515998 5:344900-344922 GCGTGTGCAGGTGTGTGTGGAGG + Intronic
985528633 5:420935-420957 GTATGTGCGCCTGTGTGGGTGGG - Intronic
985581367 5:697004-697026 GCGTGTGCCTGTGTGTGCATGGG + Intergenic
985595996 5:788330-788352 GCATGTGCCTGTGTGTGCATGGG + Intergenic
985699793 5:1363744-1363766 GAAGGTGCACCTGTGTGCGCAGG + Intergenic
986156718 5:5183745-5183767 ACATCTGCGCGTGTGTGCATAGG + Intronic
986251299 5:6060846-6060868 GTGTGTGCACATGTGTGCGGGGG - Intergenic
986719239 5:10548756-10548778 GCATGTGTTAGCGTGTGCGTTGG + Intergenic
987872283 5:23636443-23636465 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
988458740 5:31413040-31413062 GTGTGTGCTCATGTGTGCGTTGG - Intronic
988520876 5:31944733-31944755 GCGTGTGCACGTGTGTCCCCAGG + Intronic
988935767 5:36081582-36081604 GTGTGTGCATGTGTGTGGGTGGG - Intergenic
989724435 5:44571554-44571576 GCTTGTGCCTGTGTGTGTGTGGG - Intergenic
990992594 5:61700395-61700417 GCCTGGCCACGAGTGTGCGTGGG + Intronic
991069305 5:62458681-62458703 GCCTGTGCATGTGTGTGTCTAGG + Intronic
991295682 5:65077800-65077822 GCATGTGTGCGTGTGTGTGTGGG - Intergenic
992051478 5:72945165-72945187 GCAGGTGCATGTGTTTGTGTTGG - Intergenic
993276008 5:85859779-85859801 GCATATGCATGTGTGTACGTAGG + Intergenic
993987624 5:94616527-94616549 GCATGTGTGTGTGTGTGTGTAGG - Intronic
995602940 5:113818237-113818259 GCATGTGCATGTGTGTATGCAGG + Intergenic
996541083 5:124630497-124630519 GCATGTGTGCGTGTGTGCTAGGG + Intergenic
996948801 5:129100436-129100458 TCATGTGCAAATGTGTGTGTAGG + Intronic
998176900 5:139907003-139907025 GCATGTGCACATGTGTGTATGGG + Intronic
999060938 5:148634351-148634373 GCATGTGAATGTTTGTGTGTGGG - Intronic
1000292057 5:159879639-159879661 GCATATGCATGCGTGTGTGTGGG + Intergenic
1000408808 5:160916990-160917012 GCAAGTGTACGTGTGTGCAAAGG + Intergenic
1000760145 5:165213496-165213518 GTATGTGCACATGTGTGCTGGGG - Intergenic
1001245729 5:170104852-170104874 GTGTGTGCGCGTGCGTGCGTGGG + Intergenic
1001833973 5:174814920-174814942 GTGTGTGTACGTGTGTGTGTGGG - Intergenic
1002090245 5:176800822-176800844 GCATGTATATGTGTGTGTGTTGG + Intergenic
1002167522 5:177357769-177357791 GTGTGTGCGCGTGTGTGTGTAGG + Intergenic
1002450838 5:179317706-179317728 AAATGTACACGTGTGTGTGTGGG - Intronic
1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG + Intronic
1002900074 6:1403878-1403900 GCATGTGCGTGTGTGTGTCTCGG - Intergenic
1003340231 6:5213527-5213549 CCATGTGCACCTGGGTGGGTGGG + Intronic
1003453579 6:6260576-6260598 GTATGTGCTTGTGTGTGTGTTGG + Intronic
1003558734 6:7163740-7163762 GTGTGAGCACGTGTGTGCCTGGG + Intronic
1003566118 6:7223716-7223738 GAATGTGTATGTGTGTACGTAGG - Intronic
1004084291 6:12429515-12429537 GTGTGTGCACATGTGTGTGTTGG + Intergenic
1004496241 6:16165898-16165920 GCATGGGAAGGTGTGTGTGTTGG - Intergenic
1004739711 6:18447043-18447065 GTATGTGCATGTGTGTATGTGGG + Intronic
1004761696 6:18673926-18673948 GCACATACACGTGTGTGGGTAGG + Intergenic
1006173139 6:32106980-32107002 GTGTGTGCACGTGTGTGCATGGG - Intronic
