ID: 1131201030

View in Genome Browser
Species Human (GRCh38)
Location 15:90396088-90396110
Sequence TGTCACTTTCTGTAATTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131201029_1131201030 15 Left 1131201029 15:90396050-90396072 CCACGGTGATAAGTCGAGCTTAG 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1131201030 15:90396088-90396110 TGTCACTTTCTGTAATTTAGAGG 0: 1
1: 0
2: 2
3: 25
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131201030 Original CRISPR TGTCACTTTCTGTAATTTAG AGG Intronic
901685831 1:10942870-10942892 TGTGACATTCTCTGATTTAGGGG + Intergenic
903196577 1:21693666-21693688 GGGCTCTTTCTGTAATTTAAAGG + Intronic
905482898 1:38273816-38273838 TGTCACTTTCTGTTATTTACTGG + Intergenic
909293495 1:73913692-73913714 TGTGTCTTTCTATAATTTAGTGG + Intergenic
911249732 1:95561590-95561612 TTTCACATTCTTTAATTTGGAGG + Intergenic
912236734 1:107859615-107859637 TTTAGTTTTCTGTAATTTAGGGG - Intronic
915126045 1:153665726-153665748 TGTCATTTTCTGTCAATTAGTGG - Exonic
915746861 1:158167771-158167793 TATCACTATCTGAAATTAAGTGG - Intergenic
918616717 1:186552738-186552760 TGTCACTTTTTCCAATTTAATGG + Intergenic
921255564 1:213335869-213335891 TTTCACATTCTCTAATTCAGTGG - Intergenic
921348761 1:214214114-214214136 TGTCACTTTCTGCCATCTACTGG - Intergenic
921978845 1:221233158-221233180 TGTTACTAGCTGGAATTTAGTGG + Intergenic
924198054 1:241629924-241629946 TGTAAGTTTTTTTAATTTAGGGG - Exonic
1063917665 10:10900347-10900369 TGTCACTTTCTATAAATTGTTGG - Intergenic
1065677088 10:28187974-28187996 TTTCACTTTCTGAAATTTCCAGG + Intronic
1065690155 10:28324511-28324533 AGGCCCTTTCTGCAATTTAGTGG + Intronic
1066350136 10:34629821-34629843 TGTCATTTTCTGTAGGTCAGTGG + Intronic
1068967350 10:62926263-62926285 TGTCACGTGCTATAATTCAGGGG - Intergenic
1070996342 10:80786503-80786525 TGTTACTTTCTGTCATCCAGGGG - Intergenic
1071014840 10:80983893-80983915 TAACACTTTCTTTAATTTTGTGG + Intergenic
1072943990 10:99793282-99793304 GGTCACTATCTGCATTTTAGTGG - Intronic
1073510176 10:104037931-104037953 TTTCTCCATCTGTAATTTAGGGG - Intronic
1073642591 10:105268209-105268231 TGTCATTATTTGTAATTTATAGG - Intergenic
1073981708 10:109161558-109161580 TGTCAATTTCCCTAATTTTGAGG + Intergenic
1074739205 10:116468183-116468205 TGTCTCTTTATGTACTTGAGTGG + Intronic
1075032660 10:119035822-119035844 TGCCATTTTCTGGAATTTAAGGG - Exonic
1075584372 10:123646513-123646535 TGGCCCTTTCTGGAATTTGGAGG - Intergenic
1082836526 11:57654878-57654900 TGACTCTTTCTGTATTTTAGAGG + Intronic
1083060124 11:59861125-59861147 TGTCTCTTTCTCTAGTTTATTGG - Intronic
1085701758 11:78752095-78752117 TGTCACTTTCTGTGGGTTTGAGG + Intronic
1087757000 11:102064842-102064864 TATGACTTTCTGTAATTTAATGG + Intronic
1088377094 11:109152958-109152980 TGTTACTTTCTATCATATAGAGG + Intergenic
