ID: 1131215304

View in Genome Browser
Species Human (GRCh38)
Location 15:90530554-90530576
Sequence GGGTGGCGCGGCGCGGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131215292_1131215304 13 Left 1131215292 15:90530518-90530540 CCCGAGAGGAAATCGCAAACAGC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1131215304 15:90530554-90530576 GGGTGGCGCGGCGCGGCTTCTGG 0: 1
1: 0
2: 1
3: 23
4: 158
1131215291_1131215304 14 Left 1131215291 15:90530517-90530539 CCCCGAGAGGAAATCGCAAACAG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1131215304 15:90530554-90530576 GGGTGGCGCGGCGCGGCTTCTGG 0: 1
1: 0
2: 1
3: 23
4: 158
1131215293_1131215304 12 Left 1131215293 15:90530519-90530541 CCGAGAGGAAATCGCAAACAGCT 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1131215304 15:90530554-90530576 GGGTGGCGCGGCGCGGCTTCTGG 0: 1
1: 0
2: 1
3: 23
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131215304 Original CRISPR GGGTGGCGCGGCGCGGCTTC TGG Intronic
900332632 1:2143915-2143937 GGGTGACGAGGTGCTGCTTCAGG - Intronic
900344590 1:2204946-2204968 GGGGGGCGGGGCGGGGCTTGAGG - Intronic
900621848 1:3591137-3591159 GGAGGGCGGGGCGCGGCTGCTGG - Intronic
901665591 1:10824485-10824507 GGGTGGAGCAGCGTGGCTGCCGG - Intergenic
902897000 1:19485744-19485766 GCGCTGCGCGGCGCGGCTGCCGG + Intergenic
903950488 1:26993588-26993610 GGGGGGGGCGGGGCGGATTCAGG + Intergenic
905182649 1:36176455-36176477 GGGTGACGCTGCACGGCGTCAGG - Exonic
905554741 1:38873264-38873286 GGGGGGCGCGGCGTGGCTGGGGG - Intronic
906919517 1:50048514-50048536 GAGTGGCGCGGGGCTGCTGCGGG - Intronic
910408390 1:86914539-86914561 GGGGGGAGGGGCGGGGCTTCTGG + Intergenic
910449098 1:87328918-87328940 GGCCCGCGCGGCGCGGCTTCAGG - Exonic
912568864 1:110607401-110607423 GCGTGGCGCGGTGCGGCTGCGGG - Exonic
912625942 1:111204474-111204496 GGGCGGCGCGGCGCACCTTCCGG + Intronic
915545056 1:156592326-156592348 GGGTGGTTCGGCGGGGTTTCAGG - Intronic
916063530 1:161118308-161118330 GGAGGGCGGGGCGCGGCTTGGGG + Intronic
918302467 1:183216607-183216629 AGGAGGCGCTGCACGGCTTCGGG - Intronic
922234358 1:223712336-223712358 GGATGGCGCGGCCCGGCGCCGGG - Exonic
922315059 1:224434626-224434648 GGGCGCCGCGGGGCGGCTGCGGG + Intronic
924436905 1:244049514-244049536 GGCTCGCGCGTCGCGGCATCGGG + Intronic
1065590340 10:27256734-27256756 GGGGGGCGCGGGGCGGATTTGGG - Intergenic
1070328242 10:75401461-75401483 GGGAGGCGCGGGGCGGGCTCGGG + Exonic
1073242053 10:102065522-102065544 CGGCGGCGCGGCGCGGCTCCGGG + Exonic
1077322132 11:1947249-1947271 GGGGGGGGCGGCGCGGCCTCCGG + Intergenic
1083886500 11:65575962-65575984 GGGCGGGGCGACCCGGCTTCCGG - Intergenic
1084295932 11:68213444-68213466 GGGTGGCGGGGCGCGGGGGCGGG - Intronic
1087404902 11:97718058-97718080 TGGTGGGCCGGCGCGGGTTCCGG - Intergenic