1006237017 6:32642546-32642568 TCATGTGCATGTGTGTGGGATGG - Intronic
1006247002 6:32746176-32746198 TCATGTGCATGTGTGTGGGATGG - Intronic
1006295414 6:33167924-33167946 GCATGTGTATGTGTGTGTCTAGG - Intronic
1006374244 6:33663045-33663067 GCATGTACACGTGGGTGTGCGGG + Intronic
1006391282 6:33760379-33760401 TCATATGCACGTGTGTGCACAGG + Intergenic
1006464639 6:34185336-34185358 GCATGTGTATGTGTGTGGGCGGG - Intergenic
1006668887 6:35717413-35717435 CCATGTGCACGTGTGTTTGTGGG + Intronic
1007380411 6:41486828-41486850 GCAAGTGCATGTGTGTGCTGGGG + Intergenic
1007401271 6:41603977-41603999 GCATGTGCATGTGTGTGTGAAGG - Intergenic
1007784415 6:44271507-44271529 GCGTGTGCACAAGTGTGCATGGG - Intronic
1007836483 6:44677886-44677908 ACATGTGCATGTGTGTGCATAGG - Intergenic
1008406156 6:51120922-51120944 GCATGTGGGTGTGTGTGTGTTGG + Intergenic
1011172763 6:84524307-84524329 GCATGTGCACGTGTGTGATGGGG + Intergenic
1012175508 6:96077227-96077249 GGATGTGTATGTGTGTGTGTTGG - Intronic
1012301963 6:97600944-97600966 GTATGTGTGTGTGTGTGCGTGGG + Intergenic
1012729175 6:102858673-102858695 GCACGTGCATGTCTGTGTGTGGG - Intergenic
1013575726 6:111482666-111482688 GCGTGTGCGCGTGTGCGCGGCGG + Intronic
1013684699 6:112565848-112565870 GCACGTGCACGTGTGTGTCATGG + Intergenic
1015576514 6:134677422-134677444 GTGTGTGCATGTGTGTGCATAGG - Intergenic
1016504741 6:144766134-144766156 GCACGTGCTTGTGTGTGTGTGGG - Intronic
1018788175 6:167124935-167124957 GTATTTGCATGTGTGTGCATGGG - Intronic
1018837092 6:167493350-167493372 GCATGGGAATGTGTGTGCATGGG - Intergenic
1018837109 6:167493511-167493533 GCATGGGAGTGTGTGTGCGTGGG - Intergenic
1018837118 6:167493587-167493609 GCATGTGAGTGTGTGTGCATGGG - Intergenic
1019183281 6:170206160-170206182 GTGTGAGCACGTGTGTGCATGGG + Intergenic
1019329502 7:455630-455652 GTCTGTGCACGTGTGAGCGTGGG - Intergenic
1019356637 7:583368-583390 GAGTGTGCACATGTGTGAGTGGG - Intronic
1019356644 7:583413-583435 GGGTGTGTGCGTGTGTGCGTGGG - Intronic
1019356648 7:583452-583474 GTGAGTGCACGTGTGTGAGTGGG - Intronic
1019384261 7:745612-745634 ACATGTACACGTGTGTGCACAGG - Intronic
1019492127 7:1319687-1319709 GCATGTGTGCGTGTCTGTGTGGG + Intergenic
1019492143 7:1320024-1320046 GCATGTGTGCGTGTCTGTGTGGG + Intergenic
1019492159 7:1320361-1320383 GCATGTGTGCGTGTCTGTGTGGG + Intergenic
1019560046 7:1651389-1651411 GTGTGTGCCCGTGTGTGCCTGGG - Intergenic
1019784891 7:2969067-2969089 GAATGTGCAAGTGAGTGAGTGGG - Intronic
1020953910 7:14715519-14715541 GCATGTGTGCCTGTGTGTGTTGG - Intronic
1021281681 7:18727592-18727614 GAGAGCGCACGTGTGTGCGTGGG - Exonic
1021485890 7:21168180-21168202 CCATGTGCACATGTGTGTGGGGG + Intergenic
1021515223 7:21477188-21477210 GCAAATGCACTTGTGTGAGTTGG - Exonic
1022203662 7:28142295-28142317 GCATGTGCATATGTGTCTGTTGG - Intronic
1022260536 7:28700213-28700235 GCTTGTGCGCGTGTGTGAGTTGG - Intronic
1022481491 7:30746218-30746240 GCACATGCACGCGTGTGGGTGGG - Intronic
1023111980 7:36822855-36822877 GCATGTGTATGTGTGTTCATGGG + Intergenic
