ID: 1131217095

View in Genome Browser
Species Human (GRCh38)
Location 15:90546925-90546947
Sequence CACCTGCTAGGATTTTAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131217088_1131217095 21 Left 1131217088 15:90546881-90546903 CCAGAGTGCTGGGATTACAGGCG 0: 3126
1: 130507
2: 274724
3: 221599
4: 153552
Right 1131217095 15:90546925-90546947 CACCTGCTAGGATTTTAAACAGG 0: 1
1: 0
2: 1
3: 11
4: 121
1131217087_1131217095 22 Left 1131217087 15:90546880-90546902 CCCAGAGTGCTGGGATTACAGGC 0: 5645
1: 226181
2: 272263
3: 183265
4: 143363
Right 1131217095 15:90546925-90546947 CACCTGCTAGGATTTTAAACAGG 0: 1
1: 0
2: 1
3: 11
4: 121
1131217090_1131217095 -6 Left 1131217090 15:90546908-90546930 CCACAACGCCCGGCCAACACCTG 0: 1
1: 0
2: 18
3: 194
4: 1525
Right 1131217095 15:90546925-90546947 CACCTGCTAGGATTTTAAACAGG 0: 1
1: 0
2: 1
3: 11
4: 121
1131217085_1131217095 25 Left 1131217085 15:90546877-90546899 CCTCCCAGAGTGCTGGGATTACA 0: 7837
1: 299856
2: 263617
3: 151465
4: 134888
Right 1131217095 15:90546925-90546947 CACCTGCTAGGATTTTAAACAGG 0: 1
1: 0
2: 1
3: 11
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131217095 Original CRISPR CACCTGCTAGGATTTTAAAC AGG Intronic
906820908 1:48929013-48929035 TACCTGCTAGGATTTTAGATTGG + Intronic
909091325 1:71229358-71229380 CCCCAACAAGGATTTTAAACAGG - Intergenic
911431462 1:97793316-97793338 CATCTGCTAGGATTTTGATTGGG - Intronic
918778360 1:188666674-188666696 TCCCTGTTAGGCTTTTAAACAGG - Intergenic
923646962 1:235832894-235832916 CATATTCTAGGATTTAAAACTGG + Intronic
1063594662 10:7423253-7423275 CACCTGGTATTTTTTTAAACTGG - Intergenic
1066634259 10:37485376-37485398 CCCCTGATATGATTTTGAACAGG + Intergenic
1067394677 10:45903697-45903719 CACTTGCTCGTATTTTAAAATGG - Intergenic
1067863000 10:49872828-49872850 CACTTGCTCGTATTTTAAAATGG - Intronic
1074665964 10:115724629-115724651 CAACAGCTGGGATTTAAAACAGG + Intronic
1075495705 10:122916916-122916938 CCCCTGCAAGGATTTCTAACAGG - Intergenic
1076019922 10:127064439-127064461 CTCCAGCTAGAATTTTCAACAGG + Intronic
1079435881 11:20449159-20449181 CATCTGCTAATATTTTTAACTGG + Intronic
1080348213 11:31349941-31349963 CACTAACTAGGATATTAAACAGG - Intronic
1082062672 11:47874066-47874088 CACCAGCTAGGAGTTTCTACAGG + Intergenic
1084441620 11:69177542-69177564 CACTTAATAGAATTTTAAACCGG + Intergenic
1085349696 11:75790570-75790592 CACCTGCTTGGGTTTCACACTGG + Intronic
1091777011 12:3191230-3191252 CACCTGTACAGATTTTAAACTGG + Intronic
1092553797 12:9533254-9533276 CAGCTGCTAGAATTCTACACTGG - Intergenic
1099777606 12:87152930-87152952 TATCTGCTAGCATTTTAAAATGG + Intergenic
1100178988 12:92063189-92063211 CACCTGCAAGTATATTAAAGAGG + Intronic