1089114790 11:116086035-116086057 TGTCACCTTCTGCAATTAAATGG + Intergenic
1089446585 11:118557662-118557684 AGTCATTTTATGTAATTTATGGG - Intronic
1089907386 11:122054812-122054834 AGTCAGTGTCTGTCATTTAGGGG + Intergenic
1090081899 11:123619015-123619037 TGTGACTCTCTGTCCTTTAGGGG + Intronic
1090973442 11:131662250-131662272 TGACACTTTTCCTAATTTAGAGG - Intronic
1092712041 12:11349189-11349211 TTCCATCTTCTGTAATTTAGTGG + Intergenic
1093984572 12:25515362-25515384 TTTGACTTACTGTAATTTGGGGG - Intronic
1094217187 12:27955527-27955549 TGTCACTTTCTATCTTTTGGAGG + Intergenic
1097472000 12:60005083-60005105 AGTCACTTTGCGTAGTTTAGAGG - Intergenic
1098538508 12:71623264-71623286 TGTGATTCTCTGTAATTAAGTGG - Intronic
1098580955 12:72098496-72098518 TTGCTGTTTCTGTAATTTAGAGG + Intronic
1099201213 12:79679357-79679379 TGTCACATTCGGCAATTAAGAGG + Intronic
1099637609 12:85234492-85234514 TGTCTCTTTTTTTAATTGAGTGG + Intronic
1105483965 13:20807811-20807833 TGTCCTTTTCTGTAGTTTTGAGG - Intronic
1106628927 13:31450156-31450178 TGTAACTTTCTATACTTTAGAGG - Intergenic
1109021443 13:57098694-57098716 TGTTAATTTCTGTCATTTAATGG + Intergenic
1109115467 13:58376989-58377011 TGTCATTTTCTGTACTTTTGTGG - Intergenic
1109696096 13:65960389-65960411 TATCACTTTATGTAAATCAGTGG + Intergenic
1110993740 13:82076894-82076916 TGTCCCTTGCTGTAAAATAGTGG + Intergenic
1111077762 13:83261164-83261186 TGTCCATTTCTGAATTTTAGTGG - Intergenic
1112041118 13:95549214-95549236 TGTTACTTTGAATAATTTAGAGG + Intronic
1112933285 13:104768344-104768366 TCTCACTGTCTCTGATTTAGTGG - Intergenic
1113058935 13:106300318-106300340 TGTCAGATCCTGTAATTCAGGGG + Intergenic
1113268205 13:108642742-108642764 TGTCACTTACTATAAATCAGAGG - Intronic
1113446832 13:110375406-110375428 TGGCATTTTCTGTCATTTTGCGG - Intronic
1114132625 14:19809975-19809997 TGTCAATTTCTGTTTTTTTGTGG - Intronic
1114406371 14:22460688-22460710 TATCACTTTCTGTTATCAAGTGG + Intergenic
1114481117 14:23035158-23035180 AGTCACTTCCTGTGATTTTGAGG - Intronic
1115708318 14:36021320-36021342 TTTCACTTTCTGTGATTTAAAGG + Intergenic
1116248188 14:42445345-42445367 TGTCATTTTCTGTAATGTAAGGG - Intergenic
1116266112 14:42692606-42692628 TGTCAGTTTCCCTAATTTTGAGG - Intergenic
1116378903 14:44240019-44240041 TGTCTGTTTCTCTAATTTTGGGG - Intergenic
1117536430 14:56707418-56707440 TGTGACTTTCTGTCATTTCTGGG - Intronic
1117692098 14:58318132-58318154 AGTCAGTTTCTGGAAGTTAGGGG + Intronic
1118026799 14:61777153-61777175 TTTCACTTTCTGTTATATAAAGG + Intronic
1118049373 14:62010172-62010194 TGCCACTTTCTGGAAATTATAGG + Intronic
1124562254 15:30785771-30785793 TGTCTCTTTCTTTAATGTTGTGG + Intergenic
1125662599 15:41405880-41405902 TGTCACTGCCTGCAATATAGGGG - Intergenic
1126878491 15:53069886-53069908 TAGGACTTTCTGTAATTTTGTGG + Intergenic