1024148786 7:46545380-46545402 GAGTGTGCACGTGTGTGCATTGG - Intergenic
1025969600 7:66309870-66309892 TTATGTGCACATGTGTGCATGGG + Intronic
1026148964 7:67772007-67772029 GAGTGTGCGTGTGTGTGCGTGGG + Intergenic
1026975685 7:74496572-74496594 GGGTGTGCATGTGTGTGGGTGGG + Intronic
1030987469 7:116259386-116259408 ACATGTGCATGTGTGTGTGGTGG - Intergenic
1032688486 7:134259174-134259196 GCATGTTCACATGTGTGTTTGGG - Intronic
1034266138 7:149781906-149781928 GTATGTTCACGAGTGTGTGTAGG - Intergenic
1034318629 7:150158863-150158885 CTGTGTGCACGTGTGTGTGTGGG - Intergenic
1034349722 7:150408037-150408059 GCATGCGCGCGTGGGTGCGCTGG - Intronic
1034356218 7:150452303-150452325 GCATGTGCGTGTGTGTATGTGGG + Intronic
1034414161 7:150956113-150956135 GCATGTGCGCCTGTATGTGTCGG - Intronic
1034774123 7:153808337-153808359 GTGTTTGCACGTGTGTGTGTGGG + Intergenic
1035226669 7:157437729-157437751 GCATATGCATGTCTGTGTGTGGG - Intergenic
1035458971 7:159027746-159027768 GCGTGTGTGGGTGTGTGCGTGGG - Intergenic
1035617060 8:1010160-1010182 GCATGTGTCTGTGTGTGCATAGG - Intergenic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1036212126 8:6850833-6850855 GCATGTGCAGGTGTGTGTATGGG - Intergenic
1038271183 8:26077456-26077478 GCATGTTCATGTATGTGTGTAGG - Intergenic
1038501577 8:28049031-28049053 GAATGTGCATGTGCGTGTGTGGG + Intronic
1039444820 8:37622598-37622620 GCATGTGTGTGTGTGAGCGTGGG - Intergenic
1039918005 8:41873954-41873976 GCATGTGCGTTTGTGTGTGTAGG - Intronic
1040628544 8:49180819-49180841 GGATGTGCATGTGTGTGTGTTGG - Intergenic
1040780741 8:51106565-51106587 GCAAATGCATGTGTGTGTGTAGG - Intergenic
1041864197 8:62550405-62550427 GCGTGTGCGCGTGTGTGTGGTGG + Intronic
1043054125 8:75415759-75415781 GTGTGTGCACGTGTGTGTGTTGG + Intronic
1043543621 8:81291020-81291042 GTATGTGTACCTGTGTGTGTAGG + Intergenic
1044037122 8:87320600-87320622 GTATGTGCACGTGTGTGTGTGGG + Intronic
1044309029 8:90671325-90671347 GCATGTGTGAGTGTGTGTGTTGG + Intronic
1046010223 8:108537487-108537509 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1047775254 8:128065135-128065157 GCATGTGCATGCGTGTGCAAGGG + Intergenic
1047954744 8:129965309-129965331 GCATGAGTATGTGTGTGGGTGGG + Intronic
1048533811 8:135274160-135274182 GCAGGTGCCCATGTGTGGGTGGG - Intergenic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1048995671 8:139792406-139792428 GCGTGTGCGCGTGTGTGCGTGGG + Intronic
1049355996 8:142188360-142188382 CCATGTGCAGGTGTGTGCTACGG - Intergenic
1049356312 8:142190306-142190328 GCATGTGCACATATGTGTGGGGG - Intergenic
1049387751 8:142352900-142352922 GCATGTGCACACGTGTGCGTGGG - Intronic
1049392828 8:142380942-142380964 GCAGGTGCATGTGTGTGTGGGGG - Intronic
1049398602 8:142413558-142413580 GTGTGTGCACGTGTGTGTGTGGG - Intergenic
1049724465 8:144139134-144139156 GCATGCTCATGTGTGTGTGTTGG - Intronic
1050291839 9:4163222-4163244 GCATGTGCACGCATGTGCACTGG + Intronic
1050367116 9:4882842-4882864 GTGTGTGCATGTGTGTGCATAGG - Intronic
1051167268 9:14277316-14277338 GTGCGTGCACGTGTGTGCGCGGG - Intronic
