ID: 1131216286

View in Genome Browser
Species Human (GRCh38)
Location 15:90538421-90538443
Sequence AATCAAATACAGCAGGTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131216284_1131216286 -3 Left 1131216284 15:90538401-90538423 CCTGTGCAGTACATTTAAGAAAT 0: 1
1: 0
2: 1
3: 14
4: 196
Right 1131216286 15:90538421-90538443 AATCAAATACAGCAGGTATAAGG 0: 1
1: 1
2: 1
3: 12
4: 204
1131216283_1131216286 -2 Left 1131216283 15:90538400-90538422 CCCTGTGCAGTACATTTAAGAAA 0: 1
1: 0
2: 1
3: 24
4: 204
Right 1131216286 15:90538421-90538443 AATCAAATACAGCAGGTATAAGG 0: 1
1: 1
2: 1
3: 12
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131216286 Original CRISPR AATCAAATACAGCAGGTATA AGG Intronic
900779128 1:4606144-4606166 CAGCAGATACAGCAGGTACAGGG - Intergenic
902650663 1:17835206-17835228 AATCAAATAAATCAGGAAGAGGG - Intergenic
904942515 1:34175170-34175192 AATCAAATACAGCAGGGATACGG - Intronic
904973638 1:34438751-34438773 ATTCAGAGACATCAGGTATAGGG + Intergenic
909762096 1:79302560-79302582 AAGCAAATACTTCAGGTATGGGG + Intergenic
912567722 1:110600492-110600514 AAGCAAACACAGAAGATATATGG - Intronic
914910624 1:151782908-151782930 TATCCTATACCGCAGGTATAGGG - Exonic
917202002 1:172527189-172527211 AATGAAATACATAAGATATATGG - Intergenic
917285094 1:173415089-173415111 ACCCAAATACATCAGGGATAAGG - Intergenic
917779936 1:178383446-178383468 AATCACATACTGCATTTATACGG - Intronic
918811292 1:189124234-189124256 ACTCAAATACATCAAGTATAAGG + Intergenic
921592152 1:217016696-217016718 AGTCAAATAGAGGAGATATAAGG - Intronic
922089369 1:222380862-222380884 AATCATATAAAGCATGTATGAGG - Intergenic
923027138 1:230214019-230214041 AATGAAATACAGAAGGAATATGG - Intronic
923428701 1:233898089-233898111 GATGAAATACTTCAGGTATAAGG + Intergenic
1064480506 10:15735952-15735974 ACTCAAATCCAGCAGGAATGGGG - Intergenic
1065344528 10:24736100-24736122 AATTAAATAAAGTATGTATAAGG - Intergenic
1065821688 10:29531610-29531632 ACTCAAATACAACAAGTAGATGG + Intronic
1068252980 10:54468903-54468925 AATCAAAAACAGCAGAGACAAGG - Intronic
1069159121 10:65070718-65070740 AATAAAATAAAGCAGGCACATGG - Intergenic
1070893640 10:79963021-79963043 AAACAAAGACACCAGGAATAAGG - Intronic
1072445683 10:95496795-95496817 AATCAGATAGAGCAGGTTTCTGG - Intronic
1075078071 10:119364474-119364496 AACCAAATTCAGAAAGTATATGG - Intronic
1076249884 10:128977437-128977459 AAGAAAATACAGCAGGCCTAGGG - Intergenic
1076802882 10:132839865-132839887 AATAAAGTCCAGCAGTTATAAGG - Intronic
1078054245 11:7994333-7994355 AAGCAGATACAGCAGGAATATGG - Intronic
1079489157 11:20968136-20968158 AATCAAATTCAAATGGTATAGGG - Intronic
1079946851 11:26754101-26754123 AACAAAATCCAGCAGGTCTAGGG - Intergenic
1081263184 11:40986290-40986312 AATCAAATACAGAAAGGATTGGG + Intronic
1085559502 11:77457867-77457889 GAGCTTATACAGCAGGTATATGG - Intronic
1086259985 11:84927906-84927928 AATCAAAAACACTAGGTATGTGG + Intronic
1086429707 11:86724770-86724792 AATAAAACACAGCATATATAAGG + Intergenic
1086917822 11:92551172-92551194 CCTCAATTACAGCAGGTATCTGG + Intronic
1088342322 11:108782531-108782553 ATTAAAAAACAGCAGCTATAAGG - Intronic
1090505072 11:127302341-127302363 AGAGCAATACAGCAGGTATAGGG + Intergenic
1097922868 12:65095463-65095485 AATCAAATAGAGGAGATATGGGG - Intronic