1088604176 11:111512692-111512714 GGGGGTCGGGGCGCGGCTCCCGG + Intergenic
1089525797 11:119095578-119095600 GGGTGTCGCGGCTCGGCTGAGGG + Intergenic
1202805150 11_KI270721v1_random:2562-2584 GGGGGGGGCGGCGCGGCCTCCGG + Intergenic
1091550029 12:1530224-1530246 GGGTGTCGCGGCCCGGCTGGTGG + Intronic
1092695940 12:11171397-11171419 GGGTGTCGCGGCGGGGCTTGAGG - Intronic
1096502012 12:52069959-52069981 GCGGGGGGCGGTGCGGCTTCCGG + Exonic
1101848960 12:108387209-108387231 GGGTGGGGCAGGGCTGCTTCTGG - Intergenic
1103136130 12:118509417-118509439 GGGTGGGGAGGCACGGATTCGGG + Intergenic
1112506574 13:99979842-99979864 AGGATGCGCGGCCCGGCTTCTGG + Intergenic
1113798079 13:113070250-113070272 GGGTGGCACGGCTCAGCTCCCGG - Intronic
1113899606 13:113788868-113788890 GGGAGGCGCGGCGCGGCCCCCGG - Intronic
1120953379 14:90061793-90061815 AGGGGGCGTGGCGCGTCTTCAGG - Exonic
1121115702 14:91341283-91341305 GGGTGGTGTGGCTGGGCTTCAGG + Intronic
1122873097 14:104650506-104650528 GGGGGGCGCGGCGCGCCCTCTGG - Intergenic
1123037786 14:105478470-105478492 GGGTGGCGTAGCACGGCTTGTGG - Exonic
1124584480 15:30991992-30992014 CGGCGGCGCGGGGCGTCTTCTGG + Intergenic
1126087389 15:45023052-45023074 CGGAGGCGGGGCGGGGCTTCGGG - Intergenic
1126668496 15:51094939-51094961 GGGAGGCGCGGCGCCGCCCCCGG - Intronic
1127224986 15:56918934-56918956 GGGCGGCGCGGCGGGGCTGGGGG + Intronic
1127893798 15:63277496-63277518 GGGGGGCGGGGCGCGGCTCATGG - Intronic
1129644750 15:77419878-77419900 GGGCGGGGCGGCGCGGGTTCTGG - Intronic
1131200066 15:90388481-90388503 GGGTGGGGCAGGGCGGCTGCCGG + Intronic
1131215304 15:90530554-90530576 GGGTGGCGCGGCGCGGCTTCTGG + Intronic
1133021043 16:2967086-2967108 GAGCTGCGCGACGCGGCTTCGGG + Exonic
1133136633 16:3717142-3717164 GGGTCGGGCGGAGCGGCTGCGGG - Intronic
1139908454 16:70381908-70381930 GGATGGCGCGGGGCGGGCTCGGG + Intronic
1141531269 16:84648568-84648590 GGGCGGCGGGGCCCGGGTTCAGG - Exonic
1141706511 16:85668218-85668240 GGGTGGAGGGGCGCGGCTGGAGG - Exonic
1143577690 17:7804211-7804233 GTGTGGAGAGGCGGGGCTTCCGG - Intronic
1143668175 17:8376727-8376749 GGCTGGCGCTGACCGGCTTCCGG - Intronic
1144695920 17:17303756-17303778 TGGAGGACCGGCGCGGCTTCTGG + Exonic
1144759690 17:17700399-17700421 GGGCGGCGGGGCGCGGCCGCTGG - Intronic
1147184269 17:38705230-38705252 GGGTGGCGCGGGGCGGCGCGGGG + Intergenic
1147360542 17:39927230-39927252 GCGGGGAGCGGCTCGGCTTCGGG - Intronic
1147653022 17:42072710-42072732 GGCGGGGGCGGCGCGGCTCCTGG - Intergenic
1147756813 17:42773940-42773962 GGCTGGCGCGGGGGGGCGTCTGG - Intronic
1149413713 17:56436029-56436051 GGGTGGCAGGGCCAGGCTTCAGG + Intronic
1151655554 17:75494276-75494298 GGGTGGCGTGGTGGAGCTTCTGG - Intronic