1127208422 15:56744954-56744976 TGTCAGCATCTGTAATTCAGTGG + Intronic
1127425591 15:58852790-58852812 TTTCACTTTCTGTAGTTAAACGG + Intronic
1128022939 15:64408648-64408670 TGTCACTATTTGTAATTATGGGG + Intronic
1128304639 15:66589997-66590019 TGTCATTTTATGTAAATTACTGG + Intronic
1128338696 15:66804846-66804868 TTTCCTTTTCTGTAATATAGAGG + Intergenic
1128351292 15:66891717-66891739 TGTAATTTTGTGTAGTTTAGGGG - Intergenic
1129543294 15:76369369-76369391 TGCCACTTTCTGTAAATCAGAGG - Intronic
1130363872 15:83215121-83215143 TGTCACTTTCTGTATTATTCTGG - Intergenic
1131201030 15:90396088-90396110 TGTCACTTTCTGTAATTTAGAGG + Intronic
1133646296 16:7767817-7767839 TTTAACTTTCTGAAATTTTGGGG - Intergenic
1134317542 16:13133078-13133100 TGTGAGTTTCTGGAATGTAGAGG - Intronic
1135947713 16:26879478-26879500 ACTCACTTTCTGTCATTTATTGG - Intergenic
1136134944 16:28250116-28250138 TGTCAGCTTCTCTAATTTTGAGG + Intergenic
1138697257 16:58826150-58826172 TGTCTCTTTCTCTCTTTTAGGGG - Intergenic
1139687392 16:68615085-68615107 TTTCACTTTATATAATTTAGAGG - Intergenic
1143949669 17:10622738-10622760 TGTCACTGTCTGAAATATGGGGG - Intergenic
1145230490 17:21170108-21170130 TGTCAATTGCTGTAATTTTCTGG + Intronic
1148294068 17:46484632-46484654 TCTCACTTTCTGTCATTTTGTGG + Intergenic
1148316251 17:46702335-46702357 TCTCACTTTCTGTCATTTTGTGG + Intronic
1149138200 17:53395856-53395878 TGTCACTGTCAGTAATATATTGG + Intergenic
1153193264 18:2566168-2566190 TATCTCTTTCAGGAATTTAGAGG - Intronic
1153386055 18:4498275-4498297 TGTCAGTTTCTGTAGGTTTGAGG + Intergenic
1153622766 18:6995171-6995193 TGCCAGTTTCTGTGGTTTAGTGG - Intronic
1153927164 18:9844180-9844202 TGTCACTTCCTGTCCTTCAGTGG + Intronic
1154141611 18:11829076-11829098 TGTGGCTTTCTGTAATTTGAAGG - Intronic
1154313764 18:13287237-13287259 TGTATCTTTCTGTACTTTATGGG - Intronic
1154328052 18:13406380-13406402 TGTCACTTCCTGACATATAGAGG - Intronic
1155295127 18:24377235-24377257 TGTCACTTTCTCTGACTCAGAGG + Intronic
1156205799 18:34884199-34884221 TGTCACCTTCTGTATTTCAGTGG + Intronic
1156542223 18:37925484-37925506 TATCCCTTTCTGTAGTTTTGGGG - Intergenic
1158737437 18:60099256-60099278 TCTTACTTTCTGTAATTTCTAGG - Intergenic
1159367711 18:67491065-67491087 TTTACCTTTCTTTAATTTAGAGG + Intergenic
1159593008 18:70355153-70355175 TTCCACTTTCTGTCATTTAGTGG - Intergenic
1161090062 19:2355482-2355504 TCTCACTTTCTCTAACGTAGCGG - Intergenic
1166157884 19:40928473-40928495 TTTCACTATCTATAATTTAGAGG - Intergenic
1166405768 19:42520923-42520945 TGTCCCTTTCTGTAACTTCTTGG - Intronic
1166677796 19:44749813-44749835 TGAGACTTTGGGTAATTTAGAGG + Intronic
1167400867 19:49267937-49267959 TGTGTTTTTCTGTATTTTAGAGG + Intergenic
925202851 2:1982842-1982864 TTTCTCTTGCTGTAGTTTAGGGG + Intronic
925456513 2:4021071-4021093 GGTTACATTCTGTAAATTAGAGG - Intergenic