1100894589 12:99166713-99166735 CACCTGCTGGGATTTTGATTAGG - Intronic
1101840674 12:108325420-108325442 CACCTGCCAGGAGTCTACACAGG - Intronic
1106181420 13:27372685-27372707 AACCTGCGAGGTTGTTAAACTGG + Intergenic
1106827433 13:33539360-33539382 CATCTGCTGGGATTTTGAATGGG - Intergenic
1107070655 13:36265119-36265141 GAGCTGCTAGAATTGTAAACTGG - Intronic
1108517572 13:51217565-51217587 CACCTGCTAGGCTTGTGAACTGG - Intergenic
1108718759 13:53108347-53108369 CAGCTGCTAGGATTATAAAATGG + Intergenic
1108982240 13:56530361-56530383 CATCTGTTAAGATTTTTAACAGG - Intergenic
1111040798 13:82744694-82744716 CATATCCTAGGATTTTAAATTGG - Intergenic
1112843693 13:103611511-103611533 CACCTCATAAGATTTTAAATGGG - Intergenic
1115027728 14:28763703-28763725 CACCTGCTAAAATTTTATACAGG + Intergenic
1117798205 14:59416369-59416391 CAACTGCTGGGAGTGTAAACTGG - Intergenic
1118581123 14:67299089-67299111 TACCTGCTAGAATCATAAACAGG - Intronic
1120396187 14:83970147-83970169 CACGTGCCTGGATTTTGAACAGG + Intergenic
1121384595 14:93508422-93508444 ATCCTGCTGGGATTTTAATCTGG + Intronic
1128507576 15:68286509-68286531 AACCTGCTAGGATTTTCATTTGG + Intronic
1130804010 15:87299546-87299568 AAGCTGCTAGGATTTTATATAGG - Intergenic
1131217095 15:90546925-90546947 CACCTGCTAGGATTTTAAACAGG + Intronic
1131664735 15:94558178-94558200 CACCTGCAACGATTTTGAACAGG - Intergenic
1133922851 16:10169541-10169563 CACCTCCTAGCATTCAAAACTGG - Intronic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1136710459 16:32232780-32232802 CACATGGTAGGAGTTGAAACAGG - Intergenic
1136757452 16:32696631-32696653 CACATGGTAGGAGTTGAAACAGG + Intergenic
1136810654 16:33173744-33173766 CACATGGTAGGAGTTGAAACAGG - Intergenic
1136817130 16:33283824-33283846 CACATGGTAGGAGTTGAAACAGG - Intronic
1136823695 16:33340355-33340377 CACATGGTAGGAGTTGAAACAGG - Intergenic
1138940207 16:61781346-61781368 CTCCTGCTGGGATTACAAACAGG - Intronic
1140912124 16:79463639-79463661 CACCTGCTCTGACTTAAAACAGG - Intergenic
1203059601 16_KI270728v1_random:956980-957002 CACATGGTAGGAGTTGAAACAGG + Intergenic
1143965445 17:10753637-10753659 CCCCTGCTGATATTTTAAACTGG - Intergenic
1144075809 17:11718457-11718479 CCCCTCCTAGGAATTTACACAGG - Intronic
1146237885 17:31185220-31185242 GACCTGCTAGGACTTTAGTCTGG - Intronic
1146474893 17:33154858-33154880 CACCTGTTAGGAAATTAAAAAGG - Intronic
1148349133 17:46926999-46927021 CAGCTGGTAGGATTATAAATTGG - Intronic
1148744025 17:49908485-49908507 CAGCTGCTAGGATTTTGGTCAGG - Intergenic
1150015835 17:61555976-61555998 CACATACTAGGATTTTTAAAAGG - Intergenic
1151466599 17:74289672-74289694 CTCCTGCTTGGATTTTCAGCGGG + Exonic