1151876066 17:76868839-76868861 GGAGGGAGCGGCGCGGCTGCCGG - Intronic
1152552026 17:81034841-81034863 GGGAGGCGCGGCGCGGGCTGGGG - Intergenic
1152654116 17:81512203-81512225 GGATGGCGCCGCGGGGCTCCTGG - Intronic
1152685896 17:81693760-81693782 GGGTGGGGCGGGGCGGCCTCAGG + Intronic
1157666007 18:49487352-49487374 AAGGGGCGCGGCGAGGCTTCCGG + Intronic
1158435930 18:57435631-57435653 GCGTGGCGGGGCTCGGCTGCGGG - Intergenic
1160725991 19:618046-618068 GGGTGGGGCGAGGAGGCTTCTGG - Intronic
1160906837 19:1455616-1455638 GGGTTGGGGGGCGCGGGTTCTGG + Intronic
1161101791 19:2425195-2425217 GGGGGTCGCGGCGCGGGCTCGGG - Exonic
1161495002 19:4581689-4581711 GGGGGGCGCTGCGCGGCGGCCGG + Intergenic
1162024924 19:7888461-7888483 GGGCGGGGCGGGGCGGCTCCGGG + Intergenic
1162490394 19:10987844-10987866 GGGTGATGCGGCTCTGCTTCTGG - Exonic
1162744546 19:12791284-12791306 GGGTGGCTCGGCGGGGCTGCAGG - Intronic
1163635538 19:18435545-18435567 GTGAGGTGCGGCGCGGCTTCAGG - Exonic
1164834963 19:31350425-31350447 GGGGGGCGCGGCCCGGCTCCCGG - Intergenic
1165433272 19:35784199-35784221 GGGTGGCGCGGCGGCGTTCCGGG + Exonic
1165775801 19:38403645-38403667 GGATGGCGCGGCTGCGCTTCGGG + Exonic
1166292702 19:41873304-41873326 GGCTGGAGCGGCGCGGCTGCGGG - Intergenic
1167258167 19:48443207-48443229 GGGCGGCGCGGCGCGGCACGGGG - Exonic
1167982980 19:53291272-53291294 GGGTGGCTGGGCCCGGCTTAGGG - Exonic
1168689501 19:58368319-58368341 TCCTGGCGCGGCGCGCCTTCCGG - Exonic
926095735 2:10079943-10079965 GGGCGGCGCGGGGCGGGCTCCGG + Exonic
932722278 2:74146997-74147019 GGGTGGGGTGGAGCTGCTTCTGG + Intronic
933751164 2:85602728-85602750 GGGCGGCGCGGCGAGGCCTGGGG - Intronic
933847374 2:86337067-86337089 GGGCGGCGGGGCGCGGCGCCGGG + Intronic
936161028 2:110084442-110084464 AGGTGGCGCAGCGCGGTTCCTGG + Exonic
936183635 2:110286912-110286934 AGGTGGCGCAGCGCGGTTCCTGG - Intergenic
943324886 2:186486181-186486203 GGGTAGCGAGGAGCGGCTCCCGG - Exonic
944221851 2:197310917-197310939 GGGCTGCGCGGCTCGGCTGCGGG - Intronic
947729271 2:232419168-232419190 GGGCGGCGCGGCGGAGCGTCCGG - Intergenic
949019811 2:241734762-241734784 GGGTGGCGGGGCGCGATCTCGGG + Intronic
1169075910 20:2759730-2759752 GGGTGGCGCCCCGCAGCCTCGGG + Exonic
1170688194 20:18588030-18588052 GGGCGGCGCCGCGCTGCGTCCGG - Exonic
1170890146 20:20369038-20369060 GGGGGGCGCGGCGCGGCCGCTGG + Exonic
1171452819 20:25247994-25248016 GGGGGGCGGGGCGGGGCCTCGGG - Intergenic
1172028906 20:31968142-31968164 GGGAGGCGGGGAGCGACTTCCGG - Exonic
1172061552 20:32190223-32190245 GGCGGGCGCGCCGCGGCTTCTGG + Intergenic
1172126931 20:32630026-32630048 GGGCGGCGTGGCGAGGCTTCCGG + Intergenic
1172587137 20:36092789-36092811 GGCGGCGGCGGCGCGGCTTCCGG - Intronic
1172841193 20:37903511-37903533 GAGTGGCGCGGCCCGGGTTGGGG - Intronic