1051766199 9:20526656-20526678 GAATGTGCATATGTGTGTGTGGG - Intronic
1052132857 9:24870851-24870873 GTGTGTGTACGTGTGTGTGTTGG - Intergenic
1052785026 9:32820445-32820467 GCATGTGCAGGTGTGGGAGAGGG - Intergenic
1052996696 9:34555049-34555071 GCATGTTCCCGTGTGTGTGGTGG + Intronic
1053284774 9:36843136-36843158 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1053360799 9:37485542-37485564 GGATGTCCACGTGGGTGGGTGGG + Intergenic
1053593127 9:39533681-39533703 CCGTGTGTACGTGTGTGTGTCGG - Intergenic
1053850864 9:42288389-42288411 CCGTGTGCACGTGTGTGTGTCGG - Intergenic
1054573180 9:66831596-66831618 CCGTGTGCACGTGTGTGTGTCGG + Intergenic
1055518707 9:77059426-77059448 GCATGTGCACGTTTTTATGTGGG + Intergenic
1056575169 9:87850808-87850830 GCATGTACATGTGTGTGTATTGG - Intergenic
1057207452 9:93182210-93182232 GCATGTGTACAAGTGTGGGTGGG + Intergenic
1057275155 9:93672398-93672420 GCAGGTGCAGGTGTGGGTGTGGG + Intronic
1057275163 9:93672434-93672456 GCAGGTGCAGGTGTGGGTGTGGG + Intronic
1057275250 9:93672908-93672930 GCAGGTGCAGGTGTGAGGGTAGG + Intronic
1058873281 9:109220745-109220767 GTGTGTGCACGTGCGTGTGTTGG + Intronic
1058877461 9:109257087-109257109 GGATGTGTAAGTGTGTGGGTGGG + Intronic
1058902694 9:109456144-109456166 GCAGGTGTGCGTGTGTGTGTTGG + Intronic
1059332075 9:113542011-113542033 GTGTGTGCACGTGTGTGTGTTGG - Intronic
1059502638 9:114768091-114768113 GAGTGTGCGTGTGTGTGCGTGGG + Intergenic
1060406907 9:123377295-123377317 GCAGGTGTACGGCTGTGCGTGGG + Exonic
1061235186 9:129337923-129337945 GCCTGTGTCCGTGTGTGCTTGGG + Intergenic
1061412328 9:130428356-130428378 AGATGTGGACGAGTGTGCGTGGG + Exonic
1061733333 9:132634361-132634383 GCATATGTGTGTGTGTGCGTGGG - Intronic
1061816936 9:133203053-133203075 GCATGTGGCAGTGTGTGTGTAGG + Intergenic
1062197974 9:135285094-135285116 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062197981 9:135285156-135285178 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062197990 9:135285216-135285238 GCATGTGCACGTGTGTGCCTGGG - Intergenic
1062198003 9:135285279-135285301 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198016 9:135285342-135285364 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198027 9:135285405-135285427 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198039 9:135285465-135285487 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198051 9:135285528-135285550 GCATGTGCACCTGTGTGCCTGGG - Intergenic
1062198064 9:135285591-135285613 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198075 9:135285654-135285676 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198083 9:135285717-135285739 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198095 9:135285779-135285801 GCGTGTGCACCTATGTGCCTAGG - Intergenic
1062198104 9:135285839-135285861 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198117 9:135285902-135285924 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198126 9:135285965-135285987 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198141 9:135286028-135286050 GCGTGTGCACCTGTATGCCTGGG - Intergenic