926590761 2:14738006-14738028 TGTCATTTTCTTTTATTGAGGGG - Intergenic
928713377 2:34032507-34032529 TTTGGCTTCCTGTAATTTAGTGG + Intergenic
929989548 2:46773999-46774021 TGTCTCTTTCTGGAATTAGGAGG + Intergenic
929990763 2:46784267-46784289 TCTCATTGTCTGTGATTTAGTGG - Intergenic
932254417 2:70272033-70272055 TGCCATTTTCTGGAATTTAAGGG - Intronic
932297311 2:70637374-70637396 AGTAACTTTTTGTAATTTGGGGG - Intronic
937171363 2:119873232-119873254 TGTATCTTTCTGCAAATTAGGGG - Intronic
938747777 2:134296294-134296316 AGTCAGTTTCTGGAATTTATGGG + Intronic
938979239 2:136509989-136510011 TGTCAATATCTGTAAATTACGGG - Intergenic
939090251 2:137771943-137771965 TGTCACTTTCTTGCATTTATGGG + Intergenic
939954555 2:148516132-148516154 TTTCACTTTCTGTAAGTTTTAGG + Intronic
940607440 2:155944634-155944656 TTTCATTATCTGTAAATTAGAGG + Intergenic
942426919 2:175869726-175869748 TGTCACTCACTGTACTTTACTGG - Intergenic
942430165 2:175902115-175902137 TGTGGCTTTCTCTGATTTAGGGG + Intergenic
943727820 2:191269871-191269893 TGTTATTTTGTGGAATTTAGAGG + Intronic
945139414 2:206667988-206668010 TGTGACTGTCTGGAAGTTAGAGG - Intronic
945697534 2:213126530-213126552 TGTTTCTTTCTGTAATCTGGAGG - Intronic
946536447 2:220635040-220635062 TTTCCCTTTCTGTTATTTAGTGG + Intergenic
946954542 2:224914704-224914726 TGTCTTTTTCTTGAATTTAGGGG - Intronic
1169725302 20:8722489-8722511 GGTCACTTTCTGCCATCTAGTGG + Intronic
1170994112 20:21335494-21335516 TGTCATTTTATGTAACATAGTGG + Intronic
1173280094 20:41619311-41619333 TATCAATGTCTGGAATTTAGTGG - Intergenic
1173465527 20:43278225-43278247 TGTCACTCTCTGCAATTAAGGGG + Intergenic
1173560815 20:44004156-44004178 TGTCACTTGCTGAGATGTAGAGG + Intronic
1174151114 20:48487009-48487031 TGTCTCTTTCTTTTTTTTAGAGG - Intergenic
1175608521 20:60331048-60331070 TGGCACTTTCTGAAGTTCAGGGG - Intergenic
1177070261 21:16496380-16496402 TGTAATTTTATGTAATTTACTGG - Intergenic
1177557799 21:22714798-22714820 TGGCACATTCAGTCATTTAGGGG - Intergenic
1177998890 21:28135601-28135623 TGTCAGCTTCTCTAATTTTGAGG + Intergenic
1179208003 21:39301641-39301663 TGCCAGTTTCTGTAAGTCAGCGG - Intronic
1184965525 22:47969353-47969375 TGTCACTTTTTTGACTTTAGGGG - Intergenic
1185013165 22:48327759-48327781 AGAGACTTTCTGTAATTTACAGG - Intergenic
949148149 3:729673-729695 TGTCAGTGTCTGTAATATTGTGG + Intergenic
951603648 3:24406762-24406784 TGTCTCTCTCTATTATTTAGTGG - Intronic
952756183 3:36869741-36869763 TGTAATTTTATGTAAGTTAGTGG - Intronic
953304091 3:41810506-41810528 TGTCTCTTTCTTTAATGTTGTGG + Intronic
953532913 3:43754231-43754253 TGTCACTCCCTCTAATTAAGGGG - Intergenic
954244639 3:49321298-49321320 TGTAAGTTTATGTAATTTATGGG - Intronic
954277073 3:49549305-49549327 TGACATTTTCTGTAGTTTATTGG + Intergenic
956543086 3:70365797-70365819 TGTCACTTTCTTCAATTTTTTGG + Intergenic