1158143530 18:54283992-54284014 TACTTGCTAGTCTTTTAAACAGG + Exonic
1163638431 19:18448688-18448710 CACCAGCTAGGATGACAAACGGG + Intronic
926096557 2:10084957-10084979 CTCCGGCTAGGAATTTAGACCGG + Intronic
926247958 2:11134353-11134375 CACCATCCAGGATTTTAAGCGGG + Intronic
927316303 2:21687084-21687106 CACTTGCTAGGATGTGATACTGG + Intergenic
931598233 2:63974478-63974500 CAACTGCTAGGATTTTAATCAGG + Intronic
933864886 2:86507217-86507239 CTGCTGTTGGGATTTTAAACTGG - Intronic
933982494 2:87563543-87563565 AACCTGCTGGGATTTTGAATTGG - Intergenic
935364342 2:102273377-102273399 AACCTGCTAGGATTTTCAATGGG + Intergenic
936311348 2:111387250-111387272 AACCTGCTGGGATTTTGAATTGG + Intergenic
937375605 2:121333816-121333838 CATCTCCTAGGATTTTACAGAGG + Intergenic
937497636 2:122440224-122440246 CACCTGCTAGGATATTAATTAGG - Intergenic
938706473 2:133933045-133933067 AACCTGCTGAGATTTTAATCAGG + Intergenic
940505923 2:154553427-154553449 CACCAGCTTGTATTTTACACTGG - Intergenic
940794473 2:158062454-158062476 CACGTGCAAGGTTTTTAACCAGG + Intronic
941062105 2:160858719-160858741 CACTTGCCAGGATTTTTAATTGG - Intergenic
942600194 2:177633151-177633173 CACCTGCAAGGTGTTTACACGGG - Intronic
943607199 2:189989962-189989984 AGCCTGCTAGGATTTTAATAGGG - Intronic
943675286 2:190710952-190710974 CACCTGCTTGGCTTCTAAAAAGG + Intergenic
943849183 2:192694481-192694503 CACATGCTAGGAGTTAAAAGGGG + Intergenic
948037700 2:234872669-234872691 CACCTGCTAGAATTTTCAGCAGG - Intergenic
1170033666 20:11968181-11968203 CATCTTCAAGAATTTTAAACTGG - Intergenic
1177081635 21:16646101-16646123 AGCCTGCTGGGATTTTGAACAGG + Intergenic
1177520857 21:22222791-22222813 AACTTGCTAGAATTTTAAATGGG + Intergenic
1179573263 21:42291019-42291041 CGCCTGTTGGGATGTTAAACGGG + Intronic
1180691792 22:17722732-17722754 AACCTGGTAGGATTTTATATTGG + Intronic
1181130496 22:20728789-20728811 CATCTGGTGGGATTCTAAACAGG + Intronic
1182147915 22:28008408-28008430 AAGTTTCTAGGATTTTAAACAGG + Intronic
1182328577 22:29533150-29533172 CACCTGCTGGGATTTTGACAGGG - Intronic
1183089795 22:35514072-35514094 CAACTGCTAGGATTTTAGCCTGG + Intergenic
949805598 3:7952452-7952474 CACCTGAATGCATTTTAAACAGG + Intergenic
950277009 3:11670386-11670408 AAAGTGCTAGCATTTTAAACTGG - Intronic
957236861 3:77604190-77604212 CATCTGTTATGAATTTAAACAGG + Intronic
957460853 3:80517975-80517997 CACCTGGTGGGATTGTAGACTGG - Intergenic
959428799 3:106225727-106225749 TACCTGCTGGGATTTTGAATGGG + Intergenic
963185366 3:142409693-142409715 AACCTGCTAGGATTTTCACTGGG + Intronic
969082458 4:4629480-4629502 CTCCTGCTAGGAATTCAAAATGG - Intergenic
977809533 4:101344780-101344802 CACATCCTATGATTTAAAACAGG + Intronic