1098966281 12:76792466-76792488 AATCTTATACAGCAGGTATAGGG - Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1099934599 12:89110265-89110287 AATCACAAACAGCAGTGATAAGG - Intergenic
1100085848 12:90909507-90909529 GATGAAGTACAGCAGGTATCAGG + Intronic
1100517070 12:95338665-95338687 AAACAAATACAGCTGGTTAAAGG + Intergenic
1101810748 12:108105719-108105741 AATAAAATAGAGCAGGGAAAGGG + Intergenic
1105486033 13:20833700-20833722 AATCATATACAACATGCATAGGG + Intronic
1105595141 13:21830390-21830412 AATAAAATAGAGCATGTTTAAGG - Intergenic
1106014661 13:25857357-25857379 AATAAAACACAGGAGCTATAAGG - Intronic
1108167519 13:47709030-47709052 AGACAACTACAGTAGGTATAAGG + Intergenic
1109043288 13:57371345-57371367 ATTCATATTCATCAGGTATATGG + Intergenic
1109383617 13:61598564-61598586 AATTAAAGACAGAAGGTAAAGGG - Intergenic
1109490310 13:63088950-63088972 ATTCACATACAGAAGGTATTTGG + Intergenic
1109531063 13:63648639-63648661 AATCAAATACTCTAGGTAAAGGG - Intergenic
1109978072 13:69868252-69868274 AATTAAAAACATCATGTATATGG + Intronic
1112041051 13:95548358-95548380 AAACAAATCCACAAGGTATATGG + Intronic
1112692400 13:101912235-101912257 AATAAATTACAGTATGTATAAGG - Intronic
1112942308 13:104878673-104878695 AATAAAATACTGAAGGTGTACGG - Intergenic
1114991359 14:28294133-28294155 AATCAAAGACAGAAGGTTAAAGG - Intergenic
1120207500 14:81602217-81602239 AAACAAACACAGAAAGTATAAGG - Intergenic
1123152053 14:106191640-106191662 AATAAAAAACAGCAGGTGTTTGG - Intergenic
1123509940 15:20988136-20988158 TATCAAGTACAGCAGTTATTTGG + Intergenic
1127515133 15:59686507-59686529 AATCAATTACAGTAGGCAGATGG + Intronic
1128182658 15:65618376-65618398 AATTATATACAGCAGTTAAAAGG - Intronic
1128260986 15:66232674-66232696 AATCAGAGACTGGAGGTATAAGG - Intronic
1128422826 15:67510450-67510472 GATCAAATACTGCAAATATAGGG - Intergenic
1129182231 15:73884723-73884745 GATCACATCCAGCAGGTCTATGG - Intronic
1131216286 15:90538421-90538443 AATCAAATACAGCAGGTATAAGG + Intronic
1131699875 15:94923048-94923070 AGTCAATTCTAGCAGGTATATGG - Intergenic
1136357841 16:29757922-29757944 CATAAATTACAGCATGTATAGGG - Intergenic
1137890022 16:52149913-52149935 AACCAAAGACAGCAGAAATATGG + Intergenic
1138719565 16:59063532-59063554 AAGAAAACACAGCAGGTAAATGG - Intergenic
1141510805 16:84510890-84510912 CATCAAAAACAGCAGCTACATGG + Intronic
1142783770 17:2203569-2203591 AATCCCATACAGCAGATATGAGG + Intronic
1144408894 17:14980469-14980491 AATAAAATACAGGAGATAGAAGG - Intergenic
1145855407 17:28152084-28152106 ATTCAAATCCCACAGGTATAGGG + Intronic
1146107739 17:30056951-30056973 AATCTCATATAGAAGGTATAAGG + Intronic
1146473181 17:33140601-33140623 AAACAAACACAGCAGGTCTCTGG - Intronic
1147736729 17:42643545-42643567 AATTAAATACAGAAGTTATTAGG - Intergenic
1151189101 17:72384873-72384895 ATTCACATTCAGCAGGTCTAGGG - Intergenic
1153375400 18:4371577-4371599 AATTAAAAACAGAAGTTATAAGG - Intronic
1153866828 18:9277779-9277801 AATCAAATACAGCAGAGTTGAGG + Intronic
1155593614 18:27456265-27456287 AATCACATAAAACATGTATATGG - Intergenic
1155595677 18:27483222-27483244 AATCAAATACCTCGGCTATAGGG - Intergenic
1156042730 18:32841455-32841477 AATCAAATAAAACAAGTGTACGG - Intergenic