956589602 3:70899827-70899849 TGTCACTAACTGTAAATTAGAGG - Intergenic
958688637 3:97432113-97432135 TGGCACTTTAGGTAATTAAGTGG - Intronic
960133020 3:114077406-114077428 TGTCAATTTTTGAAATTGAGGGG + Intronic
961535025 3:127565320-127565342 TGTCACTTTCTGAAATTTTTTGG + Intergenic
962179538 3:133191460-133191482 TGTCACCTACTGTTATTTTGTGG - Intronic
963722906 3:148884403-148884425 TGTCACTTCCTGTGATTCATTGG - Intronic
963769109 3:149370730-149370752 GGAAACTTTCTGTAATTTTGGGG - Intronic
963905816 3:150772918-150772940 TGTCCCTTTCTGTAGTTTATGGG + Intergenic
966090352 3:176127982-176128004 TGTCACTTGCTCTATTCTAGTGG - Intergenic
966366753 3:179196595-179196617 TGTTAATTTCTGTATTTTCGTGG + Intronic
971090417 4:23337202-23337224 TCTCAGTTTCTGCAATTTGGGGG - Intergenic
972057354 4:34819683-34819705 TGTCAGTTTCCTTAATTTTGAGG + Intergenic
972657213 4:41076029-41076051 TCTCACTTACTGTCATTTAGGGG - Intronic
972928757 4:44045057-44045079 TGTCATGGTCTGGAATTTAGAGG - Intergenic
973283705 4:48390975-48390997 TGGCAATTTCTGGAATTTACTGG - Intronic
974317745 4:60304488-60304510 TTTCACTTTATTTAATTCAGTGG - Intergenic
974489613 4:62548120-62548142 TGTAAGTTTCTGAAATTTGGGGG + Intergenic
976854421 4:89586213-89586235 TATCATTTTCTGTATTTTAAAGG - Intergenic
978171624 4:105678032-105678054 TATCAGTTTCTGTAGTTCAGAGG - Exonic
978556504 4:109986557-109986579 TTTAACTTTCTTTAATTTATCGG + Intronic
979217250 4:118180544-118180566 TGTTACTTCCTGGCATTTAGTGG - Intronic
981173809 4:141656742-141656764 TATCACTTTCTGTATATTACTGG + Intronic
981281947 4:142968657-142968679 TGTCATTTTCTTTGATTTACAGG - Intergenic
981777579 4:148387375-148387397 TCTCCCTTTCTCTAGTTTAGAGG - Intronic
982264362 4:153524797-153524819 TATCACTTTATGTTATTTAGAGG + Intronic
983886990 4:172990964-172990986 TGTCCCTTTTTGGAATTCAGGGG + Intronic
983890268 4:173023130-173023152 TTTAGCTTTCTGTAATTTGGGGG - Intronic
984430919 4:179648157-179648179 TATCACTTTGTTTTATTTAGAGG - Intergenic
984822517 4:183894653-183894675 TGTGGCTTCCTGTAATTTAAGGG - Intronic
1202750409 4_GL000008v2_random:870-892 TGTCACATGCTGTAATGCAGTGG - Intergenic
986926357 5:12757728-12757750 TATCTCTTTCTGTAGTTTGGAGG - Intergenic
986966149 5:13274158-13274180 TGTAACTTTCTGTAGTTTCAAGG - Intergenic
987959241 5:24783518-24783540 TTTCATTTTATGTAATTTAATGG - Intergenic
988277566 5:29101491-29101513 TGACACTTGGTGTAATTTATGGG + Intergenic
988804206 5:34725274-34725296 TGTCAGTGTCTATGATTTAGGGG + Intronic
993031499 5:82711807-82711829 TATAACTTTCTGTTTTTTAGAGG - Intergenic
995705180 5:114981394-114981416 TCACACTTTCTGTAATTTAGGGG + Intergenic
995749592 5:115440558-115440580 TGTCACTTTTTCTAATTTTATGG + Intergenic
999137228 5:149330010-149330032 TGGCACTTTCTTTAATTGGGAGG - Intronic
1000324508 5:160162073-160162095 TGTAACTTTTTGTAATTTTAGGG + Intergenic