1173827603 20:46057652-46057674 GGGGGGCGCGGCGAGGGCTCCGG - Exonic
1174086824 20:48014853-48014875 TTGTGGCGTGGCGTGGCTTCTGG - Intergenic
1175439648 20:58981551-58981573 GGGTCCCGCGGCGCGGCCGCCGG + Intronic
1176109192 20:63403871-63403893 AGGTGGTGCGGCGCTGCCTCGGG - Intergenic
1183601826 22:38844258-38844280 GGGCCGCGCGGCGGGGCTCCTGG + Intergenic
1184046770 22:41976902-41976924 GGGCGGCGCGGCGGGGCCGCGGG + Exonic
1184127803 22:42500386-42500408 GGGTGGGGCGGGGCGGCCTAGGG + Intergenic
1184127814 22:42500407-42500429 GGGTGGGGCGGGGCGGCCTAGGG + Intergenic
1185255176 22:49827696-49827718 GGCTCGCGCGGCGCGGGCTCGGG + Intergenic
1185270638 22:49928068-49928090 GGGTGGCGCGGGGAGGCGACAGG - Intergenic
950487696 3:13282736-13282758 GGATGGCGCCGAGCGGCTGCGGG + Intergenic
952788240 3:37176562-37176584 GGGCGGCGAGGCGCGGCTGCCGG + Intronic
953139414 3:40213679-40213701 GGGTGGCGCAGTGGCGCTTCTGG - Intronic
953326040 3:42013481-42013503 GGAAGGCGGGGCGCGGCTCCAGG + Intergenic
954423224 3:50429834-50429856 GGGTGGAGGGGCGGGGCATCAGG - Intronic
960896772 3:122514468-122514490 GGGCGGCGTGGCGCGGCGGCGGG - Intronic
961377465 3:126476123-126476145 GGGGGGCGGGGCGCGGGGTCGGG + Intergenic
961377476 3:126476143-126476165 GGGGGGCGGGGCGCGGGGTCGGG + Intergenic
961377487 3:126476163-126476185 GGGGGGCGGGGCGCGGGGTCGGG + Intergenic
961377498 3:126476183-126476205 GGGGGGCGGGGCGCGGGGTCGGG + Intergenic
961377509 3:126476203-126476225 GGGGGGCGGGGCGCGGGGTCGGG + Intergenic
961446354 3:126983373-126983395 GGTGGGCGCGGGGCGGCCTCCGG + Intergenic
963880259 3:150520589-150520611 GGGTGGCGCGGCCGGGGTTTGGG - Intergenic
968661440 4:1800356-1800378 GGGTGGGGAGGTGGGGCTTCTGG + Intronic
968878208 4:3285447-3285469 GGGTGGCGTGGCTGGGCCTCTGG + Intergenic
969114008 4:4860166-4860188 GGGTGGCTCGGCGCAGCCACTGG + Exonic
972396539 4:38663775-38663797 GGCTGGCGGGGCGCGGACTCCGG + Intergenic
973642102 4:52913638-52913660 GGGTGGGGCGGTGTGGTTTCAGG - Intronic
973764268 4:54149369-54149391 GGGCGGGGCGGCGGGGCTCCGGG + Intronic
975800744 4:78057375-78057397 GTGTGGTGCGGTGCGGCTGCAGG + Intergenic
984668075 4:182449120-182449142 GGCTGGCGGAGCGCGGCTCCCGG + Intronic
986858860 5:11903897-11903919 GCGCGGCGCCGCCCGGCTTCAGG + Exonic
987090841 5:14506829-14506851 GGATGGCGTGGCCCGGCTGCCGG - Intronic
990937144 5:61162745-61162767 AGGAGGCGTGGAGCGGCTTCAGG + Intergenic
992191234 5:74294192-74294214 GGGTGGCAGGGTGAGGCTTCAGG - Intergenic
992207577 5:74445825-74445847 GGGTGTCGCAGGGGGGCTTCAGG + Intergenic
998130311 5:139648466-139648488 GGGACGCGGGGCCCGGCTTCAGG - Exonic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
1001392291 5:171388532-171388554 GGGAGGCGCGGCGCGGCGTGAGG + Intronic
1002000411 5:176193733-176193755 GGGTGGCGGGGCTGGGATTCAGG - Intergenic