1156523557 18:37743416-37743438 AATCATGTACAGCATGAATATGG - Intergenic
1158258425 18:55580939-55580961 TAAAAAATACAACAGGTATAAGG + Intronic
1159836881 18:73347838-73347860 AATCAAATCCAGTAGCTGTAGGG - Intergenic
1161076246 19:2287200-2287222 AACCAAATACAGCAGGATGAGGG + Intronic
1163055242 19:14713088-14713110 AGTCATCTACAGCAGGTATGAGG + Intronic
1168068540 19:53935236-53935258 AATCAAATTCAGGAAGTTTAAGG + Intronic
1168242929 19:55096254-55096276 CAGCAAACACAGAAGGTATAGGG - Exonic
925948730 2:8891370-8891392 AGTCCAACGCAGCAGGTATATGG + Intronic
926999307 2:18775856-18775878 AGTCATATATAGCATGTATATGG - Intergenic
929893582 2:45938824-45938846 AATCTAATACATCAGGAATAGGG - Intronic
930040487 2:47118864-47118886 AATCAACTACAGCATGTAGTAGG - Intronic
930404293 2:50935284-50935306 ACTTAAATACAGCAGAGATAAGG + Intronic
934635042 2:95977437-95977459 AAACAAATAAAGAAGGCATACGG + Intronic
935567238 2:104621497-104621519 AATCAAATAAAGCAGGGGTGTGG - Intergenic
936665172 2:114586510-114586532 AATAAAATACAACATGTAAAAGG + Intronic
938186709 2:129238648-129238670 AATGAACTAAAGCAGGTATCCGG + Intergenic
938216142 2:129517879-129517901 AAAAAAAAACAACAGGTATACGG - Intergenic
939346934 2:140977526-140977548 AATCAAATACACATGGTACAAGG + Intronic
940620731 2:156109855-156109877 CATCAAATACTGGGGGTATATGG + Intergenic
941027881 2:160478663-160478685 AATCAAATACAGGAGAAATTGGG - Intronic
941594953 2:167465045-167465067 ATTAAAATACAGCAGGTAGCAGG - Intergenic
942473099 2:176283175-176283197 AAGCAAATACAGGTGGTGTAGGG - Intronic
942781386 2:179647586-179647608 AAACAAAAAGAGCAGGTATGTGG + Intronic
942989988 2:182188852-182188874 AATCAAATATATCATGAATATGG + Intronic
943088660 2:183348009-183348031 AATCATAGACAGCTGCTATAAGG - Intergenic
943197020 2:184766018-184766040 AATGAAATACAGCATGTTTCTGG + Intronic
943259277 2:185637989-185638011 TATAAAATGCAGCAGGTAGAAGG - Intergenic
943488475 2:188519053-188519075 AAAAAAATACAGGAAGTATAAGG + Intronic
944330311 2:198457886-198457908 GATCAGATACAGCAGGTAAAGGG + Intronic
946542997 2:220706375-220706397 AATTAATTACAGATGGTATATGG + Intergenic
1168782804 20:508691-508713 AATCATTTACAGAAGGTATATGG + Intronic
1169689044 20:8309628-8309650 AATCAAAGGGAGCAGCTATAGGG + Intronic
1175021649 20:55857458-55857480 TATCTAATACTGCAGCTATATGG + Intergenic
1176896805 21:14388722-14388744 ATACAAATTCAGCAGGTAAATGG + Intergenic
1177222418 21:18211187-18211209 AACAAAATACAGCAGGAATGCGG - Intronic
1181868572 22:25879527-25879549 AATCAAAGAGAGAAGGCATAGGG - Intronic
1184053840 22:42030760-42030782 AACCAACTAGAGCAGGGATAAGG + Intronic
1185362275 22:50415493-50415515 AATCAAGTAAAGCAGCTAAAAGG - Intronic
1185394540 22:50579966-50579988 ACTCAAGAACAGCAGGTATGTGG - Exonic
951351819 3:21615559-21615581 AATAAAATACAGAAGTTAAATGG - Intronic
952583959 3:34868920-34868942 AATGAAAGAAAACAGGTATAAGG + Intergenic
953044140 3:39280488-39280510 ATTCTAATTCAGCAGATATAGGG - Intronic
954474027 3:50726358-50726380 AAGGAGATACAGGAGGTATAAGG + Intronic
956456793 3:69429633-69429655 CATGAAATAAAACAGGTATAAGG + Intronic
956599598 3:71005990-71006012 AATCAAACACAGGAGGAACACGG + Intronic
956808589 3:72842160-72842182 AAGAAAATACTTCAGGTATAAGG - Intronic
956979520 3:74619338-74619360 ATTCAGATTCAGCAGGTCTAGGG + Intergenic