1001068165 5:168556901-168556923 TTGCACTTTCTGTATTTTACAGG - Exonic
1003826381 6:9957269-9957291 TTCCAATTTCTTTAATTTAGAGG - Intronic
1004223525 6:13767059-13767081 TGTCCCTTTCTGGAAAGTAGAGG + Intergenic
1004653404 6:17634288-17634310 TGCCACTCCCTGTAAGTTAGCGG + Intronic
1008104925 6:47431010-47431032 CGTCACTCTCTTTAAATTAGCGG + Intergenic
1008146349 6:47896181-47896203 TTTCATTTTCTGTACTGTAGTGG + Intronic
1008810508 6:55492133-55492155 TATCATTTGCTTTAATTTAGGGG - Intronic
1009397677 6:63219263-63219285 TATCAGTTTTTGTAACTTAGGGG - Intergenic
1010481908 6:76365517-76365539 TGTCACGTTCTGGATCTTAGAGG + Intergenic
1011089137 6:83575488-83575510 TGGCACTTTCTGGATCTTAGAGG + Intronic
1011938315 6:92810841-92810863 TGTCACCTTCAGTATTTTAAAGG - Intergenic
1012688869 6:102288812-102288834 TGTTACATTCTGCAATCTAGTGG - Intergenic
1014920640 6:127211314-127211336 TGTCCATTTCTTTCATTTAGTGG - Intergenic
1015645553 6:135384212-135384234 TTTCCCTTTCTAAAATTTAGTGG + Intronic
1017141335 6:151192782-151192804 TATAACTTTCTGTGATTTTGAGG + Intergenic
1018087529 6:160317070-160317092 TGTCAAATTCTTCAATTTAGTGG + Intergenic
1018374836 6:163201210-163201232 TGACACTTTCTGTAAATTAAAGG - Intronic
1018529660 6:164749447-164749469 TTTCTCTTTCCGTAAGTTAGTGG + Intergenic
1018591451 6:165428490-165428512 TGTCACTTGCGTTAATTTTGGGG - Intronic
1018896327 6:168020280-168020302 TTTCTCTTTCCGTACTTTAGAGG - Intronic
1020559790 7:9716722-9716744 TGTCACTTGCTGTACCCTAGTGG + Intergenic
1023064603 7:36365008-36365030 TTTCCCTTCCTATAATTTAGTGG - Intronic
1023694933 7:42835841-42835863 TGTCACTCTCCAAAATTTAGGGG + Intergenic
1023783950 7:43686682-43686704 TGTCACTTTTTGTCCTTTACTGG + Intronic
1024705312 7:51951708-51951730 TTTTATTTTCTGTAATTTAAAGG - Intergenic
1024874437 7:54005865-54005887 ATTCACTATCTGTAATGTAGAGG - Intergenic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1030468371 7:109931662-109931684 TGTCACTTTCTGAAATATGGAGG - Intergenic
1030659182 7:112201991-112202013 TGTCATTTTCAGTAATGTGGAGG - Intronic
1034358006 7:150468802-150468824 TGTCTTTGTCTGGAATTTAGTGG - Intronic
1034887084 7:154806178-154806200 CTTCTCATTCTGTAATTTAGAGG - Intronic
1035457014 7:159015328-159015350 TGTCACTTTGCTTATTTTAGAGG + Intergenic
1037193970 8:16164978-16165000 TGATATTTTCAGTAATTTAGTGG + Intronic
1037392298 8:18406151-18406173 TGTTACTTTCTGTATTTTTCTGG - Intergenic
1037920018 8:22799215-22799237 TCTCACTTTCTGTCATTGTGCGG + Intronic
1037962713 8:23110657-23110679 TGTCACTCTTTGATATTTAGTGG + Intronic
1037968770 8:23155972-23155994 TGTCACTCTTTGATATTTAGTGG - Intronic
1038837869 8:31148472-31148494 TTTCAAATTCTGTAACTTAGAGG - Intronic
1038893382 8:31752991-31753013 TGTCACTTTGAGCAATTTATTGG + Intronic
1038915940 8:32023315-32023337 TTTCACTTTTTGTATTTTAAAGG - Intronic
