ID: 1131192056

View in Genome Browser
Species Human (GRCh38)
Location 15:90324708-90324730
Sequence CCTGATTAGCAGCAGTTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131192056_1131192058 -10 Left 1131192056 15:90324708-90324730 CCTCACAACTGCTGCTAATCAGG No data
Right 1131192058 15:90324721-90324743 GCTAATCAGGATGTATACTGAGG No data
1131192056_1131192059 -9 Left 1131192056 15:90324708-90324730 CCTCACAACTGCTGCTAATCAGG No data
Right 1131192059 15:90324722-90324744 CTAATCAGGATGTATACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131192056 Original CRISPR CCTGATTAGCAGCAGTTGTG AGG (reversed) Intergenic
No off target data available for this crispr