ID: 1131214582

View in Genome Browser
Species Human (GRCh38)
Location 15:90526641-90526663
Sequence CCTACATTGCACAAGCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131214578_1131214582 8 Left 1131214578 15:90526610-90526632 CCTTTCATCTCAATATCTTTCTA No data
Right 1131214582 15:90526641-90526663 CCTACATTGCACAAGCTGAAAGG No data
1131214575_1131214582 18 Left 1131214575 15:90526600-90526622 CCGCACCCAGCCTTTCATCTCAA No data
Right 1131214582 15:90526641-90526663 CCTACATTGCACAAGCTGAAAGG No data
1131214577_1131214582 12 Left 1131214577 15:90526606-90526628 CCAGCCTTTCATCTCAATATCTT No data
Right 1131214582 15:90526641-90526663 CCTACATTGCACAAGCTGAAAGG No data
1131214576_1131214582 13 Left 1131214576 15:90526605-90526627 CCCAGCCTTTCATCTCAATATCT No data
Right 1131214582 15:90526641-90526663 CCTACATTGCACAAGCTGAAAGG No data
1131214574_1131214582 21 Left 1131214574 15:90526597-90526619 CCACCGCACCCAGCCTTTCATCT No data
Right 1131214582 15:90526641-90526663 CCTACATTGCACAAGCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131214582 Original CRISPR CCTACATTGCACAAGCTGAA AGG Intergenic
No off target data available for this crispr