1040929269 8:52716754-52716776 TGTAATTTACTGTAATTTGGAGG - Intronic
1042801205 8:72719741-72719763 TGGCACTTGCAGTACTTTAGTGG + Intronic
1043926374 8:86041459-86041481 AGTCGCCTTCTGTAATTTATGGG + Intronic
1046755550 8:117969431-117969453 TTTCACTTTATAGAATTTAGAGG - Intronic
1046836024 8:118802301-118802323 TCTTACTTTCTCTAATTTACTGG - Intergenic
1047039150 8:120973596-120973618 TATCACTTTCTGTATTATAAAGG - Intergenic
1047396888 8:124508913-124508935 TGTTACTTTCTGAAAATTAAAGG - Intronic
1047950467 8:129929717-129929739 TTTCACTTTCTGCCTTTTAGTGG + Intronic
1048162853 8:132037081-132037103 AGTCACTTGCATTAATTTAGGGG + Intronic
1048643539 8:136391568-136391590 TGTAACTATTTATAATTTAGAGG + Intergenic
1048799046 8:138179439-138179461 TTTCACTTTCTGTAATTGGATGG - Intronic
1051437197 9:17045349-17045371 TGTCCCTTTCTGCCATTTTGTGG - Intergenic
1051573325 9:18584492-18584514 TGTCATTTTCTGCCATTGAGTGG - Intronic
1052124043 9:24754052-24754074 AGCCACTCTCTGTCATTTAGAGG - Intergenic
1052418747 9:28213379-28213401 TTTCATTTTCTGTATTTTTGTGG - Intronic
1052596464 9:30566309-30566331 TGTCAGATTTTGAAATTTAGTGG - Intergenic
1052669355 9:31535655-31535677 TTTCACATTCTGGAATTCAGTGG - Intergenic
1055709938 9:79049811-79049833 AGTCACTTTCTGTAGATTATTGG - Intergenic
1055846454 9:80569306-80569328 AGTCACTCTCAGTAATTTAAAGG + Intergenic
1056945827 9:90995824-90995846 TGTCACTTGCAGTCATCTAGAGG + Intergenic
1057368141 9:94443367-94443389 TGACACGTTCTGTAATTAATTGG - Intronic
1060861310 9:126957001-126957023 TGTGACTTGCTGTGAGTTAGTGG - Intronic
1061498508 9:130989480-130989502 GGTCACTCCCTGTTATTTAGGGG + Intergenic
1186897993 X:14024190-14024212 TGTCAATGGCTGTGATTTAGAGG + Intronic
1187868983 X:23748912-23748934 TGTCTCTTTCAATAATATAGGGG + Intronic
1188077833 X:25800845-25800867 TGTCATGTTCTGTATCTTAGGGG + Intergenic
1189008295 X:37017917-37017939 TCTCACTTTGTGAGATTTAGTGG + Intergenic
1190400465 X:50028579-50028601 TGTCTCTTTCTCTAATTTTGGGG + Intronic
1190437691 X:50442700-50442722 TCTCAGTTTCTGTAGGTTAGAGG + Intronic
1191226162 X:58045275-58045297 TGTCACCTTCTTTATTTTTGAGG + Intergenic
1191663394 X:63673210-63673232 TGTCATTTTCAGTGATTAAGAGG - Intronic
1195436646 X:104852089-104852111 TCTCCCTTTCTGTTATTTAATGG - Intronic
1195523554 X:105858948-105858970 TTTCACTTTCTTTAATTTCTGGG + Intronic
1196156057 X:112431595-112431617 TGTCTGTCTCTCTAATTTAGGGG + Intergenic
1196320176 X:114277989-114278011 TCTCTGTTTCTGAAATTTAGAGG - Intergenic
1196939723 X:120763201-120763223 TGTCCCTTTCTGAAATGTTGGGG + Intergenic
1197379625 X:125723496-125723518 GTTCTCTTTCTGTAAATTAGGGG - Intergenic
1197524701 X:127547198-127547220 TGTGACATTTTGAAATTTAGAGG + Intergenic
1199022816 X:142902430-142902452 TGTCAGTTTCTCTACTTTTGAGG - Intergenic
1200429722 Y:3064912-3064934 ATTCATTTTCTGTAATTTAAGGG + Intergenic