1062198154 9:135286091-135286113 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198167 9:135286154-135286176 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198177 9:135286217-135286239 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198185 9:135286280-135286302 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198194 9:135286340-135286362 GCGTGTGTACGTGTGTGCCTGGG - Intergenic
1062198202 9:135286400-135286422 GTGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198211 9:135286464-135286486 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198221 9:135286524-135286546 GCATGTGCACCTGTGTGCCTGGG - Intergenic
1062198234 9:135286587-135286609 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062205910 9:135337193-135337215 TCATGTGCGTGTGTGGGCGTGGG + Intergenic
1062253893 9:135611993-135612015 GAGTGTGCACGTGTGTGTGCAGG - Intergenic
1062270945 9:135708183-135708205 GCATGTGCCTGTATGTGTGTGGG - Intronic
1062328445 9:136023958-136023980 GCATGTGCACGTGTGTGTGGGGG - Intronic
1062696514 9:137878642-137878664 GCATGTTCACGTGCCTGTGTAGG + Intronic
1185468728 X:370253-370275 GCAGGTGCAGGTGTCTGAGTAGG + Intronic
1185480175 X:440136-440158 GTGTGTGCACCTGTGTGTGTGGG - Intergenic
1185480199 X:440456-440478 GTATGTGCACCTGTGTGGGGGGG - Intergenic
1185567992 X:1110848-1110870 GCGTGTGCATGTGTGTATGTAGG + Intergenic
1186404779 X:9292384-9292406 GCATGTGCATGTGTGTATATGGG - Intergenic
1186458381 X:9728848-9728870 GCAGGTGCATGTGTATGTGTTGG - Intronic
1186861570 X:13677660-13677682 GTATGTGCGCGTGTGTGTGGGGG + Intronic
1186879023 X:13846203-13846225 GCATGAGTAGGTGGGTGCGTGGG - Intronic
1187678621 X:21743402-21743424 GTGTGTGCACGTGTGTGTGGTGG - Intronic
1188519921 X:31027109-31027131 GCTTGTACAGGTGTGTGTGTGGG + Intergenic
1189267307 X:39726728-39726750 GCATGTGTATGTGTGTGTCTGGG + Intergenic
1190562433 X:51698646-51698668 GTATGTGCACCTGTGTTTGTGGG + Intergenic
1190596709 X:52059428-52059450 GTATGTGCACGTGGGTGCGAGGG + Intergenic
1190612115 X:52194645-52194667 GTATGTGCACGTGGGTGCGAGGG - Intergenic
1190617703 X:52253337-52253359 CCATGTGCAGGTTTTTGCGTGGG + Intergenic
1192655227 X:72986413-72986435 GCATGTGCACGTGTCTTTATAGG - Intergenic
1194415777 X:93609949-93609971 ACATGTGAGCGTGTGTGCATTGG - Intergenic
1194426381 X:93743629-93743651 GCATGTGCATGTGTGTATATTGG + Intergenic
1196029946 X:111086091-111086113 GCATGTGCACATGTGTGCACTGG + Intronic
1196047238 X:111269267-111269289 TTATGTGCACGTGTGTGCCTGGG - Intronic
1197775948 X:130118831-130118853 GCATATGCCTGTGTGTGTGTGGG + Intergenic
1197927336 X:131660634-131660656 TAATGTGCATGTGTGTGTGTAGG - Intergenic
1198081164 X:133240849-133240871 GTGTGTGCACCTTTGTGCGTAGG - Intergenic
1199683070 X:150240762-150240784 CCATGTACACGTGTGTGAGCGGG + Intergenic
1200121484 X:153793147-153793169 GTGTGTGCCTGTGTGTGCGTTGG - Intronic
1200311454 X:155082576-155082598 ACATGTGCATGTGTGTATGTTGG - Intronic