ID: 1131196645

View in Genome Browser
Species Human (GRCh38)
Location 15:90360682-90360704
Sequence GTAAGGCTTCACCCCTGTGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131196645_1131196650 -5 Left 1131196645 15:90360682-90360704 CCCACACAGGGGTGAAGCCTTAC 0: 1
1: 0
2: 3
3: 10
4: 104
Right 1131196650 15:90360700-90360722 CTTACAGGTGTAATGACTGTGGG 0: 1
1: 0
2: 21
3: 20
4: 205
1131196645_1131196649 -6 Left 1131196645 15:90360682-90360704 CCCACACAGGGGTGAAGCCTTAC 0: 1
1: 0
2: 3
3: 10
4: 104
Right 1131196649 15:90360699-90360721 CCTTACAGGTGTAATGACTGTGG 0: 1
1: 6
2: 120
3: 168
4: 435
1131196645_1131196652 17 Left 1131196645 15:90360682-90360704 CCCACACAGGGGTGAAGCCTTAC 0: 1
1: 0
2: 3
3: 10
4: 104
Right 1131196652 15:90360722-90360744 GGAGAGTTTTAGCCAGAGCTCGG 0: 1
1: 0
2: 2
3: 22
4: 171
1131196645_1131196651 -4 Left 1131196645 15:90360682-90360704 CCCACACAGGGGTGAAGCCTTAC 0: 1
1: 0
2: 3
3: 10
4: 104
Right 1131196651 15:90360701-90360723 TTACAGGTGTAATGACTGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131196645 Original CRISPR GTAAGGCTTCACCCCTGTGT GGG (reversed) Exonic