1002253925 5:177945248-177945270 GGGTGGCGGGGCTGGGATTCAGG + Intergenic
1002442835 5:179273234-179273256 GGGCGGCGGGGGGCGGCCTCTGG - Intronic
1003872166 6:10412230-10412252 GGGGGCCGCGGCGCGGCGTCTGG + Intronic
1005348339 6:24911135-24911157 GGGAGGCGCGGCGCGGGGGCCGG + Intronic
1006170124 6:32087619-32087641 GGGTGGCGGGGCGGGGGTGCGGG + Intronic
1006634583 6:35452658-35452680 AGGGGGCGCGGCGCGGCCTGGGG + Exonic
1007788926 6:44297835-44297857 GGGTGGCCAGGCCCGGCCTCGGG + Intronic
1018443576 6:163834796-163834818 GGGCGGGGCGGGGCGGCTCCAGG + Intergenic
1018621181 6:165731093-165731115 GGGTTCCGCGGCGCGGCATGGGG - Intronic
1018911183 6:168101558-168101580 GGGTGACGCGGCCCGGGGTCCGG + Intergenic
1019774886 7:2906503-2906525 GGGTGGGGCGGAGCGTCTGCTGG + Exonic
1020282467 7:6656478-6656500 GGGAGGCTCTGCGCGGCCTCAGG + Intergenic
1024131164 7:46354449-46354471 TGGTGGCAAGGCGCGGCTCCAGG + Intergenic
1026319567 7:69256998-69257020 GGGTGGGGAGACGAGGCTTCAGG + Intergenic
1031008449 7:116499729-116499751 GGCTGGCGCGGTGCGGCTCCCGG - Exonic
1031629823 7:124032940-124032962 GGGCGGCGCGGCGCGGCGTCCGG - Exonic
1032024630 7:128431303-128431325 GGGTGGCCCAGGGCGGTTTCCGG + Intergenic
1036185848 8:6621962-6621984 GGGTGGCCCGGGGTGGCTTTGGG - Intronic
1036688023 8:10924603-10924625 GGGTGGCGGGGCGCGGCCGGCGG + Intronic
1038002496 8:23403716-23403738 GCCGGGCGCGGCGCGGCTGCTGG - Intronic
1038963496 8:32548072-32548094 GGGGGTGGCGGCGCGGCTGCCGG - Intronic
1040324595 8:46335335-46335357 GGGTGGCGTGGGGGGGCCTCAGG + Intergenic
1042253022 8:66775233-66775255 TGGTGGCGCGGCGCAGGTCCCGG + Exonic
1042722566 8:71841872-71841894 GGTTGGCGCAGCGGGGCTTGGGG + Exonic
1042785113 8:72537436-72537458 GGCTGGCGCGGCTCGCTTTCTGG + Exonic
1044934229 8:97277738-97277760 GGGTCGCGCGGGGCGTCGTCCGG + Exonic
1060856044 9:126915297-126915319 GGGCGGGGCGCCGCGGCTGCAGG + Intronic
1060992450 9:127856801-127856823 GGGTGGCTCGGTGGGGGTTCAGG + Intergenic
1061489958 9:130939278-130939300 GAGTGGCGCGGCGCTCCTTCCGG + Intronic
1061559734 9:131394506-131394528 TGGCGGCGCCGCGCGGCCTCAGG + Intronic
1062249380 9:135586718-135586740 GGCCGTCGCGGAGCGGCTTCGGG - Intergenic
1062651176 9:137578603-137578625 GGTGCGCGCGCCGCGGCTTCGGG - Exonic
1187067541 X:15855027-15855049 GGGTCACGTGGCCCGGCTTCCGG - Intergenic
1187242037 X:17522484-17522506 GGGGGGGGGGGGGCGGCTTCTGG - Intronic
1187369018 X:18688826-18688848 GGGAGGAGGGGCGTGGCTTCCGG + Intronic
1188542575 X:31266634-31266656 GGTTCCCGCGGCGCGGCTGCAGG - Intronic
1188736785 X:33726753-33726775 GGGGGGCGCGGGGCGGCTGGGGG + Intergenic
1192212562 X:69137155-69137177 GGGGGACGGGGCGGGGCTTCTGG - Intergenic
1201175847 Y:11307889-11307911 AGGTGGAGCGGCCCGGCTTGTGG - Intergenic