957329493 3:78743340-78743362 AGTCAATTACAGCTGGTAGATGG - Intronic
960382131 3:116976117-116976139 ACTGAAATACAGCATGCATATGG + Intronic
960949086 3:122987355-122987377 ATTCAAAAACAGCATGTAAAAGG - Intronic
962448491 3:135491400-135491422 AATAAAATAAAGCAGGTTAAGGG + Intergenic
962737850 3:138341562-138341584 ATACAATTACAGCAGATATAAGG - Intergenic
963372281 3:144415947-144415969 AATCCAATAGAGAAGGTACAAGG + Intergenic
963932743 3:151021050-151021072 ATTCCAATTCAGCAGGTCTAGGG - Intergenic
964184501 3:153926207-153926229 AATAAAATAAAATAGGTATATGG - Intergenic
964445321 3:156752051-156752073 AATCAAAAACAGGAGGTTAAAGG - Intergenic
964574747 3:158153120-158153142 ATACAAATACAGAAGGTATAGGG - Intronic
965912216 3:173792573-173792595 AATAAAATACACAAGGTCTAAGG + Intronic
966321752 3:178708674-178708696 AATGAAATAAAGCAGGTAAAGGG - Intronic
968315916 3:197725309-197725331 AATTAAAAACAGCAAATATATGG - Intronic
969541333 4:7791502-7791524 TTTCAAATCCAGCAGGTATTAGG - Intronic
972195818 4:36652736-36652758 ATTCAAAAGCAGCAGGTGTATGG - Intergenic
973881409 4:55274916-55274938 AATCAAAGACGGCAGGTGTCAGG + Intergenic
974610993 4:64215189-64215211 AATGAATTACAGCATGTATAGGG + Intergenic
974873176 4:67669253-67669275 AATCAACTAGAGAAGGTAAAAGG + Intronic
975915112 4:79315567-79315589 AATAAAATATAGCTAGTATAAGG + Intronic
976303044 4:83533825-83533847 AAACAAATACAGTAAGTAAAGGG + Intergenic
979233127 4:118369041-118369063 AATCAAAAACAGCAAGTCTGAGG - Intergenic
979505617 4:121492435-121492457 AATCAAGTCAGGCAGGTATATGG - Intergenic
981290095 4:143064920-143064942 TATTAAAAACAGCTGGTATAAGG + Intergenic
981574256 4:146187727-146187749 AATCAAAGACAGCAGGGAAACGG - Intronic
982928099 4:161365667-161365689 AATCAAATACATGAGGTTTGAGG - Intergenic
983961753 4:173762655-173762677 AATCAAACACAGCAGATCTTTGG + Intergenic
984492516 4:180453255-180453277 AATTAAATACAGCAAGTGTTAGG - Intergenic
987898228 5:23977429-23977451 TTTCAAATACAGCAGGGATGTGG - Intronic
990576477 5:57128266-57128288 AATCTAAAAAAGGAGGTATATGG - Intergenic
991163941 5:63539702-63539724 AAGAAAATACTTCAGGTATAAGG + Intergenic
992084432 5:73265236-73265258 AATATAATACAGCAGGGATTAGG + Intergenic
992133789 5:73721736-73721758 AATCAAAAACAGCTAGTTTAGGG - Intronic
993179751 5:84537254-84537276 TATCAAATCCTGCATGTATAAGG - Intergenic
994720711 5:103376815-103376837 AATGAACTACAGCAGGGATCAGG - Intergenic
995064637 5:107846128-107846150 AAACCAATACATCAGGGATATGG + Intergenic
996498870 5:124193832-124193854 AATCAAATAGAACTTGTATAGGG + Intergenic
998139353 5:139691002-139691024 AAATAAATACAGCAGGTCCAGGG - Intergenic
999146299 5:149397902-149397924 AAACAAATACAGAAGGCAAATGG - Intronic
1000913834 5:167055755-167055777 AAGCAATTACAGCAGTTAGAAGG - Intergenic
1001233192 5:170007689-170007711 AGTGAAATAGAGCAGGTAAAGGG - Intronic
1005870135 6:29969079-29969101 ACTCAAATCTAGCAGGTATTTGG - Intergenic
1008449214 6:51630759-51630781 TATAAAATACAGAAGGTATAAGG + Intronic
1008478425 6:51958649-51958671 AATCAAATTCTGCAGGAGTATGG - Intronic
1008786208 6:55171696-55171718 CATAAAATAAAGCAGGTATCAGG + Intronic
1009885526 6:69619501-69619523 ACTCAAATCCAGCAGCTATTTGG + Intergenic