978079127 4:104570200-104570222 TACCTGCTAGGCTGTTAATCTGG + Intergenic
980755824 4:137158791-137158813 AACCTGCTGGGATTTTAAATGGG + Intergenic
989473056 5:41843229-41843251 CACCTGTTGAGATTTTAAATGGG + Intronic
990938454 5:61175568-61175590 AACCTGATGGGATTTTAAAAAGG - Intergenic
991942913 5:71871571-71871593 CAGCTGCTTGGATTTTAAATGGG - Intergenic
994366869 5:98927977-98927999 CTCCTGCTAAGTTTTTAAAGCGG + Intronic
995240282 5:109877510-109877532 CACCTGCTTGGAATAAAAACAGG + Intergenic
995363770 5:111330440-111330462 ATCCTGCTAGGATTTTAATTAGG - Intronic
1000099866 5:158005496-158005518 CACCTGTTAGGATTTGATAATGG - Intergenic
1002365904 5:178710694-178710716 AACCTGCTAGCACTTTAAATGGG - Intergenic
1004220478 6:13742543-13742565 CACCTCCTTGGATTCTAACCTGG - Intergenic
1005634542 6:27740775-27740797 CAGTTCCTAGCATTTTAAACAGG + Intergenic
1009560064 6:65228639-65228661 TACCTGCTAGGATTTTCACTGGG - Intronic
1010766877 6:79785263-79785285 CAGCAGATAGGGTTTTAAACTGG - Intergenic
1014667488 6:124257681-124257703 CATTTGCTAGGTTTTGAAACAGG - Intronic
1025149638 7:56538675-56538697 CACATGCTAGGATTCTAGTCCGG - Intergenic
1026794095 7:73354712-73354734 CATCTGCTGGGATTTTGAAGAGG + Intronic
1033103307 7:138496135-138496157 CCCCTGCTGGGATTTTAATTGGG + Intronic
1034775926 7:153826601-153826623 CACCTGCTAGGAAATTAATTTGG + Intergenic
1034861104 7:154595463-154595485 CCCATCCTAGGATTATAAACTGG + Intronic
1035135008 7:156695014-156695036 CATCTGCTAGGATTTTGACTGGG - Intronic
1040615591 8:49034255-49034277 CACCTGCTTGGTCTTAAAACAGG + Intergenic
1040697403 8:50018121-50018143 CACTTGCTAGGATTTTTACAGGG - Intronic
1040830125 8:51666876-51666898 TGCCTGGAAGGATTTTAAACTGG - Intronic
1045227373 8:100262459-100262481 CTACTTCTAGGCTTTTAAACTGG - Intronic
1046592375 8:116221651-116221673 CTCCTGCTAAGAGTTTTAACAGG + Intergenic
1046689087 8:117262732-117262754 GACCTGCTAAGATTGGAAACTGG + Intergenic
1047838596 8:128721505-128721527 CACATGCTGGGATTCTGAACAGG + Intergenic
1048203603 8:132397606-132397628 CATCAGCTATGAATTTAAACAGG + Intronic
1049518791 8:143077719-143077741 CACCTCCTAGGATTGAAATCAGG + Intergenic
1050162843 9:2735891-2735913 CACATGCTAGGATGACAAACAGG - Intronic
1050572877 9:6959547-6959569 CAGCTGGTAGGTTTTTACACTGG + Intronic
1055446600 9:76389886-76389908 AACCTGCTAGGATTTTGATTGGG - Intronic
1055694188 9:78865187-78865209 CACCTGCCAGGATAATAAGCAGG + Intergenic
1060753223 9:126188715-126188737 AACCTGCTAGGATTTTTACTAGG - Intergenic
1185999100 X:4988748-4988770 CACCTGCTAGGTTACTGAACAGG - Intergenic
1194113436 X:89867364-89867386 CACCAGCTAGAAGTTTAACCAGG + Intergenic
1196502851 X:116405636-116405658 TACATGAAAGGATTTTAAACAGG - Intergenic