ID: 1131193495

View in Genome Browser
Species Human (GRCh38)
Location 15:90336116-90336138
Sequence GCCATTAAAAATAATGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131193495_1131193497 -6 Left 1131193495 15:90336116-90336138 CCAACCTCATTATTTTTAATGGC No data
Right 1131193497 15:90336133-90336155 AATGGCTACATACTGTTTCATGG No data
1131193495_1131193498 0 Left 1131193495 15:90336116-90336138 CCAACCTCATTATTTTTAATGGC No data
Right 1131193498 15:90336139-90336161 TACATACTGTTTCATGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131193495 Original CRISPR GCCATTAAAAATAATGAGGT TGG (reversed) Intergenic
No off target data available for this crispr