ID: 1131190251

View in Genome Browser
Species Human (GRCh38)
Location 15:90309474-90309496
Sequence ATACACACACATACACCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3680
Summary {0: 1, 1: 0, 2: 26, 3: 352, 4: 3301}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131190248_1131190251 26 Left 1131190248 15:90309425-90309447 CCACAGCAAGAAGTGTACACCCA 0: 1
1: 0
2: 1
3: 12
4: 146
Right 1131190251 15:90309474-90309496 ATACACACACATACACCTACAGG 0: 1
1: 0
2: 26
3: 352
4: 3301
1131190249_1131190251 7 Left 1131190249 15:90309444-90309466 CCCAACGCACACACGTGCACATG 0: 1
1: 0
2: 6
3: 61
4: 341
Right 1131190251 15:90309474-90309496 ATACACACACATACACCTACAGG 0: 1
1: 0
2: 26
3: 352
4: 3301
1131190250_1131190251 6 Left 1131190250 15:90309445-90309467 CCAACGCACACACGTGCACATGC 0: 1
1: 3
2: 15
3: 108
4: 507
Right 1131190251 15:90309474-90309496 ATACACACACATACACCTACAGG 0: 1
1: 0
2: 26
3: 352
4: 3301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131190251 Original CRISPR ATACACACACATACACCTAC AGG Intronic