1013933818 6:115569486-115569508 AAGCAAATATACCAGGCATACGG + Intergenic
1016222327 6:141690191-141690213 AATAAAATAAAGTAAGTATAAGG + Intergenic
1016777798 6:147924069-147924091 AACCAAATAACACAGGTATATGG - Intergenic
1017128768 6:151090421-151090443 ATTCAAATGCAGCAGGTCTGGGG + Intronic
1018658950 6:166067379-166067401 AAACAAAAACAACAGATATAAGG - Intergenic
1020229469 7:6306648-6306670 AATCATATAAAGCATGTATGAGG - Intergenic
1021165477 7:17334613-17334635 AATCTAATAGAGCAGATGTATGG - Intronic
1021731456 7:23599214-23599236 AATCAGGCACAACAGGTATAGGG - Intronic
1023334223 7:39151660-39151682 ACTCAAATAAGGCAGATATATGG + Intronic
1024843535 7:53615772-53615794 ATTCTGATACAGCAGGTATCTGG + Intergenic
1024868698 7:53935305-53935327 AATAAAATACACAAGGTAAATGG + Intergenic
1028023351 7:85806365-85806387 AATCTGATACAGCAGGACTAGGG + Intergenic
1028253314 7:88560904-88560926 AATAAAAGACAGTAGGTATGGGG - Intergenic
1028495722 7:91457607-91457629 AAACTAACACAGCAGGTACATGG + Intergenic
1029822498 7:103159431-103159453 AAGCAGAGATAGCAGGTATAAGG + Intergenic
1029830687 7:103254994-103255016 AATTAAATACAGCAGCAATCTGG - Intergenic
1030519880 7:110585603-110585625 ATTGAAATACATCAGATATATGG + Intergenic
1030940500 7:115641117-115641139 AATAAAATACAGAATGAATATGG - Intergenic
1031661065 7:124424899-124424921 AACCTAATACAACAGGTAAATGG - Intergenic
1033226183 7:139564209-139564231 AATAAATGACAGCAGATATATGG + Exonic
1035491000 7:159278391-159278413 AATCAAATAGAGAAGGAAAATGG + Intergenic
1039210573 8:35208186-35208208 AACAAAATACAGCTGGTAAATGG - Intergenic
1039930800 8:41986735-41986757 AATCAAATACAGCCCACATATGG + Intronic
1041855523 8:62449336-62449358 AATGGAATACAGCAGGTGGATGG - Intronic
1041968942 8:63714509-63714531 TATAAAATACAGCAGCTATATGG + Intergenic
1043045236 8:75314798-75314820 AAAACAATACAGCAGGGATAGGG - Intergenic
1043289096 8:78573410-78573432 AATCAAAGTGAGCACGTATAGGG + Intronic
1043846599 8:85170718-85170740 AATCTAATACAGCTGTTAAAAGG + Intergenic
1051059812 9:13032874-13032896 ACTCAAAAACAGCAGGTAGTAGG - Intergenic
1054935514 9:70683600-70683622 ATCCAAATACAGCAGATAGATGG - Intronic
1054945048 9:70786785-70786807 GATATAAAACAGCAGGTATAGGG - Intronic
1057720610 9:97528853-97528875 AAACAAAAACAGGAGGAATATGG - Intronic
1058369107 9:104244185-104244207 AAACAAATATAGGATGTATAAGG + Intergenic
1059173056 9:112144837-112144859 TATCAGAGGCAGCAGGTATAGGG + Intronic
1060282186 9:122222028-122222050 AATGAGATAAAGCAGGTAAAGGG + Intronic
1187209041 X:17210701-17210723 ATTCCAATTCAGCAGGTCTAGGG - Intergenic
1190406668 X:50094966-50094988 CAACAAATACAGCCAGTATAGGG + Exonic
1190498404 X:51050872-51050894 AATCAAAAACAGAAGGAATTTGG + Intergenic
1191047141 X:56150592-56150614 CATCCAACACAGCAGGTCTAGGG - Intergenic
1194062301 X:89218624-89218646 AATCGAAGACATCAGGGATAAGG - Intergenic
1194610579 X:96037931-96037953 AATAAAATGCAGCAAGAATAAGG - Intergenic
1198722517 X:139638129-139638151 AATCTATTACAGCAGCAATAGGG + Intronic
1198975548 X:142332126-142332148 AATCAGAATCAGTAGGTATAGGG + Intergenic
1199098731 X:143772731-143772753 GATCAACTTCAGGAGGTATAAGG - Intergenic
1199409560 X:147504973-147504995 AGGCTAATACAACAGGTATAAGG + Intergenic
1200716168 Y:6547590-6547612 AATCGAAGACATCAGGGATAAGG - Intergenic